Genotype molecular marker related to PEPCase activity of cyperus esculentus and application of genotype molecular marker

Abstract

The invention discloses a genotype molecular marker related to cyperus esculentus PEPCase activity and application of the genotype molecular marker, a corresponding primer and a detection kit are designed according to the genotype molecular marker, so that prediction and screening of the cyperus esculentus PEPCase activity are realized, and a scientific basis is provided for cultivation of cyperus esculentus inbred lines with different PEPCase activity types.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a genotype molecular marker related to PEPCase activity of cyperus oleifera and application thereof. Background Art

[0002] Phosphoenolpyruvate carboxylase (PEPCase) is a cytoplasmic enzyme present in most higher plants. PEPCase is a multimeric structure with highly conserved amino acid sequences. About 100 residues are always the same among different plant species, and another 100 residues have similar properties. PEPCase in a three-dimensional perspective is a tetrameric structure, with four monomers tightly paired in pairs. In general, the four subunits are the same, that is, a homotetrameric structure, so the common three-dimensional model of phosphoenolpyruvate carboxylase is actually a "dimerized dimer". This type of phosphoenolpyruvate carboxylase is called the first type of PEPCase, which is composed of the 107kDa plant-type PEPCase (PTPC) subunit; in developing castor oil seeds, there is another three-dimensional form of phosphoenolpyruvate carboxylase, called the second type of PEPCase, which is composed of plant-type PEPCase subunits and bacterial-type PEPCase subunits (BTPC). Therefore, the PEPC of each plant species is a gene family that contains multiple plant-type PEPCs (PTPCs) and at least one more distantly related bacterial-type PEPC (BTPC). Currently, the PEPC gene families of many plants have been mined and identified: four PEPC family members have been identified in Arabidopsis, and two C 4 Six PEPC family members have been identified in plants. 4 Initial fixation of CO in plant photosynthesis and crassulacean acid metabolism 2 The PEPC gene was transferred into C 3 In plants, it can significantly improve the photosynthetic efficiency of plants and optimize their photosynthetic characteristics. In addition, PEPCase can participate in the distribution of phosphoenolpyruvate to the direction of protein synthesis or oil for biochemical reactions. It has been confirmed that PEPCase can affect the carbon distribution in plants, thereby having a profound impact on oil production. There is currently a theory of substrate competition between PEPCase and ACCase. The fat and protein in plant seeds compete for the same substrate-pyruvate, in which protein synthesis is catalyzed by PEPC carboxylase and fat synthesis is catalyzed by acetyl CoA carboxylase. Whether the carbon generated by photosynthesis flows to generate fat or protein depends on the relative activity of PEPC carboxylase (PEPCase) and acetyl CoA carboxylase (ACCase). It can be seen from this that in oil crops, the strength of PEPC carboxylase activity directly affects the oil content in the crop.

[0003] Cyperus esculentus L. is an annual herbaceous plant of the genus Cyperus in the family Cyperaceae. It has a short growth period, strong stress resistance, high economic benefits of planting, rich oil, starch and protein content, and has great potential edible value and economic role. Although Cyperus esculentus has great development potential, it is difficult to harvest high yields of Cyperus esculentus due to unstable variety quality, unclear biological mechanisms of genetic transformation and carbon flow allocation. With the publication of sequencing data at the genome level of Cyperus esculentus, research on the genetic mechanism of Cyperus esculentus can go further. Specifically, although there have been preliminary reports on cloning and identification of Cyperus esculentus PEPCase, they are limited to the amplification test of a certain member of its gene family, and all members of the Cyperus esculentus PEPC gene family have not been excavated, and the function of PEPC gene has not been studied in depth. Given that PEPCase has multiple biological functions, and the analysis of its gene family members has not been reported, this study conducted a comprehensive analysis and data mining of the Cyperus esculentus PEPC gene family, and through functional prediction and candidate gene expression experimental verification, laid the foundation for subsequent research on the high-yield mechanism of Cyperus esculentus. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a genotype molecular marker related to PEPCase activity of cyperus oleifera and application thereof.

[0005] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0006] A PEPC gene combination of cyperus oleifera, which uses four members of the newly developed PEPC gene family of cyperus oleifera as independent gene elements, specifically including any of the above-mentioned independent gene elements and any combination thereof; the four members of the PEPC gene family of cyperus oleifera are CePEPC-1, CePEPC-2, CePEPC-3, and CePEPC-4, respectively, and the nucleotide sequences of the four members of the PEPC gene family of cyperus oleifera are shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8.

