Application of transcription factor NR2F1 in regulation and control of tyrosine hydroxylase synthesis

Abstract

The invention belongs to the technical field of biology, and particularly relates to application of a transcription factor NR2F1 in regulation and control of tyrosine hydroxylase synthesis. The transcription factor NR2F1 is combined with a tyrosine hydroxylase coding gene promoter region to interact with a TH gene to regulate the expression of the TH gene, and the transcription factor NR2F1 has an important regulation effect on synthesis of tyrosine hydroxylase and provides a new target and a new idea for clinical treatment of tyrosine hydroxylase imbalance related diseases.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to use of a transcription factor NR2F1 in regulating the synthesis of tyrosine hydroxylase. Background Art

[0002] Tyrosine hydroxylase (TH), also known as tyrosine 3-monooxygenase, is present in high levels in the substantia nigra of the brain. It is an iron-containing multifunctional monooxygenase whose function is mainly achieved by molecular oxygen and the coenzyme tetrahydrobiopterin. Tyrosine hydroxylase is a tetrameric structure with high specificity. TH is the first step in catalyzing the synthesis of catecholamine neurotransmitters and is the rate-limiting enzyme for dopamine synthesis. TH works through the coordination of the catalytic subdomain and the regulatory subdomain, and then synthesizes catecholamine neurotransmitters. Research on TH is of great significance to the research of myocardial infarction, hypertension, mental illness and Parkinson's disease.

[0003] TH gene expression is regulated by many factors. Currently, the transcription factors that interfere with tyrosine hydroxylase expression are not fully understood. The specific target sequences and mechanisms of action of transcription factors are unknown, which is not conducive to regulating tyrosine hydroxylase synthesis in many ways. Therefore, in-depth analysis of the molecular mechanism of tyrosine hydroxylase synthesis, including the transcriptional regulation mechanism, provides new targets and ideas for the clinical treatment of Parkinson's and other diseases. Summary of the invention

[0004] In view of the deficiencies of the prior art, the present invention clarifies the use of transcription factor NR2F1 in regulating the synthesis of tyrosine hydroxylase.

[0005] In a first aspect, the present invention provides the use of transcription factor NR2F1 in preparing a reagent for regulating the expression of tyrosine hydroxylase encoding gene TH.

[0006] Preferably, the transcription factor NR2F1 specifically binds to the promoter region of the TH gene encoding tyrosine hydroxylase.

[0007] Preferably, the promoter of gene TH contains a sequence that can be recognized by the transcription factor NR2F1, and the sequence is 5'-AGGTCA(N) n GGTCA-3', wherein N is A, T, C or G, and n is an integer of 0-100.

[0008] Preferably, the gene TH promoter capable of being recognized and activated by NR2F1 contains the following sequence: 5'-AGGTCACCCCAGGGTCA-3'.

[0009] In a second aspect, the present invention provides the use of regulating the activity and / or expression of transcription factor NR2F1 in preparing a reagent for increasing the synthesis of tyrosine hydroxylase.

[0010] Preferably, the transcription factor NR2F1 specifically binds to the promoter region of the TH gene encoding tyrosine hydroxylase.

[0011] Preferably, the promoter of gene TH contains a sequence that can be recognized by the transcription factor NR2F1, and the sequence is 5'-AGGTCA(N) n GGTCA-3', wherein N is A, T, C or G, and n is an integer of 0-100.

[0012] Preferably, the gene TH promoter capable of being recognized and activated by NR2F1 contains the following sequence: 5'-AGGTCACCCCAGGGTCA-3'.

[0013] In a third aspect, the present invention provides a method for increasing the synthesis of tyrosine hydroxylase, the method comprising regulating the activity and / or expression of transcription factor NR2F1 in a cell, or editing the transcription factor NR2F1 gene.

[0014] In a fourth aspect, the present invention provides use of a transcription factor NR2F1 regulator in the preparation of a method for treating diseases associated with tyrosine hydroxylase imbalance.

[0015] Preferably, the tyrosine hydroxylase imbalance-related disease includes Parkinson's disease.

[0016] The beneficial effects of the present invention are:

[0017] The present invention identifies for the first time that the transcription factor NR2F1 can bind to the promoter region of the tyrosine hydroxylase encoding gene TH and regulate its expression, thereby affecting the synthesis of tyrosine hydroxylase, thereby exploring and developing new potential therapeutic targets for Parkinson's disease from the NR2F1-TH transcriptional regulatory mechanism. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Schematic diagram of NR2F1 binding to the NR2F1 binding site in the TH promoter region.

