Staphylococcus epidermidis commensal bacteria CGMCC NO.31064 and their applications

Abstract

This invention discloses a probiotic candidate strain, with accession number CGMCC NO.31064, accession date June 24, 2024, and accession classification name Staphylococcus epidermidis. Staphylococcus epidermidis The strain is deposited at the China General Microbiological Culture Collection Center of the China Association for the Preservation and Management of Microbial Cultures. It is harmless to animals and has a significant effect in relieving clinical symptoms of atopic dermatitis.

Description

Technical Field

[0001] This invention relates to a candidate strain of symbiotic bacteria, its bacterial components, and its applications, belonging to the field of microbiology. Background Technology

[0002] Atopic dermatitis is the most common inflammatory skin disease, clinically manifested as epidermal shedding, intense itching, and lichenification. The etiology of atopic dermatitis is complex, primarily due to skin microbiome dysbiosis, impaired skin barrier function, abnormal immune signaling, genetic factors, and environmental factors. Atopic dermatitis causes significant disruption to patients' lives due to its long duration, recurrent flare-ups, secondary infections by pathogens such as Staphylococcus aureus at the lesions, and, in some cases, secondary allergic asthma, allergic rhinitis, and allergic conjunctivitis. Atopic dermatitis is widespread globally; according to data from the World Health Organization, it is estimated that at least 230 million people worldwide suffer from it, affecting 15-30% of children and 10% of adults. Clinically, for mild atopic dermatitis, topical corticosteroids and antihistamines are used. For severe cases, systemic corticosteroids and immunosuppressants are employed. Because atopic dermatitis patients are susceptible to bacterial, viral, and fungal infections, they often require antimicrobial medications. However, long-term use of corticosteroids and immunosuppressants can cause severe side effects, such as weakened immunity, gastrointestinal symptoms like diarrhea, and gut microbiota dysbiosis, with a high relapse rate. Therefore, it is essential to research a safe, side-effect-free, and environmentally friendly intervention for atopic dermatitis.

[0003] Host-microbe interactions work together to coordinate skin homeostasis. In recent years, microbial therapy has been studied for the prevention and treatment of allergic diseases such as food allergies, asthma, allergic rhinitis, atopic dermatitis, neurodermatitis, and contact dermatitis. Microbial therapy, performed through topical application of bacterial lysates or skin microbiota transplantation, has shown promising results in animal and human trials. It not only restores the balance of the skin microbiota by reducing pathogenic bacteria and increasing beneficial bacteria, but also exerts immunomodulatory effects by influencing the host's biochemical and metabolic pathways.

[0004] Staphylococcus epidermidis is a normal commensal bacterium on human skin, and studies have confirmed that it has immunomodulatory effects. The purpose of this invention is to provide a commensal bacterium that can alleviate atopic dermatitis. Summary of the Invention

[0005] Based on the aforementioned objectives, this invention first provides a Staphylococcus epidermidis strain M2024, with accession number CGMCC NO. 31064, accession date June 24, 2024, and accession classification name Staphylococcus epidermidis.Staphylococcus epidermidis The depositary institution is the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Chinese Academy of Microbiology, 100101, China, with the telephone number 8610-64807355. The strain was isolated from the skin surface of a healthy human.

[0006] In a preferred embodiment, the 16S rRNA sequence of the strain is shown in SEQ ID NO.1.

[0007] Secondly, the present invention also provides the application of the above-mentioned strains and their bacterial components in the preparation of drugs for the treatment and / or prevention of skin allergic diseases.

[0008] In a preferred embodiment, the allergic skin disease is atopic dermatitis.

[0009] In a more preferred embodiment, the atopic dermatitis treatment and / or prevention drug refers to a drug that promotes AhR gene transcription and / or expression.

[0010] In another preferred embodiment, the atopic dermatitis treatment and / or prevention drug refers to the drug that inhibits... Tslp Drugs that transcribe and / or express genes.

[0011] Third, the present invention also provides the application of the above-mentioned strains or their bacterial components in the preparation of health products.

[0012] Finally, the present invention provides a composition containing the above-described strain.

[0013] In a preferred embodiment, the composition further comprises a pharmaceutically acceptable carrier and / or excipient.

[0014] In a more preferred embodiment, the composition is prepared as a capsule, a lyophilized powder, or a bacterial culture.

