Preparation method of sheet-shaped micro-robot with sandwich structure and precise operation system

Abstract

The invention provides a preparation method of a sheet-shaped micro-robot with a sandwich structure and a precise operation system. The method comprises the following steps: obtaining a silicon wafer provided with a sheet-shaped porous diatom shell sheet, carrying out film coating treatment on the silicon wafer, and carrying out micro-operation on the silicon wafer to separate the diatom micro-robot. Natural diatomite is used as a template, the diatomite-based heterogeneous magnetic microrobot is constructed, efficient capture and detection of salmonella are realized through a unique three-dimensional porous structure and a motion mode of the diatomite-based heterogeneous magnetic microrobot, and the diatomite-based heterogeneous magnetic microrobot has extremely high application value and research potential; according to the system, accurate control over multiple motion modes of the micro robot can be achieved.

Description

Technical Field

[0001] The present invention relates to the technical field of microrobots, and in particular to a preparation method and a precise operating system of a sheet-shaped microrobot with a sandwich structure. Background Art

[0002] Salmonella is a deadly pathogen that poses a major threat to human health. According to the World Health Organization, it is one of the main causes of foodborne diseases worldwide. Existing methods for detecting Salmonella, such as culture, enzyme-linked immunosorbent assay (ELISA) and nucleic acid detection, are effective, but often have shortcomings such as long detection cycles and complex operations, and some detection methods are prone to false positive or false negative results. Faced with these technical limitations, how to achieve rapid, efficient and sensitive detection of Salmonella has become an urgent problem to be solved.

[0003] Micro-nano robotics technology has rapidly emerged, showing great application prospects in biological detection. Microrobots have been widely used in the fields of medicine and environmental remediation due to their tiny size, group cooperative behavior and customizable functions, and have shown great potential in bacterial toxin detection. Therefore, it is very necessary to design a preparation method and precise operating system for a sandwich-structured sheet-shaped microrobot. Summary of the invention

[0004] In order to overcome the deficiencies of the prior art, the object of the present invention is to provide a method for preparing a sheet-shaped microrobot with a sandwich structure and a precise operating system.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a method for preparing a sheet-shaped microrobot with a sandwich structure, comprising:

[0007] Obtaining a silicon wafer with a sheet-shaped porous diatom shell piece;

[0008] Coating the silicon wafer;

[0009] Microrobots for micromanipulation of diatom separation on silicon wafers.

[0010] Preferably, the silicon wafer is subjected to a coating process, specifically:

[0011] The silicon wafer was placed in an ion beam sputtering apparatus for coating, wherein nickel was first plated for 10 minutes and then a gold layer was plated for 5 minutes.

[0012] Preferably, micromanipulation of the silicon wafer to separate the diatom microrobot is performed as follows:

[0013] The processed silicon wafer is taken out, placed on a micromanipulation stage, and micromanipulation is performed using a microneedle to peel the diatom microrobot from the silicon wafer, and the diatom microrobot is collected to obtain a multilayer structure diatom microrobot in the form of a sandwich.

[0014] The present invention also provides a precise operating system for a sheet-shaped microrobot with a sandwich structure, comprising: an operating terminal, a CCD camera, an Arduino single-chip microcomputer, a digital-to-analog conversion module, a current signal transmitter, a power supply, a three-dimensional magnetic field coil, a three-dimensional micro-motion platform, a Z-axis micro-motion device, a microscopic observation platform, a base and a sample stage, wherein the three-dimensional micro-motion platform is arranged on the base, and the three-dimensional micro-motion platform is fixed with a sample stage with a through hole by bolts, and a 2cm×2cm long groove is arranged on the sample stage for arranging a microfluidic chip for holding a diatom microrobot, and the Z-axis micro-motion device is arranged on the top of the microfluidic chip, and the three-dimensional magnetic field coil is arranged on the Z-axis micro-motion device corresponding to the microfluidic chip, and the base and the microscopic observation platform are connected. The microscopic observation platform is connected to the CCD camera, the microscopic observation platform is used for direct observation through an eyepiece, the CCD camera is used for collecting the motion trajectory of the diatom microrobot and displaying it on the control terminal, the power supply is used to power each component, the operation terminal is connected to the Arduino single-chip microcomputer for outputting a control signal, the Arduino single-chip microcomputer is connected to the current signal alternator through the digital-to-analog conversion module, and is used to output an analog voltage signal to the current signal alternator, the current signal alternator is connected to the three-dimensional magnetic field coil, and is used to input a current analog signal to the three-dimensional magnetic field coil, and the three-dimensional micro-motion platform, the Z-axis micro-motion device and the microscopic observation platform are connected to the Arduino single-chip microcomputer.