[0019] Figure 2 It is an agarose gel electrophoresis diagram of the chromatin immunoprecipitation analysis in Example 2, wherein lane 1 is a 100 bp DNA ladder, lanes 2 to 5 are SH-SY5Y cells transfected with pcDNA4-hNR2F1, and the results shown are input (lane 2), histone H3 antibody IP positive control (lane 3), IgG negative control (lane 4), and NR2F1 antibody IP product (lane 5).

[0020] Figure 3 Schematic diagram of NR2F1 regulating the promoter activity of TH in Example 3, wherein pGL3-Basic is an empty vector control; pGL3-hTH is a luciferase reporter gene plasmid pGL3-hTH promoter in the TH promoter region; pGL3-hTH pcDNA4 is a co-transfection of a luciferase reporter gene plasmid pGL3-hTH in the TH promoter region and a vector control plasmid pcDNA4-Vector; pGL3-hTH pcDNA4-NR2F1 is a co-transfection of a luciferase reporter gene plasmid pGL3-hTH in the TH promoter region and a NR2F1 overexpression plasmid pcDNA4-NR2F1. DETAILED DESCRIPTION

[0021] In order to make the technical solutions and beneficial effects of the present invention more clearly understandable, the following is a detailed description by listing specific embodiments. The drawings are not necessarily drawn to scale, and local features may be enlarged or reduced to more clearly show the details of the local features; unless otherwise defined, the technical and scientific terms used herein have the same meanings as those in the technical field to which this application belongs.

[0022] Tyrosine hydroxylase (TH) is the rate-limiting enzyme for dopamine synthesis in the brain, and its gene proximal promoter (<1kb upstream of the transcription start site) is very important for transcriptional regulation. The inventors conducted extensive and in-depth analysis of the promoter sequence and found that there was a potential core binding site of NR2F1 of AGGTCA-GGTCA at -911 to -895bp upstream of its transcription start site (the transcription start site is +1).

[0023] The present application constructed a luciferase expression plasmid in the TH promoter region. The luciferase assay results indicated that overexpression of NR2F1 could significantly increase the activity of the TH promoter. Further ChIP results confirmed that NR2F1 could bind to the above-mentioned site in the TH promoter region, thereby regulating the transcriptional activity of the TH promoter.

[0024] In a first aspect, the present invention provides the use of transcription factor NR2F1 in preparing a reagent for regulating the expression of tyrosine hydroxylase encoding gene TH.

[0025] In certain embodiments, the transcription factor NR2F1 specifically binds to the promoter region of the tyrosine hydroxylase encoding gene TH.

[0026] In some embodiments, the promoter of the gene TH contains a sequence that can be recognized by the transcription factor NR2F1, and the sequence is 5'-AGGTCA (N) nGGTCA-3', wherein N is A, T, C or G, and n is an integer of 0-100.

[0027] In certain embodiments, the gene TH promoter capable of being recognized and activated by NR2F1 contains the following sequence: 5'-AGGTCACCCCAGGGTCA-3'.

[0028] In a second aspect, the present invention provides the use of regulating the activity and / or expression of transcription factor NR2F1 in preparing a reagent for increasing the synthesis of tyrosine hydroxylase.

[0029] In certain embodiments, the transcription factor NR2F1 specifically binds to the promoter region of the tyrosine hydroxylase encoding gene TH.

[0030] In some embodiments, the promoter of the gene TH contains a sequence that can be recognized by the transcription factor NR2F1, and the sequence is 5'-AGGTCA (N) n GGTCA-3', wherein N is A, T, C or G, and n is an integer of 0-100.

[0031] In certain embodiments, the gene TH promoter capable of being recognized and activated by NR2F1 contains the following sequence: 5'-AGGTCACCCCAGGGTCA-3'.

[0032] In the present application, the gene TH promoter sequence that can be recognized and activated by NR2F1 is shown as SEQ ID NO:1.

[0033] SEQ ID NO:1

[0034] GGGGTTGTCCTCAAGGGAGTTCTC AGGTCA CCCCAG GGTCA CCCTCAACCCGGGGCCTGG

[0035] In a third aspect, the present invention provides a method for increasing tyrosine hydroxylase synthesis, the method comprising regulating and editing the transcription factor NR2F1 gene.

[0036] In a fourth aspect, the present invention provides use of a transcription factor NR2F1 regulator in the preparation of a method for treating diseases associated with tyrosine hydroxylase imbalance.

[0037] In certain embodiments, the disease associated with tyrosine hydroxylase imbalance comprises Parkinson's disease.

[0038] The following definitions and explanations are explanations of the terms used in the present invention; when describing the present invention, unless otherwise specified, the technical and scientific terms used herein should have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs, and the disclosures and documents mentioned herein are incorporated herein by reference.

[0039] As used herein, the terms "include" or "comprising" mean that the method, structure or composition includes any of the steps / operations, parts, components, etc. mentioned in the examples, but does not exclude any other steps / operations, parts, components.