[0015] This invention involves isolating and purifying a strain of Staphylococcus epidermidis from the skin surface of healthy individuals, which is effective in alleviating atopic dermatitis. Experiments have demonstrated that the isolated strain... Staphylococcus epidermidis M2024 is harmless to animals and has been confirmed in animal experiments to have the function of relieving atopic dermatitis. Staphylococcus epidermidis M2024 can effectively relieve the symptoms of atopic dermatitis, reduce scaling at the site of skin lesions, decrease the thickness of the epidermis, and reduce the level of inflammatory factors in the skin. It has a significant relieving effect on atopic dermatitis and shows excellent application prospects in the preparation of drugs for the treatment and / or prevention of skin allergic diseases. Attached Figure Description

[0016] Figure 1The images show that applying M2024 can significantly alleviate ear symptoms in atopic dermatitis model mice, along with H&E staining and toluidine blue staining sections from each group.

[0017] Figure 2 The study showed that applying M2024 significantly reduced ear thickness in a mouse model of atopic dermatitis.

[0018] Figure 3 The results showed that applying M2024 significantly reduced the thickness of the ear epidermis in a mouse model of atopic dermatitis.

[0019] Figure 4 The study showed that applying M2024 significantly reduced the number of mast cells in the ears of mice with atopic dermatitis.

[0020] Figure 5 The levels of IgE protein in the serum of mice in each group were displayed.

[0021] Figure 6 The application of M2024 significantly reduced the levels of M2024 in the ears of mice with atopic dermatitis. Il-4 The transcriptional level of genes;

[0022] Figure 7 The application of M2024 significantly reduced the levels of M2024 in the ears of mice with atopic dermatitis. Il-1β The transcriptional level of genes;

[0023] Figure 8 The study showed that applying M2024 significantly reduced the IL-4 protein content in the ears of mice with atopic dermatitis.

[0024] Figure 9 The results showed that applying M2024 significantly reduced the IL-1β protein content in the ears of mice with atopic dermatitis;

[0025] Figure 10 The application of M2024 significantly reduced early-stage atopic dermatitis in the ears of mice. Tslp The transcriptional level of genes;

[0026] Figure 11 The study showed that applying M2024 significantly reduced the TSLP protein content in the early ear of atopic dermatitis model mice;

[0027] Figure 12 The application of M2024 significantly reduced early-stage atopic dermatitis in the ears of mice. Il-33 The transcriptional level of genes;

[0028] Figure 13 The study showed that applying M2024 significantly reduced the IL-33 protein content in the early ear of atopic dermatitis model mice;

[0029] Figure 14The application of M2024 significantly enhanced early ear growth in mice with atopic dermatitis. Ahr The transcriptional level of genes;

[0030] Figure 15 The application of M2024 significantly enhanced early ear growth in mice with atopic dermatitis. Cyp1a1 The transcriptional level of genes;

[0031] Figure 16 The study showed that applying M2024 significantly increased the CYP1A1 protein content in the early ear of atopic dermatitis model mice;

[0032] Figure 17 The ear symptoms of mice in each group after application of AhR inhibitors are shown.

[0033] Figure 18 This shows the ear thickness of mice in each group after the application of AhR inhibitors;

[0034] Figure 19 The levels of IgE protein in the serum of mice in each group after the application of AhR inhibitors were shown.

[0035] Figure 20 Early mouse ear activity after application of AhR inhibitors was observed. Tslp The transcriptional level of genes;

[0036] Figure 21 This shows the TSLP protein content in the early ear of mice after application of an AhR inhibitor;

[0037] Figure 22 The image shows the ear tissues of mice in different groups after application of AhR inhibitors. Il-4 The transcriptional level of genes;

[0038] Figure 23 The image shows the ear tissues of mice in different groups after application of AhR inhibitors. Il-1β The transcriptional level of genes. Detailed Implementation

[0039] The present invention will be further described below with reference to specific implementation examples, and the advantages and features of the present invention will become clearer with the description. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of protection of the present invention.

[0040] Example 1: Isolation, identification, and preservation of Staphylococcus epidermidis strain M2024

[0041] 1. Isolation of Staphylococcus epidermidis strain M2024

[0042] 1) Prepare BHI blood agar medium, autoclave at 121℃ for 15 min, then add 20% defibrinated sheep blood and mix well. Pour into a petri dish and let it solidify before using it for bacterial isolation.

[0043] 2) Wipe the skin surface of a healthy person with a cotton swab and transfer the solution into a 1.5 mL Ep tube pre-filled with 1000 μL of sterile PBS, and then perform a 10-fold serial dilution;

[0044] 3) Take 100 μL of samples with different dilutions and spread them on BHI solid medium, and incubate them in a constant temperature incubator at 37℃ for 48 h.

[0045] 2. Identification of Staphylococcus epidermidis strain M2024

[0046] Staphylococcus epidermidis strain M2024 was preliminarily identified by 16S rRNA gene sequencing.