[0015] Preferably, the Z-axis fine-motion device includes a Z-axis fine-motion stage, a transparent acrylic base, a spirit level and a calibration ruler. The Z-axis fine-motion stage is respectively arranged on the bases on both sides of the three-dimensional fine-motion platform, the transparent acrylic base is arranged on the top of the Z-axis fine-motion stage, a groove is arranged on the transparent acrylic base corresponding to the microfluidic chip, the three-dimensional magnetic field coil is arranged inside the groove, four spirit levels and two calibration rulers are evenly arranged on the top of the transparent acrylic base, and the Z-axis fine-motion stage is connected to the Arduino microcontroller.

[0016] According to the specific embodiments provided by the present invention, the present invention discloses the following technical effects:

[0017] The present invention provides a method for preparing a sheet-shaped microrobot with a sandwich structure and a precise operating system, the method comprising: obtaining a silicon wafer with a sheet-shaped porous diatom shell piece, coating the silicon wafer, and performing micro-operation on the silicon wafer to separate the diatom microrobot; the system comprises an operating terminal, a CCD camera, an Arduino single-chip microcomputer, a digital analog conversion module, a current signal transmitter, a power supply, a three-dimensional magnetic field coil, a three-dimensional micro-motion platform, a Z-axis micro-motion device, a microscopic observation platform, a base and a sample stage. The present invention uses natural diatomite as a template to construct a diatomite-based heterogeneous magnetic microrobot, and through its unique three-dimensional porous structure and motion mode, it can achieve efficient capture and detection of Salmonella, which has extremely high application value and research potential. In addition, the system can achieve precise control of various motion modes of the microrobot. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0019] Figure 1 This is a schematic diagram of the preparation method of an embodiment of the present invention;

[0020] Figure 2a This is the SEM image of the diatom microrobot after sputtering the nickel layer for 5 minutes;

[0021] Figure 2b This is the SEM image of the diatom microrobot after sputtering the nickel layer for 10 minutes;

[0022] Figure 2c This is the SEM image of the diatom microrobot after sputtering the nickel layer for 15 minutes;

[0023] Figure 3 Schematic diagram of the overall preparation process of diatomite heterostructure microrobot;

[0024] Figure 4 A schematic diagram of the operation flow of the control system provided by an embodiment of the present invention;

[0025] Figure 5 A front view of the control system structure provided by an embodiment of the present invention;

[0026] Figure 6 A side view of the control system structure provided by an embodiment of the present invention;

[0027] Figure 7 A schematic diagram of the control system structure provided by an embodiment of the present invention;

[0028] Figure 8 A three-dimensional diagram of the control system structure provided by an embodiment of the present invention.

[0029] Figure numerals: 1. base; 2. three-dimensional fine-motion platform; 3. level; 4. Z-axis fine-motion stage; 5. sample stage; 6. three-dimensional magnetic field coil; 7. transparent acrylic base. DETAILED DESCRIPTION

[0030] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0031] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the present invention is further described in detail below with reference to the accompanying drawings and specific embodiments.

[0032] Figure 1 A schematic flow chart of a method for preparing a sandwich-structured sheet-shaped microrobot provided in an embodiment of the present invention is shown in FIG. Figure 1 As shown, the present invention provides a method for preparing a sheet-shaped microrobot with a sandwich structure, comprising:

[0033] Step 100: obtaining a silicon wafer on which a sheet-shaped porous diatom frustule sheet is arranged;

[0034] Step 200: coating the silicon wafer;

[0035] Step 300: Perform micro-operation on the silicon wafer to separate the diatom micro-robot.