[0040] In the context of the present invention, when referring to a numerical range, it is understood that the upper and lower limits of the range, and each intermediate value therebetween, and any other specified values ​​or intermediate values ​​within the range are included in the present invention. The upper and lower limits of these smaller ranges that may be independently included in the range are also included in the present invention, subject to any explicit exclusions in the specified range. When a specified range includes one or both of the limiting values, the range excluding either of the two including the limiting values ​​is also within the present invention.

[0041] As used herein, "transcription factor NR2F1", the full name of which is Nuclear Receptor Subfamily 2 Group F Member 1, is a protein encoded by the NR2F1 gene in the human genome. It belongs to the nuclear receptor superfamily and is involved in regulating gene expression and transcription.

[0042] As used herein, the term "TH gene" is located in band 5 (11p15.5) of region 1 of the short arm of human chromosome 11, with a coding region cDNA length of 1827 bp, containing 13 exons, encoding tyrosine hydroxylase. Mutations in the TH gene may lead to tyrosine hydroxylase deficiency or impaired function, and are associated with some nervous system-related diseases such as Parkinson's disease, autism, attention deficit hyperactivity disorder, and schizophrenia. In the present application, the gene TH sequence (NM_000360) is about 7887 bp long.

[0043] The present invention is further described below by specific examples. Unless otherwise specified herein, "%" represents mass percentage. The materials and reagents in the following examples, unless otherwise specified, are all commonly used materials or reagents in the art, and can be obtained from commercial sources or synthesized by known methods. The experimental methods for which the conditions are not specified in the following implementation cases are usually carried out according to conventional experimental conditions or the conditions recommended by the manufacturers of the relevant reagents (kits).

[0044] Example 1

[0045] Methylated DNA immunoprecipitation combined with high-throughput sequencing (MeDIP-seq) and chemical labeling and affinity purification combined with high-throughput sequencing (hMe-Seal) were used to detect whole-genome methylation and hydroxymethylation modifications in substantia nigra brain tissue of PD patients. The findMotifsGenome.pl module in Homer software (v4.10) was used to identify potential transcription factors in differentially hydroxymethylated regions of promoter regions. This command was compared with randomly selected background genomic regions (enrichment threshold: q-value (Benjamini) < 0.05) to determine the motifs enriched in specific regions. The results suggested that there was enrichment of potential binding motifs of transcription factors such as NR2F1 in differentially hydroxymethylated regions.

[0046] Example 2

[0047] Analysis of the TH gene promoter sequence revealed that the TH transcription start site was located at -911 to -895 bp upstream (see Figure 1 ) There is a potential core binding site of NR2F1 of AGGTCA-GGTCA (NM_000360, with the transcription start site as +1). Chromatin immunoprecipitation assay (ChIP) was used to confirm the binding of NR2F1 to the NR2F1 binding site in the TH promoter region.

[0048] use Enzymatic Chromatin IP Kit (Magnetic Beads) is completed. The brief steps are as follows:

[0049] SHSY5Y cells were transfected with pcDNA4-hNR2F1, and 270 μl of 37% formaldehyde was added after 24 hours. After standing for 10 min, 10╳Glycine Solution was added to terminate the cross-linking reaction. The cells were washed with pre-cooled 1×PBS, and then the prepared pre-cooled PBS and protease inhibitors were added. The cells were scraped with a cell brush and transferred to an EP tube. The cells were centrifuged at 2000 rpm and 4°C for 5 min. The cells were lysed and ultrasonically treated according to the instructions of the kit. The ultrasonic lysis products were centrifuged and the supernatant was transferred to prepare for immunoprecipitation. The antibodies were incubated in groups, and IgG, NR2F1 antibody (Invitrogen, PA5-30190) in the kit and histone H3 antibody in the kit were added as negative control, test group and positive control, respectively. The chromatin was eluted with magnetic beads and DNA was purified by column before PCR detection. PCR amplification was performed using T6 SuperPCR Mix (1.1×) Gold Mix (Green) kit, the reaction system contains 40 μl of gold mix, 2 μl of forward / reverse primers, 6 μl of template DNA, the target fragment of NR2F1 ChIP-PCR product is 159 bp, the primers are TH promoter region specific primers, the forward primer sequence is: 5'-GACATGGAACTTGGGGGAGG-3' (SEQ ID NO: 2), the reverse primer sequence is: 5'-TTGGAGAGACCTTTGCAGTTTC-3' (SEQ ID NO: 3), the histone H3 ChIP-PCR primer is provided by the kit (target fragment 160 bp), the obtained PCR product is subjected to agarose gel electrophoresis (see Figure 2 ). Lane 1 is a 100bp DNA ladder, lanes 2 to 5 are SH-SY5Y cells transfected with pcDNA4-hNR2F1, and the results shown are input (lane 2), histone H3 antibody IP positive control (lane 3), IgG negative control (lane 4), and NR2F1 antibody IP product (lane 5). The results showed that NR2F1 antibody can immunoprecipitate TH promoter, indicating that NR2F1 binds to the NR2F1 binding site in the TH promoter region.