[0047] 1) Using a sterile white pipette tip, pick up an appropriate amount of the moist, round, raised yellow colonies cultured in the previous step and transfer them into an Eppendorf tube containing 100 μL of sterile water;

[0048] 2) After mixing by pipetting, place the sample in a 98 ℃ metal bath and boil for 15 min, then centrifuge at 5000 rpm for 5 min, and take 5 μL of supernatant as a template for PCR to amplify the 16S rRNA gene.

[0049] 3) The amplified products were sent to Riboxin Biotech for sequencing. The assembled amplified sequences were then preliminarily identified using Nucleotide BLAST alignment (rRNA / ITS databases) on NCBI. The alignment results showed that the 16S rRNA sequence of Staphylococcus epidermidis strain M2024 was consistent with... Staphylococcus epidermidis The sequence identity of strain NBRC 100911 was 99.893%, supporting that strain M2024 of Staphylococcus epidermidis belongs to the Staphylococcus epidermidis species.

[0050] 2.2 Accurate identification of Staphylococcus epidermidis strain M2024 by comparing ANI and DDH with the model strain

[0051] Genomic hybridization (dDDH, <70%) and average nucleotide identity (ANI, <95%) are the gold standards for identifying prokaryotic species. Both methods are performed online (dDDH, http: / / ggdc.dsmz.de; ANI, http: / / enve-omics.ce.gatech.edu / ani / ).

[0052] 1) Following the instructions, use the DNA extraction kit produced by Nanjing Novizan Biotechnology Co., Ltd. to extract the genome of the target strain;

[0053] 2) The genome was transported via cold chain to Beijing Novogene Technology Co., Ltd. for draft sequencing; the draft results showed that the genome size of Staphylococcus epidermidis strain M2024 was 2470146 bp, and the GC content was 32.06%.

[0054] 3) The dDDH and ANI of the model strain ATCC 14990 of Staphylococcus epidermidis and the M2024 strain of Staphylococcus epidermidis were compared. The results showed that the dDDH and ANI of the M2024 strain and the model strain were 74.7% and 96.87%, respectively, which supports the fact that the M2024 strain belongs to Staphylococcus epidermidis.

[0055] 3. Observation of colony appearance and cell morphology of Staphylococcus epidermidis strain M2024

[0056] Based on the 16S rRNA results, a strain of *Staphylococcus epidermidis*, M2024, was obtained. This strain is an aerobic bacterium and grew well in a 37°C incubator. The colonies were round, lemon-yellow, smooth, raised, with regular edges, and opaque. Gram-positive cocci were observed under a microscope after Gram staining.

[0057] 4. Preservation of microbial strains

[0058] In our laboratory, BHI medium containing 50% glycerol was used as the preservation solution for cryopreservation of bacterial strains, as follows:

[0059] 1) Prepare the preservation solution, autoclave it, and then dispense it into sterile 2 mL preservation tubes;

[0060] 2) Streak the identified Staphylococcus epidermidis M2024 strain in three zones on BHI solid medium. After subculturing a single colony twice, scrape the bacterial cells into the preservation tube containing the preservation solution from the previous step using an inoculation loop. Mix well by pipetting to ensure that the bacterial cells are evenly distributed in the preservation solution. Store at -80℃.

[0061] 5. Strain preservation and acquisition of accession numbers

[0062] Staphylococcus epidermidis strain M2024, with accession number CGMCC NO. 31064, accession date June 24, 2024, and accession classification name Staphylococcus epidermidis. Staphylococcus epidermidis The depository is the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, China Academy of Microbiology, Postcode: 100101, Tel: 8610-64807355.

[0063] Example 2. Functional assessment of Staphylococcus epidermidis strain M2024 in alleviating atopic dermatitis

[0064] 1. Laboratory animals

[0065] Female SPF C57BL / 6J mice weighing 18 - 20 g were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., with the license number SYXK (Beijing) 2022 - 0029. They were housed in the Laboratory Animal Center of the Chinese Center for Disease Control and Prevention, with 6 mice per cage. The housing environment was a barrier environment with a 12 - hour light / dark cycle, and the mice had free access to water and food. All animal experiments were conducted in accordance with the guiding principles of laboratory animal welfare ethics of the Laboratory Animal Center of the Chinese Center for Disease Control and Prevention (approval number: 2023 - 025).

[0066] 2. Animal experiment design and sample collection

[0067] The mice were randomly divided into 3 groups, with 12 mice in each group, namely the Vehicle group (blank control group, where only anhydrous ethanol was applied to the mouse ears), the MC903 (calcipotriol) group (model group, where 1 nmol MC903 was applied to the mouse ears daily), and the MC903 + M2024 group (intervention group, where 200 μL of the bacterial suspension of Staphylococcus epidermidis strain M2024 was applied to the mouse ears 1 hour after applying 1 nmol MC903 daily).