[0036] In step 200, the silicon wafer is subjected to a coating process, specifically:

[0037] The silicon wafer was placed in an ion beam sputtering apparatus for coating, wherein nickel was first plated for 10 minutes and then a gold layer was plated for 5 minutes;

[0038] First of all, it should be explained that this method improves the driving performance of the diatom microrobot by precisely controlling the ion beam sputtering time and adjusting the deposition thickness of the nickel layer to obtain ideal magnetic properties and surface morphology;

[0039] During the manufacturing process, the sputtering time of the nickel layer directly affects the surface nanopore structure and magnetic properties of the diatom microrobot. Prolonging the sputtering time can effectively enhance the magnetism of the diatom microrobot, but if the sputtering time is too long, the nickel layer will cover and fill the nanopore structure of the diatom, causing damage to its surface morphology, thereby affecting the functional application of the microrobot. On the other hand, if the sputtering time is too short, the nickel layer will be insufficient and the magnetism will not meet expectations, thus affecting the driving performance of the microrobot and subsequent biological detection needs.

[0040] In order to optimize the process, the present invention designed experimental schemes with various sputtering times, and prepared diatom microrobot samples with nickel layer sputtering times of 5 minutes, 10 minutes and 15 minutes, respectively. Surface imaging analysis was performed using a scanning electron microscope (SEM), and the driving performance of the microrobot in a liquid environment was tested.

[0041] The results show that:

[0042] 5 minutes sputtering time: The nickel layer is thin, and the surface morphology of the diatom is well preserved, but its driving performance is poor, and the maximum movement speed is only 500μm / s.

[0043] 15 minutes of sputtering time: The nickel layer covers the nanopore structure of the diatom. Although the magnetic properties are enhanced, the filling of the nanopore structure makes the microrobot unsuitable for subsequent biodetection applications.

[0044] 10 minutes sputtering time: Under this parameter, the surface nanopore structure of the diatom microrobot remains intact and its maximum movement speed reaches 1100μm / s, showing an ideal balance between driving performance and magnetic properties.

[0045] Therefore, the present invention determines that the nickel layer sputtering time of 10 minutes is the optimal parameter. Through this time control, the optimal adjustment of the surface morphology and the driving performance can be achieved simultaneously, thereby meeting the needs of efficient biological detection.

[0046] Among them, the SEM images of diatom microrobots with different sputtering times are shown in the figure below: Figure 2a , 2b and as shown in 2c.

[0047] In step 300, micro-manipulation is performed on the silicon wafer to separate the diatom micro-robot, specifically:

[0048] The processed silicon wafer is taken out, placed on a micromanipulation stage, and micromanipulation is performed using a microneedle to peel the diatom microrobot from the silicon wafer, and the diatom microrobot is collected to obtain a multilayer structure diatom microrobot in the form of a sandwich.

[0049] The present invention provides an embodiment, which is a preparation process of the entire diatom microrobot, such as Figure 3As shown, the seven steps described above also include the functionalization of the diatomite heterostructure microrobot. The 5-end of the ligand is modified with a thiol group. The role of the thiol group is to combine with the gold on the surface of the diatom robot to form a gold-thiol bond, thereby completing the binding of the aptamer probe to the microrobot. In order to quantitatively characterize the binding effect of the aptamer probe, the method of modifying the 3-end of the aptamer probe with a Cy-5 fluorescent probe is used to verify the binding efficiency of the probe. The nucleic acid aptamer base sequence:

[0050] CTCCTCTGACTGTAACCACGGTGGTTTGATCACTATTGGGCCTTTGT GATGTCGGTAGT.

[0051] The specific method is:

[0052] Restore Processing:

[0053] A 1 M TCEP solution was mixed with the nucleic acid aptamer probe and subjected to reduction treatment for 30 minutes.

[0054] Mixing and pH Adjustment:

[0055] Mix microrobot solutions of different concentrations with nucleic acid aptamers and shake well. Add 1mM HCl solution and 1mM NaOH solution dropwise to the mixture to adjust the pH to 3. Incubate the mixture for 10 minutes. Then add 1mM NaOH solution dropwise to adjust the pH to 7. Incubate the mixture again for 10 minutes.

[0056] Control group and experimental group treatment:

[0057] The mixture of the control group was mixed on a shaker.

[0058] The experimental group used a magnetic field automated programming mode to drive the microrobot for mixing.