[0007] Application of PEPC gene combination of Cyperus oleifera in PEPCase activity analysis of Cyperus oleifera and screening, preliminary screening, identification and auxiliary identification of Cyperus oleifera germplasm resources based on PEPCase function.

[0008] The genotype molecular marker related to PEPCase activity of Cyperus oleifera is gene CePEPC-2.

[0009] The purpose of the genotype molecular marker related to the activity of PEPCase in cyperus oleifera is to analyze the activity of PEPCase in cyperus oleifera and to screen, preliminarily screen, identify and assist in identifying PEPCase-based germplasm resources by detecting the expression level of the genotype molecular marker CePEPC-2.

[0010] According to the use of genotypic molecular markers related to PEPCase activity of Cyperus oleifera, Cyperus oleifera plants from different geographical areas were collected from the natural population of Cyperus oleifera to construct a primary natural population library of Cyperus oleifera, and the expression level of the genotypic molecular marker CePEPC-2 was detected to achieve a preliminary screening of potential excellent germplasm resources; including: screening out the high-expression population to construct a secondary natural population sub-library H of Cyperus oleifera, screening out the low-expression population to construct a secondary natural population sub-library L of Cyperus oleifera, H and L were respectively used as the initial wild Cyperus oleifera germplasm banks for subsequent different breeding directions, and hybrid breeding or molecular breeding was carried out in H or L to quickly construct the target superior germplasm.

[0011] According to the use of genotypic molecular markers related to PEPCase activity of Cyperus oleifera, Cyperus oleifera plants from different geographical areas were collected from natural populations of Cyperus oleifera to construct a primary natural population library of Cyperus oleifera. By detecting the expression level of the genotypic molecular marker CePEPC-2 and the biomass accumulation of plants in the same growth cycle, plants with relatively low CePEPC-2 expression and high biomass accumulation were selected to construct a secondary natural population sub-library X of Cyperus oleifera as the initial resource library for germplasm improvement of high-yield Cyperus oleifera. Hybrid breeding or molecular breeding was carried out within X to quickly construct high-yield Cyperus oleifera varieties.

[0012] A primer pair for specific PCR amplification of genotype molecular markers related to PEPCase activity in Cyperus oleifera, including a forward primer 1F and a reverse primer 1R;

[0013] The nucleotide sequence of the forward primer 1F is shown in SEQ ID NO.1;

[0014] The nucleotide sequence of the reverse primer 1R is shown in SEQ ID NO.2

[0015] A detection kit comprises a primer pair including a forward primer 1F, a reverse primer 1R and a PCR amplification reagent.

[0016] Application of a primer pair including a forward primer 1F and a reverse primer 1R or the detection kit in identifying, screening and regulating PEPCase activity of cyperus oleifera, and application in breeding of PEPCase activity regulation of cyperus oleifera

[0017] Application of a genotype molecular marker related to PEPCase activity of Cyperus oleifera or a primer pair comprising a forward primer 1F and a reverse primer 1R or a detection kit in constructing a molecular identity card of Cyperus oleifera.

[0018] The beneficial effects of the above technical solution are: the present invention provides a genotype molecular marker related to the PEPCase activity of cyperus oleiferus, and the genotype molecular marker is significantly correlated with the PEPCase activity of cyperus oleiferus; in addition, the present invention designs corresponding primers and detection kits according to the genotype molecular marker, thereby realizing the prediction and screening of the PEPCase activity trait in cyperus oleiferus, and providing a scientific basis for the cultivation of cyperus oleiferus inbred lines with different PEPCase activities. At the same time, during the detection process, it is not necessary to consider the growth period and tissue type of cyperus oleiferus, nor is it necessary to conduct field phenotypic investigations, and the genotype information of the sample can be accurately and quickly obtained, which is beneficial to accelerate the germplasm innovation of cyperus oleiferus with high PEPCase activity and improve breeding efficiency.