[0068] After one week of adaptation, 10 μL of anhydrous ethanol was applied to the right ears of the mice in the Vehicle group daily, 1 nmol MC903 (dissolved in 10 μL of anhydrous ethanol, and the drug acted on the skin after the anhydrous ethanol evaporated) was applied to the right ears of the mice in the MC903 group daily, and 200 μL of the bacterial suspension of Staphylococcus epidermidis strain M2024 (2×10 8 CFU / mouse) was applied to the right ears of the mice in the MC903 + M2024 group 1 hour after applying 1 nmol MC903 daily. Meanwhile, the same volume of PBS was applied to the MC903 group. This was continuously applied for 12 days, and the ears were photographed and measured with a micrometer every day to record the induction situation. Six mice were sacrificed on the 5th and 12th days respectively, and the serum was taken for the determination of IgE protein content. The ears were quickly frozen in liquid nitrogen and transferred to -80 °C for storage, used for tissue fixation and embedding to make paraffin sections, and RNA was extracted for the detection of the transcription of cytokines ( Il-1β 、 Il-4 、 Tslp 、 Il-33 ), as well as for the determination of cytokine protein content (IL - 1β, IL - 4, TSLP, IL - 33).

[0069] 3. Sample detection methods

[0070] 3.1 ELISA for detecting the IgE protein content in mouse serum

[0071] Mouse serum was diluted 50-fold, and the IgE protein content in mouse serum was detected using the relevant kit (Mouse IgE Uncoated ELISA, Invitrogen, Cat# 88-50460-88) following the experimental procedures in the manufacturer's instructions.

[0072] 3.2 ELISA detection of cytokine protein levels in mouse ears

[0073] Mouse ears were removed from the -80°C freezer, added to 1 mL of PBS, homogenized using a high-throughput tissue homogenizer, centrifuged, and the supernatant was collected for later use. Cytokine levels in the mouse ear homogenate supernatant were detected using the relevant kits according to the instructions, including IL-1β (Mouse IL-1 beta Uncoated ELISA, invitrogen, Cat#88-7013A-88), IL-4 (Mouse IL-4 Uncoated ELISA, invitrogen, Cat#88-7044-88), TSLP (Mouse TSLP Uncoated ELISA, invitrogen, Cat#88-7490-88), and IL-33 (Mouse IL-33 Uncoated ELISA, invitrogen, Cat#88-7333-88).

[0074] 3.3 Real-time quantitative PCR was used to detect changes in cytokine gene expression levels in mouse ears.

[0075] 3.3.1 Total RNA extraction from mouse ears

[0076] Mouse ears were soaked overnight in RNAlater (Beyotime, Cat#R0116), then transferred to 1 mL of Trizol and homogenized using a high-throughput tissue homogenizer to extract RNA. The mixture was incubated on ice for 10 min, then 200 µL of chloroform was added, and the mixture was inverted and mixed thoroughly before being allowed to stand at room temperature for 5 min. The mixture was then centrifuged at 12000 rpm for 15 min at 4 °C, and 400 µL of the supernatant was transferred to a new 1.5 mL centrifuge tube. An equal volume of isopropanol was added, and the mixture was inverted and mixed thoroughly before being incubated at room temperature for 5 min. The mixture was then centrifuged at 12000 rpm for 15 min at 4 °C, and the supernatant was discarded. RNA was observed as a white precipitate. The RNA precipitate was washed with 1 mL of 70% anhydrous ethanol, and the mixture was centrifuged at 12000 rpm for 10 min at 4 °C. The supernatant was discarded, and after the RNA dried, 50 µL of RNase-free water was added to dissolve the RNA.

[0077] 3.3.2 Reverse transcription

[0078] Using PrimeScript TM Reverse transcription was performed using the RT Master Mix (Perfect Real Time) kit (Takara, Cat#RR036A). The system used was: 5× PrimeScript RT Master Mix (Perfect Real Time): 2 μL; RNA: 1 μg; RNase-free dH2O: to a final volume of 10 μL. The reverse transcription conditions were: 37 ℃ for 15 min; 95 ℃ for 5 s.