[0059] Nucleic acid probe loading calculation:

[0060] The BJDMs solution loaded with aptamer probes was heated at 90°C for 5 minutes to remove the fluorescent probes. The supernatant was collected and its peak value was measured at a wavelength of 650nm using a fluorescence spectrophotometer, which was recorded as N1. Different concentrations of fluorescent probe solutions were tested using the same parameters, and their peak values ​​were recorded and recorded as N2.

[0061] Calculate the probe load percentage:

[0062] The final aptamer probe loading percentage was obtained using the value of the formula N1 / N2×100%.

[0063] like Figure 4 , 5, 6, 7 and 8, the present invention also provides a precise operating system for a sheet-shaped microrobot with a sandwich structure, comprising: an operating terminal, a CCD camera, an Arduino single-chip microcomputer, a digital-to-analog conversion module, a current signal transmitter, a power supply, a three-dimensional magnetic field coil 6, a three-dimensional micro-motion platform 2, a Z-axis micro-motion device, a microscopic observation platform, a base 1 and a sample stage 5, wherein the three-dimensional micro-motion platform 2 is arranged on the base 1, and the three-dimensional micro-motion platform 2 is fixed with a sample stage 5 with a through hole by bolts, and a 2cm×2cm long groove is arranged on the sample stage 5 for arranging a microfluidic chip for holding a diatom microrobot, the Z-axis micro-motion device is arranged on the top of the microfluidic chip, and the three-dimensional magnetic field coil 6 is arranged on the Z-axis micro-motion device corresponding to the microfluidic chip, and the The base 1 is connected to the microscopic observation platform, and the microscopic observation platform is connected to the CCD camera. The microscopic observation platform is used for direct observation through an eyepiece, and the CCD camera is used to collect the motion trajectory of the diatom microrobot and display it on the control terminal. The power supply is used to power each component, and the operation terminal is connected to the Arduino single-chip microcomputer for outputting a control signal. The Arduino single-chip microcomputer is connected to the current signal alternator through the digital-to-analog conversion module, and is used to output an analog voltage signal to the current signal alternator. The current signal alternator is connected to the three-dimensional magnetic field coil, and is used to input a current analog signal to the three-dimensional magnetic field coil. The three-dimensional micro-motion platform, the Z-axis micro-motion device and the microscopic observation platform are connected to the Arduino single-chip microcomputer.

[0064] The Z-axis fine-motion device includes a Z-axis fine-motion stage 4, a transparent acrylic base 7, a level 3 and a calibration ruler. The bases 1 on both sides of the three-dimensional fine-motion platform 2 are respectively provided with a Z-axis fine-motion stage 4, the transparent acrylic base 7 is provided on the top of the Z-axis fine-motion stage 4, a groove is provided on the transparent acrylic base 7 corresponding to the microfluidic chip, the three-dimensional magnetic field coil 6 is provided inside the groove, four levels 3 and two calibration rulers are evenly provided on the top of the transparent acrylic base 7, and the Z-axis fine-motion stage 4 is connected to the Arduino microcontroller.

[0065] When the control system is working, first select the group drive mode of the micro robot swarm in the program, and then the operation terminal sends the corresponding digital signal to the Arduino single chip microcomputer through the serial port, and the Arduino single chip microcomputer is connected to the digital analog conversion module. The digital analog conversion module converts the digital signal sent by the Arduino single chip microcomputer into an analog voltage signal. Subsequently, the digital analog conversion module sends the analog voltage signal to the current signal transmitter. The current signal alternator converts the corresponding voltage signal into a corresponding current signal. Each group of coils of the three-dimensional magnetic field coil 6 is connected in series with a current signal alternator. Thereby driving the three-dimensional magnetic field coil 6 to generate a corresponding rotating magnetic field or gradient magnetic field. Thereby controlling the robot swarm to realize different modes of motion. The image recognition program written by the program can read the motion position and heading angle of the swarm captured by the CCD camera. Thereby optimizing the motion trajectory and heading angle of the micro robot swarm as feedback.

[0066] The microscopic observation platform is connected to the CCD camera. There are two observation modes, one is to observe directly on the microscopic observation platform through the eyepiece, and the other is to display the movement trajectory of the micro robot on the control terminal in real time through the CCD camera.

