Chilo suppressalis gene CsFer1, coding product thereof and application of Chilo suppressalis gene CsFer1 in prevention and treatment of Chilo suppressalis

Abstract

The invention discloses a chilo suppressalis gene CsFer1, a coding product of the gene CsFer1 and application of the gene CsFer1 to prevention and treatment of chilo suppressalis. The gene CsFer1 has a DNA sequence as shown in SEQ ID No.1. The gene sequence is a complete coding frame composed of 699 nucleotides, and small molecular weight protein containing 232 amino acid residues is coded. Research finds that the gene is related to growth and development of chilo suppressalis. An RNAi carrier of CsFer1 is constructed and transferred into rice, dsRNA of the CsFer1 gene is expressed in transgenic rice, and the purpose of improving the resistance of rice to chilo suppressalis can be achieved. The invention will be widely applied in crop breeding, especially in rice insect-resistant breeding.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a striped stem borer gene CsFer1 and a coding product thereof and application in preventing and controlling the striped stem borer. Background Art

[0002] Rice (Oryza sativa L.) is one of the most important food crops in China and even in the world. Every year, rice production is greatly lost due to rice pests, and even no grain is harvested in severe years. Therefore, how to increase food production by reducing pests is an urgent problem that humans must face today.

[0003] The Chilo suppressalis is widely distributed in the world, involving many countries in Eurasia. In my country, the Chilo suppressalis damages the area from north (such as Heilongjiang) to south (such as Hainan Island). According to different climatic conditions, as the latitude decreases, the number of generations of Chilo suppressalis gradually increases from north to south to more than three generations. Chilo suppressalis has a wide range of hosts and is difficult to control. Due to factors such as the renewal of rice varieties, changes in rice farming methods, and the emergence of Chilo suppressalis resistance, the degree of damage caused by Chilo suppressalis in my country continues to rise. The control of Chilo suppressalis has always been based on chemical agents, but because the occurrence and damage of Chilo suppressalis have always been obviously irregular, it is difficult to grasp the effective control period, so it has developed obvious resistance to many agents. In the integrated control system for Chilo suppressalis, planting insect-resistant rice varieties is one of the most economical and effective methods to control pests, thereby ultimately achieving sustainable control of Chilo suppressalis.

[0004] RNA interference (RNAi) refers to the phenomenon that exogenous or endogenous dsRNA (double-stranded RNA, dsRNA) specifically causes the silencing of target gene expression. There have been many reports on the functional study of insect genes using RNAi technology. In recent years, attempts have been made at home and abroad to silence the corresponding target genes of feeding insects by using transgenic plants to express related gene dsRNA, thereby affecting the survival, development and reproduction of insects, hoping to ultimately achieve the purpose of controlling pests. Recently, this technology has begun to be implemented in the field and has achieved good results. Among them, the use of transgenic rice to express dsRNA of genes related to piercing-sucking mouthparts pests such as brown planthoppers (hexose transporter gene, NlHT1, carboxypeptidase gene, Nlcar and trypsin-like serine protease gene, Nltry) can reduce the transcription level of target genes to a certain extent, but the lethal effect on brown planthoppers is not obvious.

[0005] So far, no target gene related to the Chilo suppressalis that can be used with this technology has been cloned either at home or abroad. The purpose of controlling the damage caused by the Chilo suppressalis can be achieved by silencing the gene through transgenic rice. Summary of the invention

[0006] Purpose of the invention: The technical problem to be solved by the present invention is to provide a Chilo suppressalis gene CsFer1, a fragment thereof or an expression product thereof.

[0007] The technical problem that the present invention needs to solve is to provide a protein encoded by the Chilo suppressalis gene CsFer1.

[0008] The technical problem that the present invention needs to solve is to provide an expression cassette, a recombinant vector or a cell.

[0009] The technical problem that the present invention also solves is to provide the application of the Chilo suppressalis gene CsFer1, its fragments or its expression products, the protein, the expression cassette, the recombinant vector, the recombinant strain, and the recombinant cell in controlling Chilo suppressalis or obtaining insect-resistant plants.

[0010] The technical problem that the present invention also solves is to provide a method for obtaining plants with insect-resistant function.