[0079] 3.3.3 Real-time fluorescence quantification

[0080] Real-time quantitative PCR was performed using 2× ChamQ Universal SYBR qPCR Master Mix (Vazyme, Cat#Q711-03) to detect ( ) in mouse ears. Il-1β , Il-4 , Tslp , Il-33 Changes in gene expression levels. The reverse transcription product obtained in the previous step was diluted 5-fold and used as a template. The qPCR system was as follows: 2× ChamQ Universal SYBR qPCRMaster Mix: 10 μL; F: 0.8 μL; R: 0.8 μL; cDNA template: 2 μL; RNase-free dH2O: to 20 μL. The reaction conditions were: 95 ℃ pre-denaturation for 30 s; then 95 ℃ denaturation for 10 s, 60 ℃ annealing for 30 s, for 40 cycles. Fluorescence signals were collected by the system at the end of each cycle. The relative mRNA expression levels of each group of samples were calculated by the delta-delta CT method, with the Vehicle group sample being 1, thus obtaining the expression level in the MC903+M2024 group samples and comparing it with the MC903 group.

[0081] The primers used in this experiment were synthesized by Sangon Biotech Co., Ltd. The primer sequences are as follows:

[0082] mβ-actin-F: ATATCGCTGCGCTGGTCG (SEQ ID NO. 2);

[0083] mβ-actin-R: TTCCCACCATCACACCCTGG (SEQ ID NO.3);

[0084] mIL-1β-F: TGGAAGTCTGTCTGCTCAGTATT (SEQ ID NO.4);

[0085] mIL-1β-R:GGTTTGGAAGCAGCCCTTCAT (SEQ ID NO.5);

[0086] mIL-4-F: GGTCTCAACCCCCAGCTAGT (SEQ ID NO. 6);

[0087] mIL-4-R: GCCGATGATTCTCTCAAGTGAT (SEQ ID NO. 7);

[0088] IL-33-F: TCCAACTCCAAGATTTCCCCG (SEQ ID NO.8);

[0089] IL-33-R: CATGCAGTAGACATGGCAGAA (SEQ ID NO.9);

[0090] mTSLP-F: ACGGATGGGGCTAACTTACAA (SEQ ID NO. 10);

[0091] mTSLP-R: AGTCCTCGATTTGCTCGAACT (SEQ ID NO. 11);

[0092] mAhR-F: CTGGTTGTCACAGCAGATGCCT (SEQ ID NO. 12);

[0093] mAhR-R: CGGTCTTCTGTATGGATGAGCTC (SEQ ID NO. 13);

[0094] mCYP1A1-F: CATCACAGACAGCCTCATTGAGC (SEQ ID NO. 14);

[0095] mCYP1A1-R: CTCCACGAGATAGCAGTTGTGAC (SEQ ID NO. 15).

[0096] 3.4 Statistical Analysis Methods

[0097] All data are expressed as mean ± standard deviation and analyzed using GraphPad Prism 8 (GraphPad Inc., San Diego, CA, USA). Differences between groups were analyzed using one-way ANOVA and t-tests. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0098] 4. Research Results

[0099] 4.1 Applying Staphylococcus epidermidis strain M2024 can relieve symptoms of atopic dermatitis.

[0100] To observe the effect of Staphylococcus epidermidis strain M2024 in alleviating atopic dermatitis, a mouse model of atopic dermatitis was established by applying the modeling agent MC903 to the right ear of mice in the MC903 group and the MC903+M2024 group. Mice in the MC903+M2024 group were treated with 200 μL of Staphylococcus epidermidis strain M2024 suspension (2×10⁻⁶) one hour after applying MC903 daily. 8 CFU / mouse / day, the MC903 group was treated with the same volume of PBS. Mice were sacrificed after 12 consecutive days of modeling. The efficacy of Staphylococcus epidermidis M2024 strain in alleviating atopic dermatitis was evaluated by comparing ear thickness, ear pathology, serum IgE levels, and levels of various cytokines in the ears of mice in the MC903 and MC903+M2024 groups. Results showed that application of Staphylococcus epidermidis M2024 strain significantly alleviated atopic dermatitis symptoms. Compared with the MC903 group, mice in the MC903+M2024 group showed a visible reduction in dandruff (CFU / mouse / day). Figure 1 Ear thickness reduced ( Figure 2 (p < 0.0001, Vehicle group 253.3 ± 1.708 μm, MC903 group 559.7 ± 31.30 μm, MC903 + M2024 group 330.8 ± 17.50 μm); Pathological section results showed that the skin thickness of mice in the Vehicle group was normal, with no obvious infiltration of inflammatory cells and mast cells; the skin of mice in the MC903 group was significantly thickened, with a large number of inflammatory cells and mast cells infiltrating; compared with the MC903 group, the skin thickness of mice in the MC903 + M2024 group was significantly improved, and the infiltration of inflammatory cells and mast cells was significantly reduced. Figure 1 Further analysis of pathological sections showed that, compared with the MC903 group, the epidermal thickness at the skin lesion site was significantly reduced in the MC903+M2024 group mice. Figure 3 p < 0.0001, Vehicle group 17.77 ± 0.2517 μm, MC903 group 103.9 ± 11.49 μm, MC903 + M2024 group 29.87 ± 4.796 μm, mast cell number significantly reduced ( Figure 4 (p < 0.001; Vehicle group: 21.33 ± 1.528; MC903 group: 60.33 ± 1.528; MC903 + M2024 group: 30.33 ± 2.082). Serum IgE levels in mice were detected by ELISA. The results showed that the IgE levels in the MC903 and MC903 + M2024 groups were significantly higher than those in the Vehicle group, while there was no significant difference between the MC903 and MC903 + M2024 groups. Figure 5(P>0.05, Vehicle group 182.1±95.60 ng / mL, MC903 group 12870±7515 ng / mL, MC903+M2024 group 8511±4184 ng / mL). These results indicate that applying Staphylococcus epidermidis strain M2024 can alleviate symptoms of atopic dermatitis.