[0067] The observation platform is connected to the base 1. The base is used as a stable three-dimensional structure to fix the three-dimensional micro-motion platform. The three-dimensional micro-motion platform 2 is fixed with a sample stage 5 with a through hole by bolts. The sample stage 5 with a through hole ensures that the light source for photographing the micro-nano robot is not blocked. The sample stage 5 has a 2cm*2cm long groove for fixing the microfluidic chip containing the micro-nano robot. In addition, the most uniform magnetic field area of ​​the three-dimensional magnetic field coil 6 is at the center of the coil, in order to facilitate the placement and removal of the sample;

[0068] The three-dimensional magnetic field coil 6 is placed in the groove of the transparent acrylic base 7, the three-dimensional micro-motion platform 2 is connected to the transparent acrylic base 7 by bolts and nuts, and four small-sized spirit levels 3 are fixed to the transparent acrylic base 7 by adhesive stickers. When placing the sample, the two Z-axis micro-motion tables 4 are rotated to make the coil slowly descend, and then the microfluidic chip is placed on the sample table 5. Subsequently, the Z-axis micro-motion table 4 is rotated to place the sample at the center of the three-dimensional magnetic field coil 6, and the horizontality of the micro-motion device is adjusted by observing the four spirit levels 3.

[0069] The microrobot is able to rotate in situ by applying appropriate magnetic field waveforms to the X-axis and Y-axis coils through a precise operating system. Specifically, applying magnetic field signals with orthogonal phase differences can effectively control the microrobot to rotate stably around its central axis, which is suitable for enhancing the local fluid disturbance and target capture efficiency of the microrobot in liquid media.

[0070] To achieve the tumbling motion mode, a lower frequency magnetic field signal, such as a 20 Hz low-frequency magnetic field, can be used to induce the microrobot to perform a stable tumbling motion. In this mode, the microrobot periodically flips around its central axis, which helps improve the ability to capture targets in a liquid environment.

[0071] When the magnetic field frequency is gradually increased to 30Hz, the microrobot will gradually transition from the tumbling mode to the rolling motion mode. At this time, the microrobot will roll along the surface of the liquid medium. By setting an appropriate magnetic field strength (such as 50Gs) and adjusting the frequency to 30Hz, stable control of the microrobot's rolling motion can be achieved.

[0072] In addition, by adjusting the magnetic field strength, the movement speed of the microrobot can be further optimized and controlled. As the magnetic field strength increases (for example, from 50Gs), the rolling speed of the microrobot is significantly improved. Especially under the action of a magnetic field with a higher frequency (such as 30Hz), the speed of the rolling motion mode is significantly faster than the tumbling mode. Therefore, the present invention can achieve accurate control of the motion mode and speed of the microrobot by programming the combination of magnetic field frequency and strength.

[0073] This method can achieve optimal motion mode and speed control under different operating conditions by parameter selection through programmed logic in the drive system, which is suitable for target capture, enrichment and functional applications in different environments.

[0074] The present invention provides a microrobot swarm driving method based on heterogeneous structures, aiming to improve the enrichment and capture efficiency of microrobots for target objects in liquid media. After fully studying the motion performance of a single microrobot, this method further optimizes the collective motion behavior of the microrobot swarm under different magnetic fields, ensuring that it exhibits excellent capture performance in a variety of application scenarios.

[0075] First, by applying a rotating magnetic field in the XOY plane, the designed microrobot (BJDMs) can achieve in-situ spin, and with the help of the special design of its Janus structure, the microrobot also produces in-plane displacement during the spin process. This in-plane rotation not only enhances the fluid disturbance effect of the microrobot, but also prompts the microrobots to gradually approach and form a vortex-shaped cluster, further optimizing the enrichment process of the target. Secondly, under the action of the three-dimensional magnetic field, the microrobots can automatically gather near the side wall of the liquid cavity to form a magnetically controlled chain structure. This chain structure can efficiently shuttle in the liquid to achieve rapid enrichment and target capture. Based on this chain structure, the present invention develops two unique group motion modes: traversal mode and cross mode. In the traversal mode, the microrobot group with a long chain structure moves in the liquid matrix according to a preset path to ensure comprehensive enrichment of the target substance in the liquid; in the cross mode, the microrobot group first moves from one side wall of the liquid chamber to the opposite side wall, and then performs a cross-shaped motion from another direction, thereby effectively covering the entire liquid space and achieving comprehensive capture of the target. These group motion patterns are controlled by automated programming, and the preset driving time and path cycles ensure efficient capture and enrichment during each cycle. This invention proposes for the first time a multimodal group motion method based on heterogeneous structures, which can achieve efficient target capture and detection in complex environments under different magnetic field parameters, laying the foundation for subsequent experimental applications in the fields of biosensing and environmental monitoring.