[0011] The technical problem that the present invention also solves is to provide a method for identifying and obtaining plants with insect-resistant function.

[0012] Technical solution: To solve the above technical problems, the present invention provides a Chilo suppressalis gene CsFer1, a fragment thereof or an expression product thereof, wherein the nucleotide sequence of the CsFer1 gene, a fragment thereof or an expression product thereof is selected from (a) or (b):

[0013] (a) the nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.13;

[0014] (b) having 80% to 90% or more homology with the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.13.

[0015] The present invention also includes the protein encoded by the Chilo suppressalis gene CsFer1, which is selected from (1) or (2):

[0016] (1) a protein whose amino acid sequence is shown in SEQ ID NO.2;

[0017] (2) A protein derived from SEQ ID NO. 2, wherein one or more amino acid residues of the amino acid residue sequence of SEQ ID NO. 2 are substituted, deleted or added and the protein has the same activity as the amino acid residue sequence of SEQ ID NO. 2.

[0018] The present invention also includes an expression cassette, a recombinant vector, a recombinant strain, a recombinant cell or an expression product thereof, which contains the Chilo suppressalis gene CsFer1 or a fragment thereof.

[0019] Wherein, the recombinant vector includes a silencing vector, an interference vector or a knockdown vector. Preferably, the interference vector includes pCAMBIA1301-RNAi-CsFer1.

[0020] The present invention also includes the Chilo suppressalis gene CsFer1, its fragment or its expression product, the protein or the expression cassette, recombinant vector, recombinant strain or cell, and the use of the recombinant vector in preventing and controlling Chilo suppressalis or cultivating insect-resistant plants.

[0021] The method for preventing and controlling the striped stem borer comprises feeding the striped stem borer with a substance containing the striped stem borer gene CsFer1, a fragment thereof or an expression product thereof.

[0022] Preferably, the expression product includes a dsRNA fragment expressing the CsFer1 gene.

[0023] The present invention also includes a method for cultivating plants with insect-resistant functions, which comprises introducing the said Chilo suppressalis gene CsFer1, its fragment or its expression product, the said expression cassette, the recombinant vector, the recombinant strain or the recombinant cell, and the said recombinant vector into the plant; preferably, the said method enables the said plant to express the dsRNA fragment of the CsFer1 gene.

[0024] The plants include but are not limited to rice, and may also be other green plants.

[0025] Wherein, the method comprises steps such as genetic modification, hybridization, backcrossing or asexual reproduction.

[0026] A method for identifying and obtaining plants with insect-resistant functions, wherein the plant is a plant containing the gene or a plant obtained by the method, comprising the following steps: identifying whether the plant obtained by the method contains the Chilo suppressalis gene CsFer1 or its fragment or its expression product; preferably, the step of identifying whether the plant expresses a dsRNA fragment of the CsFer1 gene.

[0027] The invention obtains the full length of CsFer1 gene by sequencing and analyzing the transcriptome of salivary gland of striped stem borer; then synthesizes the corresponding dsRNA by using the CsFer1 gene fragment as a template; and analyzes the gene expression level of CsFer1 in striped stem borer and the corresponding body weight and borer ability after RNAi silencing of the CsFer1 gene by feeding the target fragment dsRNA; and transforms the striped stem borer gene CsFer1 into rice by using transgenic technology, so that the transgenic rice expresses the dsRNA fragment of the CsFer1 gene.

[0028] Beneficial effects: Compared with the prior art, the present invention has the following advantages: the present invention obtains a new rice stem borer gene CsFer1, the gene sequence of which is a complete coding frame consisting of 599 nucleotide bases, encoding a small molecular weight protein containing 232 amino acid residues. The present invention finds through experimental research that the gene is related to the growth and development of the rice stem borer, and constructs an RNAi vector of CsFer1, transfers it into rice, and expresses the dsRNA of the CsFer1 gene in the transgenic rice, which can achieve the purpose of improving the resistance of rice to the rice stem borer. The present invention will be widely used in crop breeding, especially in rice insect-resistant breeding. The present invention uses the transgenic technology to prove that the transgenic rice transferred with the CsFer1 gene has an excellent insect-resistant effect on the rice stem borer. The isolation and cloning of the gene will play an important role in promoting the insect-resistant breeding of crops, especially the rice borer-resistant breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is the full-length electrophoresis diagram of the CsFer1 gene of the Chilo suppressalis. In the figure, lane 1 is the PCR electrophoresis result of the Chilo suppressalis, and M is a marker;