[0101] 4.2 Effects of applying Staphylococcus epidermidis strain M2024 on cytokines in mice with atopic dermatitis model

[0102] Inflammation-related genes in the ears of mice on day 12 of modeling were detected using real-time quantitative PCR. Il-4 and Il-1β ) and allergy initiation factor in the ears of mice on day 5 of modeling ( Tslp and Il-33 Changes in transcriptional levels were observed, and the results showed that, compared with the MC903 group, the MC903+M2024 group mice had lower levels of transcriptional transcription in their ears. Il-4 Gene expression levels were significantly reduced ( Figure 6 (p < 0.01, Vehicle group 1.131 ± 0.5944, MC903 group 34.29 ± 21.99, MC903 + M2024 group 5.898 ± 3.94). Il-1β Gene expression levels were significantly reduced ( Figure 7 (p < 0.05, Vehicle group 1.172 ± 0.6057, MC903 group 53.81 ± 30.10, MC903 + M2024 group 21.47 ± 11.90). Tslp Gene expression levels were significantly reduced ( Figure 10 (p < 0.0001, Vehicle group 1.168 ± 0.7710, MC903 group 23400 ± 6002, MC903 + M2024 group 1959 ± 1577). Il-33 Gene expression levels were significantly reduced ( Figure 12 (p < 0.05, Vehicle group 1.002 ± 0.08017, MC903 group 1.837 ± 0.2792, MC903+M2024 group 1.223 ± 0.1140). ELISA was used to detect the levels of IL-4 and IL-1β in the ears of mice on day 12 of modeling and TSLP and IL-33 in the ears of mice on day 5 of modeling. The results showed that compared with the MC903 group, the IL-4 protein level in the ears of mice in the MC903+M2024 group was significantly lower (p < 0.05). Figure 8, p < 0.05, Vehicle group: 8.528 ± 4.556 pg / mL, MC903 group: 177.0 ± 78.58 pg / mL, MC903 + M2024 group: 69.69 ± 63.87 pg / mL), the content of IL-1β protein was significantly decreased ( Figure 9 , p < 0.05, Vehicle group: 15.74 ± 2.454 pg / mL, MC903 group: 113.9 ± 46.53 pg / mL, MC903 + M2024 group: 46.95 ± 17.98 pg / mL), the content of TSLP protein was significantly decreased ( Figure 11 , p < 0.0001, Vehicle group: 17.34 ± 3.390 pg / mL, MC903 group: 1285 ± 78.04 pg / mL, MC903 + M2024 group: 392.2 ± 118.6 pg / mL), the content of IL-33 protein was significantly decreased ( Figure 13 , p < 0.0001, Vehicle group: 510.3 ± 96.60 pg / mL, MC903 group: 1185 ± 173.1 pg / mL, MC903 + M2024 group: 518.7 ± 63.47 pg / mL). The above results indicate that applying Staphylococcus epidermidis strain M2024 can reduce the levels of atopic dermatitis-related inflammatory factors and can also reduce the levels of early allergy initiation factors.

[0103] Example 3. Exploring the mechanism of the function of Staphylococcus epidermidis strain M2024 in relieving atopic dermatitis

[0104] 1. Experimental animals

[0105] Female SPF-grade C57BL / 6J mice weighing 18 - 20 g were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., with the license number SYXK (Beijing) 2022 - 0029. They were housed in the Experimental Animal Center of the Chinese Center for Disease Control and Prevention, 6 mice per cage, and the housing environment was a barrier environment with a 12-hour light / dark cycle. The mice had free access to drinking water and food. All animal experiments were conducted in accordance with the guiding principles of laboratory animal welfare ethics of the Experimental Animal Center of the Chinese Center for Disease Control and Prevention (approval number: 2023 - 025).