[0050] Example 3

[0051] HEK293 cells were co-transfected with NR2F1 overexpression plasmid pcDNA4-NR2F1 and TH promoter luciferase reporter gene plasmid pGL3-hTH promoter to detect TH promoter activity and explore whether NR2F1 can upregulate TH promoter activity.

[0052] TH promoter region luciferase reporter gene plasmid pGL3-hTH promoter and pRL-TK (internal standard) were co-transfected with NR2F1 overexpression plasmid pcDNA4-NR2F1 or vector control plasmid pcDNA4-Vector into HEK293 cells. After 24 hours of co-transfection, the promoter activity was detected using Dual-luciferase reporter assay system (Promega). The results are shown in Figure 3, pGL3-Basic is an empty vector control; pGL3-hTH is a luciferase reporter gene plasmid pGL3-hTH in the TH promoter region; pGL3-hTH pcDNA4 is a luciferase reporter gene plasmid pGL3-hTH in the TH promoter region and a vector control plasmid pcDNA4-Vector co-transfected; pGL3-hTH pcDNA4-NR2F1 is a luciferase reporter gene plasmid pGL3-hTH in the TH promoter region and a NR2F1 overexpression plasmid pcDNA4-NR2F1 co-transfected. The results showed that the overexpression plasmid pcDNA4-NR2F1 significantly increased the promoter activity of the luciferase reporter gene plasmid pGL3-hTH in the TH promoter region, indicating that NR2F1 can upregulate the promoter activity of TH, which can promote the synthesis of tyrosine hydroxylase.

[0053] Tyrosine hydroxylase is the rate-limiting enzyme for dopamine synthesis in the brain. Its gene proximal promoter (<1 kb upstream of the transcription start site) is very important for transcriptional regulation. This application identified that the transcription factor NR2F1 interacts with the promoter region of the tyrosine hydroxylase gene TH to regulate the synthesis of tyrosine hydroxylase.

[0054] It should be understood that the above embodiments are exemplary and are not intended to include all possible implementations included in the claims. Various modifications and changes may be made on the basis of the above embodiments without departing from the scope of the present disclosure. Similarly, the various technical features of the above embodiments may be arbitrarily combined to form other embodiments of the present invention that may not be explicitly described. Therefore, the above embodiments only express several implementations of the present invention and do not limit the scope of protection of the patent of the present invention.

Claims

1. Application of transcription factor NR2F1 in the preparation of reagents for regulating the expression of tyrosine hydroxylase encoding gene TH.

2. The use according to claim 1, characterized in that: The transcription factor NR2F1 specifically binds to the promoter region of the tyrosine hydroxylase encoding gene TH.

3. The use according to claim 2, characterized in that: The promoter of gene TH contains a sequence that can be recognized by the transcription factor NR2F1, which is 5'-AGGTCA(N) n GGTCA-3', wherein N is A, T, C or G, and n is an integer of 0-100.

4. The use according to claim 3, characterized in that: The gene TH promoter that can be recognized and activated by NR2F1 contains the following sequence: 5'-AGGTCACCCCAGGGTCA-3'.

5. Application of regulating the activity and / or expression of transcription factor NR2F1 in the preparation of reagents for increasing the synthesis of tyrosine hydroxylase.

6. The use according to claim 5, characterized in that: The transcription factor NR2F1 specifically binds to the promoter region of the tyrosine hydroxylase encoding gene TH.

7. The use according to claim 6, characterized in that: The promoter of gene TH contains a sequence that can be recognized by the transcription factor NR2F1, which is 5'-AGGTCA(N) n GGTCA-3', wherein N is A, T, C or G, and n is an integer of 0-100.

8. The use according to claim 7, characterized in that: The gene TH promoter that can be recognized and activated by NR2F1 contains the following sequence: 5'-AGGTCACCCCAGGGTCA-3'.

9. A method for improving the synthesis of tyrosine hydroxylase, characterized in that: The method comprises regulating the activity and / or expression of the transcription factor NR2F1 in the cell, or editing the transcription factor NR2F1 gene.

10. Application of transcription factor NR2F1 regulators in the preparation of drugs for the treatment of diseases related to tyrosine hydroxylase imbalance; Preferably, the tyrosine hydroxylase imbalance-related disease includes Parkinson's disease.

Images