[0030] Figure 2 It is a bar graph of the inhibitory effect of CsFer1 dsRNA on the expression of CsFer1 after feeding C. suppressalis. In the figure, dsCsFer1 refers to C. suppressalis fed with CsFer1 dsRNA solution (OD600=0.8); dsGFP refers to C. suppressalis fed with GFP dsRNA solution (OD600=0.8); the asterisk indicates that there is a very significant difference in the expression level of CsFer1 gene between the dsCsFer1 group and the dsGFP group (**, P<0.01, Student's t-tests), and the bar graph is the mean + standard error (n=10);

[0031] Figure 3This is a graph showing the effect of feeding CsFer1 dsRNA on the body weight of Chilo suppressalis, which refers to Chilo suppressalis fed with CsFer1 dsRNA bacterial solution (OD600=0.8); dsGFP refers to Chilo suppressalis fed with GFP dsRNA bacterial solution (OD600=0.8); asterisks indicate that there is a very significant difference in the body weight of Chilo suppressalis between the dsCsFer1 group and the dsGFP group (**, P<0.01, Student's t-tests), and the bar graph is the mean + standard error (n=5);

[0032] Figure 4 It is a bar graph showing the effect of feeding CsFer1 dsRNA on the boring time of rice. In the figure, refers to the rice borer fed with CsFer1 dsRNA solution (OD600=0.8); dsGFP refers to the rice borer fed with GFP dsRNA solution (OD600=0.8); the asterisk indicates that there is a significant difference in the boring time of rice by the rice borer between the dsCsFer1 group and the dsGFP group (*, P<0.05, Student's t-tests), and the bar graph is the mean + standard error (n=10);

[0033] Figure 5 It is a schematic diagram of the plasmid structure of the rice genetic transformation vector containing the CsFer1 gene;

[0034] Figure 6 Figure 1 is a bar graph showing the inhibitory effect of feeding on transgenic rice expressing CsFer1 dsRNA on the expression level of CsFer1 gene in Chilo suppressalis. In the figure, irCsFer1-3: the expression level of CsFer1 gene in Chilo suppressalis feeding on the transgenic rice line irCsFer1-3 expressing CsFer1 dsRNA; irCsFer1-7: the expression level of CsFer1 gene in Chilo suppressalis feeding on the transgenic line irCsFer1-7 expressing CsFer1 dsRNA; WT: the expression level of CsFer1 gene in Chilo suppressalis feeding on non-transgenic rice; letters in the figure indicate that there is a significant difference in the expression level of CsFer1 gene between Chilo suppressalis feeding on transgenic lines (irCsFer1-3 or irCsFer1-7) and WT rice (*, P<0.05, one-way ANOVA followed by Duncan's multiple range test), the bar graph is the mean + standard error (n = 10);

[0035] Figure 7This is a diagram showing the effect of feeding on transgenic rice expressing CsFer1 dsRNA on the pupation rate of the Chilo suppressalis. In the figure, irCsFer1-3: the pupation rate of the Chilo suppressalis feeding on the transgenic rice line irCsFer1-3 expressing CsFer1 dsRNA; irCsFer1-7: the pupation rate of the Chilo suppressalis feeding on the transgenic rice line irCsFer1-7 expressing CsFer1 dsRNA; WT: the pupation rate of the Chilo suppressalis feeding on non-transgenic rice; letters in the figure indicate that there is a significant difference in the pupation rate between the Chilo suppressalis feeding on the transgenic lines (irCsFer1-3 or irCsFer1-7) and WT rice (*, P<0.05, one-way ANOVA followed by Duncan's multiple range test), and the bar graph is the mean + standard error (n=10);

