A hybridoma cell line secreting monoclonal antibody against Clonorchis sinensis and its application

Abstract

The present invention discloses a hybridoma cell strain secreting a monoclonal antibody of Clonorchis sinensis and its application, belonging to the technical field of monoclonal antibodies. The present invention is to improve the sensitivity, specificity and titer of the detection of monoclonal antibodies of Clonorchis sinensis. The present invention provides a hybridoma cell strain secreting a monoclonal antibody of Clonorchis sinensis, and the hybridoma cell strain has been deposited in the General Microbiology Center of China Microbiological Culture Collection Administration Committee, with a deposit number of CGMCC NO.46128 and a deposit time of November 6, 2024. The test strip provided by the present invention is safe and harmless to the operator and will not cause pollution to the environment, so it has huge application potential and prospects in the market of clinical detection of Clonorchiasis sinensis.

Description

Technical Field

[0001] The invention belongs to the technical field of monoclonal antibodies, and in particular relates to a hybridoma cell strain secreting monoclonal antibodies of Clonorchis sinensis. Background Art

[0002] Clonorchis sinensis is an important foodborne zoonosis parasite. People become sick from eating insufficiently cooked fish and shrimp containing infectious metacercariae of Clonorchis sinensis. The metacercariae shed their cyst walls in the duodenum, and then, under the chemotaxis of bile, the larvae migrate to the liver and bile ducts. The larvae not only cause physical damage to the bile duct during migration, but also release metabolites (excretory and secretory antigens) that can stimulate an inflammatory response in the hepatobiliary system. Patients infected with Clonorchis sinensis may experience clinical symptoms such as malnutrition, diarrhea, jaundice, and cirrhosis. Those with severe illness may even develop cholangiocarcinoma.

[0003] In view of the great threat and harm that Clonorchis sinensis poses to public health and human health, the International Cancer Agency has classified Clonorchis sinensis as a Class I biological carcinogen, and my country has listed it as one of the 24 zoonotic diseases. Currently, the detection of Clonorchis sinensis still uses the relatively time-consuming, labor-intensive and low-sensitivity fecal microscopy method, which not only requires professional operation, but also cannot meet the needs of residents for self-examination at home.

[0004] Currently, although there are rapid detection technologies such as enzyme-linked immunosorbent assay and immunochromatography for Clonorchis sinensis, the accuracy of these methods is limited by the disease-specific antigen-antibody reaction. In serological testing, commonly used antigens are mainly derived from the excretory secretions of Clonorchis sinensis and the worm itself. However, these antigens are not only complex in composition, but also face problems such as cumbersome preparation process, long production cycle, and large quality differences between batches. What is more troublesome is that the poor specificity of these two antigens greatly limits the practical application of these detection methods. Summary of the invention

[0005] The purpose of the invention is to improve the sensitivity, specificity and titer of the detection of Clonorchis sinensis monoclonal antibodies.

[0006] The present invention provides a hybridoma cell strain secreting a monoclonal antibody against Clonorchis sinensis. The hybridoma cell strain has been deposited in the General Microbiology Center of China National Microbiological Culture Collection Administration with a deposit number of CGMCC NO. 46128 and a deposit date of November 6, 2024.

[0007] The invention provides a Clonorchis sinensis monoclonal antibody, wherein the monoclonal antibody is obtained by secretion of the hybridoma cell line.

[0008] The present invention provides an application of the hybridoma cell line or the monoclonal antibody in preparing a kit for diagnosing Clonorchis sinensis infection.

[0009] The present invention provides an application of the hybridoma cell line or the monoclonal antibody in preparing a prognosis detection kit for Clonorchiasis sinensis.

[0010] The invention provides a kit for detecting clonorchiasis sinensis, and the kit contains the monoclonal antibody.

[0011] It is further defined that the kit comprises a sample pad, a conjugate pad, a NC membrane and a water absorbent pad.

[0012] It is further defined that the conjugate pad is sprayed with CSTR1 antigen coupled with time-resolved fluorescent microspheres, the NC membrane includes a detection line and a quality control line, the detection line is sprayed with mouse anti-human IgG, and the quality control line is sprayed with the above-mentioned monoclonal antibody.

[0013] It is further defined that the amino acid sequence of the CSTR1 antigen is shown as SEQ ID NO.1.