[0106] 2. Animal experiment design and sample collection

[0107] Mice were randomly divided into 5 groups of 12 mice each: Vehicle group (blank control group, mice ears were treated with anhydrous ethanol only), MC903 group (model group, mice ears were treated with 1 nmol MC903 daily), MC903+M2024 group (intervention group, mice ears were treated with 1 nmol MC903 for 1 hour daily, followed by 200 μL Staphylococcus epidermidis M2024 suspension daily), CH+MC903 group (AhR inhibitor + model group, mice ears were treated with 1 nmol MC903 daily, followed by CH223191), and CH+MC903+M2024 group (AhR inhibitor + intervention group, mice ears were treated with 1 nmol MC903 and CH223191 for 1 hour daily, followed by 200 μL Staphylococcus epidermidis M2024 suspension daily).

[0108] After one week of acclimatization, mice in the Vehicle group had 10 μL of anhydrous ethanol applied to their right ear daily, mice in the MC903 group had 1 nmol of MC903 (dissolved in 10 μL of anhydrous ethanol, the drug acting on the skin after the anhydrous ethanol evaporated) applied to their right ear daily, and mice in the MC903+M2024 group had 1 nmol of MC903 applied to their right ear daily, followed by 200 μL of Staphylococcus epidermidis M2024 bacterial suspension (2×10⁻⁶). 8 CFU / mouse), mice in the CH+MC903 group had 1 nmol MC903 applied to their right ear daily, followed by 10 μL of the 10 μmol / L AhR inhibitor CH223191 (MCE, Cat#HY-12684). Mice in the CH+MC903+M2024 group had 1 nmol MC903 and CH223191 applied to their right ear daily for 1 hour, followed by 200 μL of Staphylococcus epidermidis M2024 bacterial suspension (2×10⁻¹⁰ CFU / mouse). 8 CFU / mouse), and the MC903 group and CH+MC903 group were coated with the same volume of PBS for 12 consecutive days. Ear thickness was measured daily using a micrometer to record the induction process. Mice were sacrificed on days 5 and 12, and serum was collected for IgE protein content determination. Ears were removed, rapidly frozen in liquid nitrogen, and stored at -80 °C. RNA was extracted for cytokine detection (CFU / mouse). Il-1β , Il-4 , Tslp , Ahr、Cyp1a1 The transcription status of mRNA was used to determine the content of cytokine protein (TSLP) and the extraction of total protein from the ear.

[0109] 3. Sample Detection Methods

[0110] 3.1 ELISA detection of IgE protein content in mouse serum

[0111] Refer to section 3.1 of Example 2.

[0112] 3.2 ELISA detection of cytokine protein levels in mouse ears

[0113] Refer to section 3.2 of Example 2.

[0114] 3.3 Real-time quantitative PCR was used to detect changes in cytokine gene expression levels in mouse ears.

[0115] 3.3.1 Total RNA extraction from mouse ears

[0116] Refer to section 3.3.1 of Example 2.

[0117] 3.3.2 Reverse transcription

[0118] Refer to section 3.3.2 of Example 2.

[0119] 3.3.3 Real-time fluorescence quantification

[0120] Refer to section 3.3.3 of Example 2.

[0121] 3.4 Western blot analysis of protein expression in mouse ears

[0122] Cells were lysed using NP-40 cell lysis buffer (Beyotime, Cat#P0013F), then centrifuged at 12000 g for 10 min. After discarding the precipitate, 5× protein buffer was added at a ratio of 1:4, and the mixture was boiled at 100 °C for 10 min. The sample was electroporated onto a nitrocellulose membrane, which was then blocked in 5% skim milk at room temperature for 2 h. The membrane was washed three times (5 min each time) with phosphate-buffered saline (PBST), and then incubated at room temperature for 1.5 h with rabbit-derived CYP1A1 polyclonal antibody (Beyotime, Cat#AF6642). The membrane was washed three times (5 min each time) with PBST, and then incubated with HRP-labeled goat anti-rabbit IgG secondary antibody (Beyotime, Cat#A0352) at room temperature in the dark for 45 min. The membrane was washed three times (5 min each time) with PBST, and then scanned using a membrane scanner.

[0123] 3.5 Statistical Analysis Methods

[0124] All data are expressed as mean ± standard deviation and analyzed using GraphPad Prism 8 (GraphPad Inc., San Diego, CA, USA). Differences between groups were analyzed using one-way ANOVA and t-tests. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0125] 4. Research Results

[0126] 4.1 Applying Staphylococcus epidermidis strain M2024 to the skin can activate the AhR signaling pathway.