[0036] Figure 8 This is a graph showing the effect of feeding on transgenic rice expressing CsFer1 dsRNA on the body weight of Chilo suppressalis. In the graph, irCsFer1-3: body weight of Chilo suppressalis feeding on the transgenic rice line irCsFer1-3 expressing CsFer1 dsRNA for seven days; irCsFer1-7: body weight of Chilo suppressalis feeding on the transgenic rice line irCsFer1-7 expressing CsFer1 dsRNA for seven days; WT: body weight of Chilo suppressalis feeding on non-transgenic rice for seven days; letters in the graph indicate that there is a significant difference in body weight of Chilo suppressalis feeding on transgenic lines (irCsFer1-3 or irCsFer1-7) and WT rice for seven days (*, P<0.05, one-way ANOVA followed by Duncan's multiple range test), and the bar graph is the mean + standard error (n=10). DETAILED DESCRIPTION

[0037] The embodiments of the present invention will be described in detail below in conjunction with the examples, but it will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. If no specific conditions are specified in the examples, the conditions are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified for the reagents or instruments used, they are all conventional products that can be obtained commercially.

[0038] The present invention obtains transcriptome data by constructing a salivary gland transcriptome library of a striped stem borer and performing high-throughput sequencing, and preliminarily obtains a full-length sequence of CsFer1 CDS. First, a pair of primers CsFer1-CDS-F and CsFer1-CDS-R are designed in the non-coding regions at the 5' end and 3' end of the CDS sequence. Then, the striped stem borer RNA is extracted and reversely transcribed into cDNA, and the cDNA is used as a template, and a conventional PCR reaction is performed with CsFer1-CDS-F and CsFer1-CDS-R as primers to obtain the full-length sequence of CsFer1 CDS and connect it to a pMD19-T cloning vector, transform it into an Escherichia coli competent cell (TG1), shake the bacteria, and send the bacterial solution for sequencing (Nanjing GenScript Company). The sequencing result is compared and verified with the full-length sequence of CsFer1 CDS obtained from the transcriptome. Then, a 367bp fragment was selected from the CsFer1 CDS sequence to design and synthesize dsRNA, and RNAi was performed on the target gene by feeding method to detect its inhibitory effect on the expression level of the target gene and its influence on the body weight and boring ability of the striped stem borer. A rice transgenic mutant expressing the CsFer1 gene dsRNA was obtained by transgenic technology. Through bioassay, it was proved that this transgenic rice has a good insect-resistant effect. The isolation and cloning of the gene and the analysis of its biological function will play an important role in promoting the insect-resistant breeding of crops, especially the rice resistance to the striped stem borer. In the embodiment of the present invention, the PCR amplification and T4 ligase used the kit purchased by Takara Company, and the homologous recombination used the kit purchased by Vazyme Company.

[0039] Example 1: Acquisition and sequence analysis of CsFer1 gene

[0040] Using the method of sequencing the salivary gland transcriptome of Chilo suppressalis, an expression gene database was obtained, and the CsFer1 gene was screened, and the full-length sequence of CsFer1 CDS (SEQ ID NO.1) was initially obtained. The salivary gland mRNA of Chilo suppressalis (Nanjing area) was extracted and reverse transcribed into cDNA. The cDNA was used as a template, and CsFer1-CDS-F and CsFer1-CDS-R were designed from the 5' and 3' non-coding regions of the CsFer1 gene. PCR amplification of CDS ( Figure 1 ) full-length sequence was connected into the pMD19-T cloning vector and transformed into Escherichia coli competent cells (TG1). Four clones were selected and sent to Nanjing GenScript for sequencing to obtain the CsFer1 gene DNA sequence, as shown in the sequence table SEQ ID No. 1. Based on the open reading frame (ORF) of the sequence, the amino acid sequence of the protein encoded by the gene was deduced, as shown in SEQ ID No. 2.