[0014] Further defined, the preparation method of CSTR1 antigen coupled to time-resolved fluorescent microspheres: 10 μL of 1 mg / mL EDC, 10 μL of 1 mg / mL NHS and 100 μL of 0.05M MES were mixed with EuNPs in the dark and at room temperature for 45 minutes, then centrifuged at 14,000 g for 20 minutes, the supernatant was discarded and PB buffer was added to the precipitate, sonicated for 6 minutes, 20 μg of CSTR1 antigen was added, incubated at room temperature for 3 hours, centrifuged at 14,000 g for 15 minutes, the supernatant was discarded and 200 μL of blocking solution was added to the precipitate and blocked at 4°C for 12 hours, centrifuged at 14,000 g for 15 minutes, the supernatant was discarded and 400 μL of microsphere preservation solution was added to the precipitate.

[0015] It is further defined that ultrasound is performed using a water bath ultrasound machine with a power of 90%, ultrasound for 3 seconds, and an interval of 2 seconds.

[0016] Beneficial effects: Monoclonal antibodies have played an important role in the development of immunological detection technology due to their unique advantages - high antigen binding specificity, excellent purity, outstanding repeatability, convenience for strict quality control, good affinity and the ability to be mass-produced. Based on these characteristics, we successfully screened out hybridoma cell lines that can secrete specific monoclonal antibodies against the CSTR1 antigen, and further developed a test strip for the instant detection of human clonorchiasis. The test strip has both specificity and sensitivity, stable and reliable test results, simple and quick operation, and is suitable for large-scale epidemiological surveys and self-examination by residents. The test strip provided by the present invention is safe and harmless to the operator and will not cause pollution to the environment. Therefore, it has great application potential and prospects in the market for clinical detection of clonorchiasis.

[0017] [Biological Deposit Information]: A hybridoma cell line against the CSTR1 antigen of Clonorchis sinensis, named CSTR1-C3B4C10, has been deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number CGMCC NO.46128 and the deposit date November 6, 2024. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Ascites titer determination of CSTR1 monoclonal antibody;

[0019] Figure 2 Diagram of the structure of the human Clonorchiasis instant test strip based on monoclonal antibodies;

[0020] Figure 3 It is the test strip specificity test result diagram;

[0021] Figure 4 This is a picture of the test strip sensitivity test result;

[0022] Figure 5 The test strip mixed infection serum test results are shown in Figure 1; 1: Clonorchis sinensis positive serum, 2-3: Clonorchis sinensis and Schistosoma japonicum co-infection serum, 4-6: Clonorchis sinensis and Trichinella spiralis co-infection serum, 7-8: Clonorchis sinensis and Echinococcus co-infection serum: 9-10: Clonorchis sinensis and Cysticercus co-infection serum, 11: negative serum;

[0023] Figure 6 This is a graph showing the test strip shelf life test results. DETAILED DESCRIPTION

[0024] Example 1. Preparation of hybridoma cells

[0025] A peptide (KLH-GGKAPPPESA) was prepared based on the repeating unit of CSTR1 for mouse immunization. The peptide was prepared by Sangon Biotechnology (Shanghai) Co., Ltd.

[0026] (1) First immunization: Mix the prepared KLH-GGKAPPPESA (100 μg) with an equal amount of Freund's complete adjuvant, sonicate until the emulsion is in water, and inject 200 μL / mouse subcutaneously at multiple points. Perform the second immunization 14 days later, with the same dosage as the first immunization, and try to avoid the first inoculation site. Perform the third immunization again after an interval of 14 days, with the same process as above. For the fourth immunization, no adjuvant is added, and intraperitoneal injection is used. Serum is collected 10 days later to detect antibody titer.

[0027] (2) Determination of mouse serum titer: KLH-GGKAPPPESA polypeptide was used as an ELISA coated antigen to detect the serum antibody titer of immunized mice, and the serum of unimmunized mice was set up as a negative control. Finally, the maximum serum dilution with P / N>2.1 was taken as the mouse serum titer (Table 1).