[0127] Activation of the AhR (aromatic hydrocarbon receptor) signaling pathway inhibits the early allergy initiation factor in atopic dermatitis. Tslp The transcriptional level of genes was investigated, and therefore, real-time quantitative PCR and Western blot were used to detect whether smearing Staphylococcus epidermidis strain M2024 affected the expression of AhR and CYP1A1. The results showed that, compared with the MC903 group, the MC903+M2024 group mice had significantly lower levels of AhR and CYP1A1 in their ears. AhR Gene expression levels were significantly increased ( Figure 14 (p < 0.01, Vehicle group 1.004 ± 0.09492, MC903 group 0.4655 ± 0.1337, MC903 + M2024 group 0.7178 ± 0.1375). Cyp1a1 Gene expression levels were significantly increased ( Figure 15 p < 0.001, Vehicle group 1.019 ± 0.2267, MC903 group 0.6127 ± 0.1483, MC903+M2024 group 1.267 ± 0.3049), where the Western blot results of CYP1A1 protein were consistent with the real-time quantitative PCR results ( Figure 16 The above results indicate that applying Staphylococcus epidermidis strain M2024 can activate the AhR signaling pathway.

[0128] 4.2 Applying Staphylococcus epidermidis strain M2024 alleviates atopic dermatitis symptoms by activating the AhR signaling pathway.

[0129] To investigate whether applying Staphylococcus epidermidis strain M2024 alleviates atopic dermatitis symptoms by activating the AhR signaling pathway, the AhR inhibitor CH223191 (1-methyl-N-[2-methyl-4-[2-(2-methylphenyl)diazepine]phenyl-1H-pyrazole-5-carboxamide) was applied to the ears of mice before applying M2024. The results showed that CH223191 significantly eliminated the protective effect of M2024 against MC903-induced atopic dermatitis. Mice in the CH+MC903+M2024 group exhibited significantly more severe redness, scaling, ear swelling, and ear thickness compared to the MC903+M2024 group, while showing little difference in symptoms compared to the CH+MC903 group. Figure 17 ,18). Serum IgE results showed no significant difference between the CH+MC903+M2024 group and the CH+MC903 group ( Figure 19P > 0.05; CH+MC903 group: 6101 ± 2288 ng / mL; CH+MC903+M2024 group: 5577 ± 3498 ng / mL. Real-time quantitative PCR was used to detect changes in the transcriptional levels of relevant cytokines. The results showed that the ear function of mice in the CH+MC903+M2024 group and the CH+MC903 group differed. Tslp Gene expression level ( Figure 20 P > 0.05, CH+MC903 group 2504±1003, CH+MC903+M2024 group 2064±509.3), Il-4 Gene expression level ( Figure 22 (P>0.05, CH+MC903 group 6.768±3.301, CH+MC903+M2024 group 6.997±4.050) and Il-1β Gene expression level ( Figure 23 There were no significant differences (P>0.05; CH+MC903 group 19.05±6.260, CH+MC903+M2024 group 30.94±11.66). The ELISA results for the TSLP factor were consistent with the real-time quantitative PCR results. Figure 21 (P>0.05, CH+MC903 group 2661±77.80 pg / mL, CH+MC903+M2024 group 2503±207.8 pg / mL). This result indicates that applying Staphylococcus epidermidis strain M2024 alleviates atopic dermatitis symptoms by activating the AhR signaling pathway.

Claims

1. A strain of *Staphylococcus epidermidis*, wherein the accession number is CGMCC NO.31064, the accession date is June 24, 2024, and the accession classification name is *Staphylococcus epidermidis*. Staphylococcus epidermidis The depository is the China General Microbiological Culture Collection Center of the China Association for the Preservation and Management of Microbial Cultures.

2. The Staphylococcus epidermidis strain according to claim 1, characterized in that, The 16S rRNA sequence of the strain is shown in SEQ ID NO.

1.

3. The use of the strain according to claim 1 or 2 in the preparation of a medicament for the treatment and / or prevention of calcipotriol-induced atopic dermatitis.

4. The application according to claim 3, characterized in that, The drugs mentioned for the treatment and / or prevention of atopic dermatitis refer to drugs that promote the transcription and / or expression of the AhR gene.

5. The application according to claim 3, characterized in that, The aforementioned atopic dermatitis treatment and / or prevention drugs refer to those that inhibit... Tslp Drugs that transcribe and / or express genes.

6. A composition comprising the strain of claim 1 or 2.

7. The composition according to claim 6, characterized in that, The composition also contains a pharmaceutically acceptable carrier and / or excipient.

8. The composition according to claim 6, characterized in that, The composition is prepared as capsules, lyophilized powder, or bacterial liquid preparation.

Images