[0076] The sheet-shaped microrobot extremely precise control system provided by the present invention can realize the integrated functions of specific capture of Salmonella, photothermal sterilization and DNA extraction. The specific implementation process of the system is described in detail below:

[0077] 1. Specific capture of Salmonella function

[0078] The surface of the diatom microrobot has been specially functionalized and loaded with specific nucleic acid aptamer probes. The aptamer is chemically modified to efficiently identify and bind to specific molecular sites on the surface of Salmonella to achieve precise capture. Driven by a magnetic field, the microrobot can actively move in a liquid medium and efficiently capture Salmonella using its large specific surface area and multi-level pore structure. Compared with traditional magnetic nanoparticle or antibody capture systems, the microrobot of the present invention has higher specificity and selectivity and is suitable for efficient pathogen capture in complex matrices.

[0079] Specific implementation steps:

[0080] (1) Take 100 μL of 2 mg / mL functionalized microrobot solution to ensure that the microrobot surface is modified with aptamers to specifically capture Salmonella, and prepare 100 μL of target liquid sample containing Salmonella (concentration range 5.8×10 2 CFU / mL to 5.8×105 CFU / mL), and the two were mixed evenly.

[0081] (2) The mixed solution was placed in a three-dimensional magnetic field coil system, and an appropriate motion mode (such as rotation mode, tumbling mode, or rolling mode) was selected for swarm motion control. The capture time was set to 30 minutes. Through precise control of the rotating magnetic field, the microrobot was ensured to effectively enrich and capture the target Salmonella in the liquid.

[0082] Experimental verification:

[0083] The experimental results were verified by nucleic acid detection methods such as qPCR. DNA was extracted from the captured Salmonella and the Ct value was analyzed by qPCR and compared with the standard curve to confirm the capture efficiency. The qPCR detection results showed that the microrobot system of the present invention can achieve rapid and specific capture of Salmonella in complex matrices such as milk.

[0084] 2. Photothermal sterilization function

[0085] One side of the diatom microrobot is modified with gold nanoparticles by ion beam sputtering. The gold nanoparticles can convert light energy into heat energy under the irradiation of near-infrared light (808nm), generating local high temperature. When the local temperature rises to 50℃-60℃, the captured Salmonella protein denatures and the cell membrane ruptures, achieving rapid inactivation.

[0086] Specific implementation steps:

[0087] (1) After capturing Salmonella, the microrobot is irradiated with an 808nm near-infrared laser. Under the irradiation of near-infrared light, gold nanoparticles quickly convert light energy into heat energy, generating local high temperatures and killing the captured bacteria.

[0088] (2) The laser irradiation time is controlled to 5 minutes to ensure that a sufficient temperature (50°C to 60°C) is generated to inactivate the bacteria. The inactivation process does not damage the microrobot structure, allowing it to continue to be used for subsequent operations.

[0089] (3) After photothermal sterilization is completed, a magnetic field is used to separate the microrobot from the solution and wash to remove residual bacterial fragments.

[0090] Photothermal results characterization:

[0091] The photothermal sterilization effect was verified by comparing the survival rate of bacteria. The treated samples were diluted and plated for bacterial count. The experiment showed that the photothermal sterilization treatment significantly reduced the survival rate of Salmonella, verifying the effectiveness of the photothermal sterilization process.

[0092] 3. DNA extraction function

[0093] The diatom microrobot of the present invention has the dual functions of capturing pathogens and extracting DNA. One side of the Janus structure retains the porous surface of the diatom, which can effectively adsorb the DNA released after bacterial lysis. After completing the capture of the pathogen, the microrobot adsorbs the DNA by adjusting the pH value of the solution.

[0094] Specific implementation steps:

[0095] (1) After sterilization achieved by the photothermal process, the bacteria die and release their DNA into the solution.

[0096] (2) The pH value of the solution was adjusted to acidic (pH 5-6) to enhance the electrostatic interaction between DNA and the surface of the microrobot porous diatom and achieve efficient adsorption of DNA.