[0028] Table 1 Detection of serum titers in immunized mice

[0029]

[0030] (3) Cell fusion. Remove SP2 / 0 cells from liquid nitrogen, quickly place them in a 37°C water bath to melt, then transfer them to a biosafety cabinet, centrifuge and remove the supernatant, resuspend them with 1 mL of DMEM basal medium, and transfer them to a culture bottle. Add an appropriate amount of complete medium, gently mix, and culture in an incubator. After one day of culture, centrifuge and remove the supernatant, count and store at 4°C. Kill the experimental mice, disinfect them with 75% alcohol, cut open the abdomen to expose the peritoneum, inject the basal culture medium into the mouse's abdominal cavity, press the abdominal cavity repeatedly and then aspirate the liquid into a centrifuge tube. After centrifugation, remove the supernatant, the bottom is the feeder layer cells, blow them away with 20% HAT complete medium, and plate them on a 96-well plate for culture at 200 μL / well. Select mice with a CSTR1 antibody titer higher than 1:5,000 after four immunizations, collect blood from the eyeballs, separate the serum, and store at -20°C for later use.

[0031] The mice were then disinfected with 75% ethanol, and the spleen was removed and ground. Filtered with a sterile mesh and rinsed with basal culture medium, the rinse solution was collected and centrifuged, and the precipitate was spleen cells, which were resuspended with basal culture medium and counted for later use. SP2 / 0 cells in the logarithmic growth phase were selected and mixed with spleen cells at a ratio of 1: 5, centrifuged to remove the supernatant, and the precipitate at the bottom of the centrifuge tube was gently knocked loose, placed in a 37°C water bath, and preheated PEG 4000 was added (completed within 60 seconds), the centrifuge tube was gently shaken, and allowed to stand for 30 seconds. Then the preheated basal culture medium was added to terminate. The cells were resuspended with 20% HAT complete culture medium, spread onto a 96-well plate, and cultured in a 37°C, 5% CO2 incubator. 20% HAT DMEM complete culture medium was supplemented on days 4 and 8, respectively, and cell fusion was observed throughout the process.

[0032] (4) Screening and cloning of positive wells. On the 5th and 10th days after cell fusion, the cell culture supernatant was collected and added to each well of a 96-well plate at 100 μL. The plates were incubated at 37°C for 60 minutes, washed three times, and patted dry. Then, 100 μL of rabbit anti-mouse secondary antibody diluted 1:5,000 was added to each well. The plates were incubated at 37°C for 60 minutes, washed three times, and patted dry. Then, 100 μL of TMB was added to each well. The plates were protected from light for 15 minutes, and 100 μL of stop solution was added to terminate the reaction. The supernatant of SP2 / 0 cells was used as a negative control in the experiment. The absorbance value was read by an ELISA reader. The 31-B4-C10 cell line with the highest titer was screened out (Table 2).

[0033] Table 2 Indirect ELISA detection of cell line supernatant titer

[0034]

[0035] Select cells with high OD values ​​for expansion culture, freeze a portion, and subclone the other portion again. After mixing the liquid in the positive cell wells detected, transfer it to a 1.5 mL centrifuge tube and centrifuge to remove the supernatant. Continue to subculture the cells to the 25th generation to obtain a stable hybridoma cell line. During the last culture, when the cells are in the logarithmic growth phase, freeze the cells, record the relevant information in detail, and store them in liquid nitrogen.

[0036] Preservation information of 31-B4-C10 cell line: A hybridoma cell line secreting monoclonal antibodies against Clonorchis sinensis, named CSTR1-C3B4C10, has been deposited in the General Microbiology Center of China Microorganism Culture Collection Administration with the deposit number CGMCC NO. 46128 and the preservation date is November 6, 2024.

[0037] (5) Preparation of monoclonal antibody ascites and titer determination. Female Balb / c mice were intraperitoneally injected with 0.5 mL of IFA to stimulate immune response. Nine days later, 0.5 mL of culture medium (containing 2×10 6 Hybridoma cells). Monitor the mental state and abdominal volume changes of mice daily. If the abdomen of the mouse is significantly swollen, collect ascites with a syringe and centrifuge at 5,000 r for more than 20 minutes. The supernatant is the monoclonal antibody and is stored at -80°C for later use.

[0038] The ascites was diluted in multiple ratios and plated on a 96-well plate, 100 μL / well, coated at 37°C for 60 minutes, washed three times with PBST and patted dry; HRP-labeled rabbit anti-mouse secondary antibody was added at a dilution of 1:5000, 100 μL / well, incubated at 37°C for 60 minutes, washed three times with PBST and patted dry; single-component TMB substrate solution was added, 100 μL / well, and color was developed at 37°C in the dark for 10 minutes; 2 M sulfuric acid was added to terminate the reaction, 100 μL / well. The negative control was coated with SP2 / 0 cell ascites, and the rest of the operation steps were the same. The results were read by the microplate reader, and the titer of mouse 31-B4-C10 ascites reached 1:32000 ( Figure 1 )

[0039] (6) Identification of monoclonal antibody subclasses. The ascites of mice injected with monoclonal antibodies was collected and the subclasses of the monoclonal antibodies were identified using IgG1, IgG2a, IgM, and IgA antibodies, respectively. The monoclonal antibody was IgG1.