[0041] SEQ ID NO.1:

[0042]

[0043] SEQ ID No.2:

[0044]

[0045] The specific steps are:

[0046] 1) Extraction, quality inspection and first-strand synthesis of total cDNA from salivary glands of Chilo suppressalis;

[0047] 2) synthesizing the CsFer1 CDS fragment from the first strand of total cDNA by PCR;

[0048] Upstream primer (SEQ ID No. 3): 5'-ATGAAGGTGTTATTGAGTACAGTGA-3'

[0049] Downstream primer (SEQ ID No. 4): 5′-TTAAACGGTTTTTTGGAGGTACTCG-3′

[0050] PCR amplification system (Takara): buffer 10 μL, 1 μL 10 μM upstream primer, 1 μL 10 μM downstream primer, 1 μL template cDNA, 1 μL, 0.2 μL 5U / μL Taq enzyme, and 6.8 μL double distilled water.

[0051] PCR amplification conditions: 98℃×3min→(98℃×30sec→55℃×30sec→72℃×30sec)×35 cycles→72℃×10min, specific PCR amplification products were obtained. Figure 1 .

[0052] 3) Construction of pMD19-CsFer1 cloning vector and gene base analysis

[0053] The specific PCR amplification product was cloned into the pMD19-T vector of Takara Company to obtain the pMD19-CsFer1 vector, and then transferred into TG1 Escherichia coli by heat shock method. The TG1 bacterial solution containing the pMD19-CsFer1 vector was sent to Nanjing GenScript Company for sequencing. Sequence alignment analysis was performed using NCBI Blast (http: / / www.ncbi.nlm.nih.gov / BLAST / ) to obtain the sequence SEQ ID No.1 in the sequence table. The gene of this cDNA was named CsFer1. Based on the open reading frame (ORF) of the sequence, the amino acid sequence of the protein encoded by the gene was deduced, as shown in SEQ ID No.2.

[0054] Example 2 Synthesis of Chilo suppressalis CsFer1 dsRNA and its RNAi effect

[0055] siDirect (http: / / sidirec2.rnai.jp / ) was used to design the target fragment. At the same time, specific primers dsCsFer1-T7-F, dsCsFer1-T7-R and dsGFP-T7-F, dsGFP-T7-R were designed according to the restriction sites on the pET-2p plasmid (gift from Xinjiang Academy of Agricultural Sciences, source of the article: Evaluation of the effects of dsRNA extraction methods for prokaryotic expression of double-stranded RNA, DOI:10.6048 / j.issn.1001-4330.2021.04.013). By constructing vectors expressing CsFer1 dsRNA and GFP dsRNA, and then transferring them into HT115 competent cells, bacterial solutions containing dsCsFer1 and dsGFP were obtained. The third-instar Chilo suppressalis larvae were placed in feed soaked in dsCsFer1 or dsGFP bacterial solutions for long-term feeding. Firstly, the effect of feeding dsRNA on the expression level of CsFer1 gene in Chilo suppressalis was detected.

[0056] The specific steps are:

[0057] 1) Using the pMD19-CsFer1 and GFP plasmid (donated by Zhejiang University) cloning vectors constructed in Example 1 as templates, PCR was performed using primers designed with restriction sites (dsCsFer1-T7-F and dsCsFer1-T7-R) to amplify a 367 bp CsFer1 gene fragment and a 357 bp GFP gene fragment with the same CsFer1 dsRNA sequence.

[0058] CsFer1 fragment: (SEQ ID NO.13)

[0059]

[0060] Gfp fragment (SEQ ID NO.14)

[0061]

[0062]

[0063] PCR primers:

[0064] dsCsFer1-T7-F (SEQ ID No. 5):

[0065]

[0066] dsCsFer1-T7-R (SEQ ID No. 6):

[0067]

[0068] dsGFP-T7-F (SEQ ID No. 7):

[0069]

[0070] dsGFP-T7-R (SEQ ID No. 8):

[0071]

[0072] The PCR amplification system (the kit was purchased from Takara) was the same as that in Example 1.

[0073] PCR amplification conditions: CsFer1: 98℃×3min→(98℃×30sec→65℃×30sec→72℃×30sec)×35 cycles→72℃×10min GFP: 98℃×3min→(98℃×30sec→65℃×30sec→72℃×40sec)×35 cycles

[0074] →72℃×10min.

[0075] 2) The PCR products were recovered by gel tapping, and the CsFer1 / GFP gene fragment was inserted into the pET-2p vector by homologous recombination (the kit was purchased from Vazyme) using the recovered products as templates, thereby obtaining RNAi expression vector pET-2p-CsFer1 and expression vector pET-2p-GFP containing the CsFer1 / GFP gene fragment.