[0097] (3) After three washes, the pH of the solution was adjusted to neutral (pH 7-7.5) to dissociate the DNA from the surface of the microrobot. Finally, the supernatant was extracted and the DNA extraction effect was evaluated by nucleic acid detection methods such as qPCR.

[0098] DNA extraction effect verification:

[0099] The extracted DNA samples were analyzed by qPCR to detect the presence and concentration of Salmonella. The experiment showed that the system was easy to operate during DNA extraction, had high adsorption efficiency, and could provide high-quality DNA samples for subsequent analysis.

[0100] In summary, the multifunctional diatom microrobot system of the present invention can achieve efficient capture, photothermal sterilization and DNA extraction of Salmonella, and has broad application prospects.

[0101] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0102] The present invention uses specific examples to illustrate the principles and implementation methods of the present invention. The above examples are only used to help understand the method and core ideas of the present invention. At the same time, for those skilled in the art, according to the ideas of the present invention, there will be changes in the specific implementation methods and application scope. In summary, the content of this specification should not be understood as limiting the present invention.

Claims

1. A method for preparing a sheet-shaped microrobot with a sandwich structure, characterized in that: include: Obtaining a silicon wafer with a sheet-shaped porous diatom shell piece; Coating the silicon wafer; Microrobots for micromanipulation of diatom separation on silicon wafers.

2. The method according to claim 1, characterized in that The silicon wafer is coated as follows: The silicon wafer was placed in an ion beam sputtering apparatus for coating, wherein nickel was first plated for 10 minutes and then a gold layer was plated for 5 minutes.

3. The method according to claim 1, characterized in that: Micro-manipulation of silicon wafers to separate diatom microrobots, specifically: The processed silicon wafer is taken out, placed on a micromanipulation stage, and micromanipulation is performed using a microneedle to peel the diatom microrobot from the silicon wafer, and the diatom microrobot is collected to obtain a multilayer structure diatom microrobot in the form of a sandwich.

4. A precise operating system for a sandwich-structured sheet-shaped microrobot, characterized in that: include: An operation terminal, a CCD camera, an Arduino single-chip computer, a digital-to-analog conversion module, a current signal transmitter, a power supply, a three-dimensional magnetic field coil, a three-dimensional micro-motion platform, a Z-axis micro-motion device, a microscopic observation platform, a base and a sample stage, wherein the three-dimensional micro-motion platform is arranged on the base, and the three-dimensional micro-motion platform is fixed with a sample stage with a through hole by bolts, and a 2cm×2cm long groove is arranged on the sample stage for arranging a microfluidic chip for holding a diatom microrobot, and the Z-axis micro-motion device is arranged on the top of the microfluidic chip, and the three-dimensional magnetic field coil is arranged on the Z-axis micro-motion device corresponding to the microfluidic chip, and the base is connected to the microscopic observation platform, and the microscopic observation platform is connected to the C The microscopic observation platform is connected to a CCD camera, the microscopic observation platform is used for direct observation through an eyepiece, the CCD camera is used to collect the motion trajectory of the diatom microrobot and display it on the control terminal, the power supply is used to power each component, the operation terminal is connected to the Arduino single-chip microcomputer for outputting a control signal, the Arduino single-chip microcomputer is connected to the current signal alternator through the digital-to-analog conversion module, and is used to output an analog voltage signal to the current signal alternator, the current signal alternator is connected to the three-dimensional magnetic field coil, and is used to input a current analog signal to the three-dimensional magnetic field coil, and the three-dimensional micro-motion platform, the Z-axis micro-motion device and the microscopic observation platform are connected to the Arduino single-chip microcomputer.

5. The system according to claim 4, characterized in that The Z-axis fine-motion device includes a Z-axis fine-motion stage, a transparent acrylic base, a level and a calibration ruler. The bases on both sides of the three-dimensional fine-motion platform are respectively provided with a Z-axis fine-motion stage, the transparent acrylic base is provided on the top of the Z-axis fine-motion stage, a groove is provided on the transparent acrylic base corresponding to the microfluidic chip, the three-dimensional magnetic field coil is provided inside the groove, four levels and two calibration rulers are evenly provided on the top of the transparent acrylic base, and the Z-axis fine-motion stage is connected to the Arduino single-chip computer.

Images