[0040] Example 2. Construction of a monoclonal antibody-based instant test strip for human clonorchiasis

[0041] The instant test strip includes a sample pad, a conjugate pad, an NC membrane and a water-absorbing pad. The conjugate pad is sprayed with CSTR1 antigen (EuNPs-CSTR1) coupled with time-resolved fluorescent microspheres as a capture probe, and the cellulose acetate membrane includes a test line (T-Line) and a quality control line (C-Line) sprayed with mouse anti-human IgG and CSTR1 monoclonal antibody respectively. When a positive serum sample is detected, the EuNPs-CSTR1 probe on the conjugate pad captures the anti-C. sinensis antibody in the serum, migrates to the test line, and binds to the mouse anti-human IgG. The other part of the probe continues to chromatograph forward to the quality control line and binds to the CSTR1 monoclonal antibody.

[0042] CSTR1 antigen amino acid sequence: (SEQ ID NO.1)

[0043] GGKAPPPESAGGKAPPPESAGGKAPPPESAGGKAPPPESAGGKAPPPESAGGKAPPPESAGGKAPPPESAGGKAPPPESAGGKAPPPESAGGKAPPPESA;

[0044] CSTR1 antigen gene sequence: (SEQ ID NO.2)

[0045] GGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCT GGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCTGGCGGCAAGGCACCACCTCCTGAGTCAGCT;

[0046] Chemical coupling of time-resolved fluorescent microspheres to antigens. The capture probes were prepared by chemical coupling. The time-resolved fluorescent microspheres were centrifuged at 14,000 g for 15 min and the preservation solution was removed: 10 μL of EDC (1 mg / mL), 10 μL of NHS (1 mg / mL) and 100 μL of MES (0.05 M) were mixed with EuNPs for 45 min (dark, room temperature) to ensure that EuNPs were fully activated. Excess EDC and NHS were removed by centrifugation at 14,000 g for 20 min. PB buffer was added and ultrasonic dispersion was performed for 6 min, followed by the addition of 20 μg of CSTR1 and incubation at room temperature for 3 h. Excess coupling proteins were removed by centrifugation at 14,000 g for 15 min. 200 μL of blocking solution (5% BSA) was added and blocked at 4°C for 12 h. Excess blocking solution was removed by centrifugation at 14,000 g again for 15 min. Finally, 400 μL of microsphere preservation solution (0.05 M PBS containing 1% BSA and 1% Pro Clin 300) was added and stored at 4°C in the dark.

[0047] Preparation of conjugate pad: Spray the labeled capture probe onto the glass cellulose and dry it in an oven.

[0048] NC membrane treatment: The cellulose acetate membrane test line was coated with mouse anti-human IgG (2 mg / mL), and the quality control line was coated with CSTR1 monoclonal antibody (2 mg / mL), and dried in an oven.

[0049] Assembly. Stick the sample pad, conjugate pad, NC membrane, and absorbent pad on the PVC base plate in sequence, cut to a suitable width, and store at room temperature away from light.

[0050] Dilute the sample as needed, add the sample and react at room temperature for 10 minutes. Under ultraviolet light, the test line and quality control line of the positive sample emit red fluorescence at the same time; when testing negative samples, only the probe is retained on the quality control line, and the quality control line emits red fluorescence. The test results can be read by naked eye after ultraviolet irradiation, or accurately read by a fluorescence reader ( Figure 2 ).

[0051] Example 3. Clinical sample detection

[0052] (1) Specificity test

[0053] The specificity of the test strip was tested using sera from patients with other parasites, including sera from patients with Schistosoma japonicum, Trichinella spiralis, Toxoplasma gondii, Whipworm, Cysticercus, Ascaris, Hookworm, and Echinococcosis, and sera from healthy people were used as controls. The results showed that, except for the sera from patients with Clonorchis sinensis, the test strips for the sera from patients with other parasites were all negative, indicating that the test strip had good specificity ( Figure 3 ).