[0076] 3) The expression vectors pET-2p-CsFer1 and pET-2p-GFP were respectively transferred into HT115 competent cells by heat shock method, and single colonies were screened on double-antibody plates (kanamycin 50 μg / mL, tetracycline 10 μg / mL). The dsCsFer1 and dsGFP bacterial solutions with correct sequences were mixed with LB double-antibody culture medium (kanamycin 50 μg / mL, tetracycline 10 μg / mL) at a volume ratio of 1:1000, and cultured in an incubator at 37°C, 200 rpm until OD600 = 0.8 for later use.

[0077] 4) The bacterial solution to be used was expanded to 250 mL, centrifuged at 5000 g for 10 min, the supernatant was discarded, and the bacterial precipitate was thoroughly suspended with 0.01 times the volume of PBS buffer to prepare the dsRNA feeding bacterial solution. The artificial diet of Chilo suppressalis was cut into small pieces of 10 mm x 10 mm x 5 mm, and the feed was immersed in the bacterial solution, and the surface liquid was taken out and dried for 10 min for use.

[0078] 5) Select the first day of the third instar Chilo suppressalis larvae, raise them individually in a 24-well plate, and feed them with feeds soaked in dsCsFer1 and dsGFP bacterial solutions, which are freshly prepared and replaced every day. On the second and fifth days after feeding, 10 Chilo suppressalis samples were randomly selected from each treatment, and total RNA was extracted, which was then reverse transcribed into the first strand of cDNA. Combined with the following quantitative primers, the effect of feeding CsFer1 dsRNA on the expression level of CsFer1 gene in Chilo suppressalis was detected ( Figure 2 ).

[0079] CsFer1 quantitative primers:

[0080] CsFer1-F (SEQ ID No.9): 5'-GCCACAGAGTTGCAAGCATA-3'

[0081] CsFer1-R (SEQ ID No.10): 5'-ACGCTGGCTGAAGTTCATTT-3'

[0082] Internal reference elongation factor quantitative primers:

[0083] elongation factor-F(SEQ ID No.11):5'-AAAATGGACTCGACTGAACCCC-3'

[0084] elongation factor-R(SEQ ID No.12):5'-TCTCCGTGCCAACCAGAAATA-3'

[0085] 6) The same batch of 3rd instar larvae of the same development were fed with dsRNA according to the above feeding method. Two treatments were set in the same group of experiments: feeding on dsCsFer1 soaked in CsFer1 dsRNA (OD600=0.8) bacterial solution or dsGFP soaked in GFP dsRNA (OD600=0.8) bacterial solution, and the bacterial solution was freshly prepared and the feed was changed every day. After the larvae of the same treatment were fed for 7 days, the weight of the larvae of each treatment was randomly selected and weighed using a balance, and the weight of each larvae was recorded. Each treatment was repeated 5 times, and 10 larvae of the same treatment were selected in each repeat.

[0086] 7) The same batch of 3rd instar larvae of Chilo suppressalis with the same development were fed with dsRNA according to the above feeding method. Two treatments were set in the same group of experiments: dsCsFer1 soaked in CsFer1 dsRNA (OD600=0.8) solution or dsGFP control soaked in GFP dsRNA (OD600=0.8) solution. After 2 days of feeding, the larvae were starved for 8 hours and then placed on healthy rice in the tillering stage to observe their boring behavior and record the boring time. Each treatment was repeated 10 times, and 3 larvae were placed in each repeat.

[0087] The results showed that the method of feeding dsRNA can indeed induce silencing of target genes in Chilo suppressalis, causing the expression of target genes to be continuously suppressed ( Figure 2 We also measured the weight changes of C. suppressalis fed with CsFer1 dsRNA feed 7 days later and their ability to bore into rice. The results showed that compared with those fed with GFP dsRNA, the weight growth of C. suppressalis after CsFer1 gene silencing was significantly reduced and their ability to bore into rice was significantly weakened ( Figure 3 and 4 ).

[0088] Example 3: Obtaining transgenic rice lines expressing CsFer1 dsRNA and testing their resistance to Chilo suppressalis

[0089] Study on the insect resistance of transgenic CsFer1 dsRNA rice: A rice genetic transformation vector containing the CsFer1 gene was constructed, and the constructed expression vector was transformed into Agrobacterium by electroporation to obtain engineered Agrobacterium containing the expression vector. The rice callus was infected with the mature Agrobacterium transgenic method in our laboratory. After resistance screening, the callus obtained callus tissue integrated with the target gene, and then cultured in differentiation medium and rooting medium to obtain transgenic rice expressing CsFer1 gene dsRNA. No physiological defects were found in the rice plants, and normal generations were obtained. 1. Using the pMD19-CsFer1 cloning vector constructed in Example 1 as a template, PCR was performed using a forward fragment primer pair designed with restriction sites Cla I and KpnI (NEB, catalog number: R0141S and R3133S) and a reverse fragment primer pair designed with restriction sites SmaI and SpeI (NEB, catalog number: R0141S and R3133S) to amplify the PCR amplification products of the forward fragment and reverse fragment of the 367 bp CsFer1 gene that are identical to the CsFer1 dsRNA sequence amplified in Example 2.

[0090] PCR forward fragment primer pair and reverse fragment primer pair:

[0091] Forward fragment primer F: TCGTCGACGCTGCGTACTTCAATAACTATCAGACCA

[0092] Forward fragment primer R: ATGGTACCCCAGCTATTTCGCGAATTGTC

[0093] Reverse fragment primer F: ATCCCGGGGCTGCGTACTTCAATAACTATCAGACCA

[0094] Reverse fragment primer R: GCTCTAGACCAGCTATTTCGCGAATTGTC The PCR amplification system and amplification conditions are the same as those in step 1) of Example 2.

[0095] 2. The PCR products of the forward fragment and the reverse fragment are respectively recovered by gel tapping, and the recovered products, the forward fragment and the reverse fragment of the CsFer1 gene, are obtained. The forward fragment of CsFer1 gene was first inserted into the pCAMBIA1301-RNAi vector (Silencing OsSLR1 enhances the resistance of rice to the brown planthopper Nilaparvata lugens, donated by Zhejiang University) after double digestion with Cla I and Kpn I using T4 ligase (according to the instructions of Takara's T4 DNA Ligase Kit, catalog number: D2011A), and then transformed into DH5α Escherichia coli by heat shock method and propagated to extract plasmid (Vazyme Company), and then the plasmid with inserted CsFer1 forward fragment was double digested with SmaI and SpeI, and then the reverse fragment of CsFer1 gene was ligated to the plasmid containing the forward fragment after digestion with T4 ligase, and finally the RNAi expression vector pCAMBIA1301-RNAi-CsFer1 ( Figure 5 ).

[0096] 3. pCAMBIA1301-RNAi-CsFer1 was transferred into Agrobacterium EHA105 by electroporation to obtain the Agrobacterium engineered cell line. Rice callus was infected by Agrobacterium transfection method, and the co-infected rice callus was cultured in NBDS1 medium containing hygromycin.

[0097] [NBD (NB (agar broth medium) + 2mg / L 2,4-D + 500mg / L GLu + 500mg / L Pro + 300mg / L Casein + 30g / l Sucrose + 3g / l Phytagel) + 3g / L Hytagel + Cef 200mg / L + Hyg 30mg / L, pH = 5.8] culture, the first screening 20 days. When the new resistant callus grows, the resistant callus is peeled off from the mother and transferred to the new screening medium NBDS2 (NBD + 3g / L Hytagel + Cef 150mg / L + Hyg 50mg / L, pH = 5.8), one resistant callus is one strain. After subculture and propagation, the resistant calli are cultured on the pre-differentiation medium MS-PG (MS+2mg / LBA+5mg / L ABA+1mg / L NAA+30g / L Sucrose+10-20g / L Sorbitol+3g / L Phytogel, pH5.8) at 26-28°C in the dark for 7-10 days; then, they are transferred to the differentiation medium MS-RG (MS+2-3mg / L BA+0.1-0.5mg / L NAA+3g / LPhytogel, pH5.8), cultured at 26-28°C with 16h light intensity for 2-3 weeks, and the calli first turn green and then differentiate into T0 generation plants.