[0054] (2) Sensitivity test

[0055] The serum samples were divided into different categories according to the infection intensity observed by the KK method in the fecal samples (EPG = 0, 24, 48, 72, 96, 120, 144, 168, 192, 216, 240), and each serum sample was tested by FIA to evaluate its sensitivity. Each reaction was performed three times according to the predetermined optimal conditions. The cross-reaction test was performed using 9 other parasites to evaluate the specificity of FIA, and all these sera were tested three times under the optimal conditions. The results showed that serum samples with low-intensity infection could also be accurately detected by the test strip, indicating that the test strip has good sensitivity ( Figure 4 ).

[0056] (3) Test strips for detection of mixed infection serum

[0057] In order to verify the detection effect of the fluorescent test strip on serum co-infected with Clonorchis sinensis and other parasites, 9 mixed infected sera were tested using the optimized test strips. The results showed that the test strips can identify serum samples co-infected with Clonorchis sinensis and other parasites ( Figure 5 ).

[0058] (4) Test strip shelf life test

[0059] After a series of test strip optimization experiments, the shelf life of the test strip needs to be tested. The test strip is stored at room temperature (22-28°C) away from light. The test strip is tested for negative serum, weak positive serum and strong positive serum every 15 days. The results show that the test strip can still detect weak positive samples after being stored at room temperature and away from light for 90 days ( Figure 6 )

[0060] (5) FI and KK methods were used to test 133 clinical serum samples and corresponding fecal samples from the endemic area of ​​clonorchiasis, and the test results were compared to evaluate the clinical application performance of FIA. The positive rate of serum samples detected by FIA was 44.36% (59 / 133), which was consistent with the results of fecal microscopy (Table 3).

[0061] Table 3 Comparison of detection effect of EuNPs-FIA with KK method and PCR method

[0062]

[0063] In summary, the present invention prepared and identified a monoclonal antibody against Clonorchis sinensis CSTR1. On this basis, the human serological instant detection method for Clonorchiasis sinensis established in combination with time-resolved fluorescent microsphere nanomaterials has strong specificity and no cross-reaction with other types of parasite sera; it has high sensitivity and can detect patients with low-intensity infection (EPG≥24); it has high accuracy and is consistent with the detection results of traditional fecal microscopy, with specificity and sensitivity both of 100%, providing technical guarantee for the rapid detection of human Clonorchiasis sinensis.

Claims

1. A hybridoma cell line secreting a monoclonal antibody against Clonorchis sinensis, characterized in that: The hybridoma cell line has been deposited in the General Microbiology Center of China Microorganism Culture Collection Administration, with the deposit number CGMCC NO. 46128 and the deposit date being November 6, 2024.

2. A monoclonal antibody against Clonorchis sinensis, characterized in that: The monoclonal antibody is secreted by the hybridoma cell line according to claim 1.

3. A kit for detecting clonorchiasis, characterized in that: The kit contains the monoclonal antibody according to claim 2.

4. The kit according to claim 3, characterized in that The kit includes a sample pad, a conjugate pad, an NC membrane and a water absorbent pad.

5. The kit according to claim 4, characterized in that The conjugate pad is sprayed with CSTR1 antigen coupled with time-resolved fluorescent microspheres, and the NC membrane includes a detection line and a quality control line. The detection line is sprayed with mouse anti-human IgG, and the quality control line is sprayed with the monoclonal antibody described in claim 2; the amino acid sequence of the CSTR1 antigen is shown in SEQ ID NO.

1.

6. The kit according to claim 5, characterized in that Preparation method of CSTR1 antigen coupled to time-resolved fluorescent microspheres: 10 μL of 1 mg / mL EDC, 10 μL of 1 mg / mL NHS and 100 μL of 0.05 M MES were mixed with EuNPs in the dark and at room temperature for 45 minutes, then centrifuged at 14,000 g for 20 minutes, the supernatant was discarded, PB buffer was added to the precipitate, sonicated for 6 minutes, 20 μg of CSTR1 antigen was added, incubated at room temperature for 3 hours, centrifuged at 14,000 g for 15 minutes, the supernatant was discarded, 200 μL of blocking solution was added to the precipitate, blocked at 4°C for 12 hours, centrifuged at 14,000 g for 15 minutes, the supernatant was discarded, and 400 μL of microsphere storage solution was added to the precipitate.

7. The kit according to claim 6, characterized in that Ultrasonication was performed using a water bath ultrasonic machine with a power of 90%, ultrasonication for 3 seconds and an interval of 2 seconds.

Images