[0098] 4. From the T1 generation seeds obtained from the T0 generation transgenic plants, remove the plants without CsFer1 and plant them individually. Harvest the T2 generation seeds and identify the seeds of each individual plant. Obtain the homozygous lines irCsFer1-3 and irCsFer1-7 of the CsFer1 gene for the subsequent biological function analysis.

[0099] 5. The transgenic rice lines irCsFer1-3, irCsFer1-7 and non-transgenic rice were subjected to a Chilo suppressalis damage test. The expression level of the CsFer1 gene, pupation rate, body weight change and other indicators in the bodies of Chilo suppressalis after feeding on the transgenic rice were compared, so as to analyze the important role of CsFer1 in resistance to Chilo suppressalis.

[0100] Bioassays showed that the expression level of CsFer1 gene was significantly reduced after Chilo suppressalis fed on transgenic rice expressing CsFer1 dsRNA compared with non-transgenic rice ( Figure 6 ), the pupation rate of Chilo suppressalis was significantly reduced ( Figure 7 ), and the amount of weight gain also decreased significantly ( Figure 8 ).

Claims

1. A Chilo suppressalis gene CsFer1, a fragment thereof or an expression product thereof, wherein the nucleotide sequence of the CsFer1 gene, the fragment thereof or the expression product thereof is selected from (a) or (b): (a) the nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.13; (b) having 80% to 90% or more homology with the nucleotide sequence shown in SEQ ID NO.1 or SEQ ID NO.

13.

2. The protein encoded by the Chilo suppressalis gene CsFer1 according to claim 1, wherein the protein is selected from (1) or (2): (1) a protein whose amino acid sequence is shown in SEQ ID NO.2; (2) A protein derived from SEQ ID NO. 2, wherein one or more amino acid residues of the amino acid residue sequence of SEQ ID NO. 2 are substituted, deleted or added and the protein has the same activity as the amino acid residue sequence of SEQ ID NO.

2.

3. An expression cassette, a recombinant vector, a recombinant strain, a recombinant cell or an expression product thereof, which contains the Chilo suppressalis gene CsFer1 or a fragment thereof according to claim 1.

4. The recombinant vector according to claim 3, characterized in that The recombinant vector includes a silencing vector, an interference vector or a knockdown vector. Preferably, the interference vector includes pCAMBIA1301-RNAi-CsFer1.

5. Use of the Chilo suppressalis gene CsFer1 according to claim 1, the protein according to claim 2, the expression cassette, recombinant vector, recombinant strain or cell according to claim 3, the recombinant vector according to claim 4 or its expression product in controlling Chilo suppressalis or cultivating insect-resistant plants.

6. The use according to claim 5, characterized in that: The method for controlling the striped stem borer comprises feeding the striped stem borer with a substance containing the striped stem borer gene CsFer1, a fragment thereof or an expression product thereof according to claim 1. Preferably, the expression product comprises a dsRNA fragment expressing the CsFer1 gene.

7. A method for cultivating plants with insect resistance, characterized in that: The method comprises introducing the Chilo suppressalis gene CsFer1, its fragment or its expression product as described in claim 1, the expression cassette, recombinant vector, recombinant strain or recombinant cell as described in claim 3, and the recombinant vector as described in claim 4 into a plant; preferably, the method enables the plant to express the dsRNA fragment of the CsFer1 gene.

8. The method for cultivating plants with insect resistance according to claim 7, characterized in that: The plants include rice.

9. The method according to claim 7, characterized in that: It includes steps such as transgenic, hybridization, backcrossing or asexual reproduction.

10. A method for identifying and obtaining a plant having an insect-resistant function, wherein the plant is a plant comprising the gene according to claim 1 or a plant obtained by the method according to any one of claims 7 to 8, characterized in that: The method comprises the following steps: identifying whether the plant obtained by the method contains the Chilo suppressalis gene CsFer1, its fragment or its expression product as claimed in claim 1, and preferably, identifying whether the plant expresses the dsRNA fragment of the CsFer1 gene.

Images