[0019] Based on the above technical advantages, the present invention also provides a method for identifying high PEPCase activity in cyperus oleiferus, comprising the following steps: using the genomic DNA of the sample to be tested as a template, performing PCR amplification using the primers described in the above technical solution to obtain a PCR amplification product; performing gel electrophoresis on the PCR amplification product and making a judgment. Experiments have shown that the genotype molecular marker provided by the present invention and the primers designed based on the marker can accurately detect the PEPCase activity of cyperus oleiferus and effectively distinguish whether cyperus oleiferus contains the CePEPC-2 genotype. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a schematic diagram of the gene structure and phylogenetic relationship of PEPC members of Cyperus oleifera in Example 2;

[0021] Figure 2 The multiple sequence alignment result of the PEPCase family of Cyperus oleifera in Example 2; wherein black, gray and light shades represent 100%, 75% and 50% conservation, respectively, a dash represents a vacancy, and amino acid residues with binding site functions are indicated by an asterisk;

[0022] Figure 3 Schematic diagram of the phylogenetic tree of different species of the PEPCase family in Example 2, wherein At represents Arabidopsis thaliana; Os represents rice; Rc represents castor; Sb represents sorghum; Zm represents corn; Gm represents soybean; Bd represents Brachypodium distachyon; Sl represents tomato; Ce represents Cyperus oleifera; Support value represents the credibility of bootstrap;

[0023] Figure 4This is a schematic diagram of the protein structure of PEPCase of Cyperus oleifera predicted by SWISS-MODEL tertiary structure in Example 2;

[0024] Figure 5 This is a statistical diagram of the functions of cis-acting elements of different members of CePEPC in Example 3;

[0025] Figure 6 The expression profile of CePEPC family in different growth stages of Cyperus oleifera obtained by mining public transcriptome data in Example 4 is shown in FIG.

[0026] Figure 7 The 18s rRNA and CePEPC-2 specific bands obtained after PCR amplification of mature leaf samples of Cyperus oleifera Y2 variety in Example 5;

[0027] Figure 8 This is the qPCR gene expression level diagram of the Y2 variety at different growth stages in Example 5. DETAILED DESCRIPTION

[0028] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained by purchasing from the market. The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0029] It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or combinations thereof.

[0030] It should also be understood that the term “and / or” used in the specification and appended claims refers to any and all possible combinations of one or more of the associated listed items, and includes these combinations.

[0031] References to "one embodiment" or "some embodiments" etc. described in the specification of this application mean that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Therefore, the statements "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in this specification do not necessarily refer to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "including", "comprising", "having" and their variations all mean "including but not limited to", unless otherwise specifically emphasized in other ways.

[0032] In addition, in the description of the present application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the descriptions and cannot be understood as indicating or implying relative importance.

[0033] The following will be combined with specific embodiments of the present invention to clearly and completely describe the technical solution of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] Example 1. Gene identification, physicochemical properties and subcellular localization of PEPC in Cyperus oleifera

[0035] Methods: The protein sequences of Arabidopsis PEPCase family members were downloaded from the Arabidopsis Genome Database (https: / / www.arabidopsis.org / ) as reference sequences; the relevant files of the whole chromosome genome of Cyperus oleraceus were downloaded from the CNGB database (project number CNA0051961, https: / / ftp.cngb.org / pub / CNSA / data5 / CNP0003839 / CNS0648185 / CNA0051961 / ). TBtools was used to perform BLAST sequence alignment of Cyperus oleraceus chromosome-level protein sequence data using the Arabidopsis reference sequence as an index, and the E-value was set to 1e -5 , the sequence with the highest score was selected according to the hit score, and the sample number of the PEPCase family of Cyperus oleraceus in the sequencing data was obtained after Venn (Up to Six Sets) mapping to remove redundancy, and the corresponding protein sequence was obtained. The extracted protein sequence was put into NCBI BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and blastp was compared with the UniProtKB / Swiss-Prot (swissprot) database. Proteins were screened according to the comparison score and annotation results to obtain members of the PEPC gene family in Cyperus oleraceus that were homologous to the PEPC gene family of Arabidopsis; the HMMER model of eggNOG-mapper (http: / / eggnog-mapper.embl.de / ) was used for verification, and the protein sequence group at the genomic level of Cyperus oleraceus was annotated as a family member of PEPCase in the Pfam database.

[0036] Combining the above methods, the members of PEPCase family of Cyperus oleifera were screened and identified. The GeneLocation Visualize from GTF / GFF function in TBtools was used to determine the distribution order of PEPC family on scaffold and name the PEPC gene family of Cyperus oleifera.

[0037] Results: A total of four PEPC family members were identified. After deduplication, the family members were located on four different scaffolds, namely scaf13, scaf18, scaf40, and scaf42. According to the annotation results and the positions in the scaffolds, the PEPC gene family members of cyperus oleraceus were named CePEPC-1 to CePEPC-4.

[0038] Submit the protein sequences of PEPCase family members of Cyperus oleifera to the Expasy-ProtParam tool (https: / / web.expasy.org / protparam / ) website to predict the physicochemical properties of PEPCase family members of Cyperus oleifera; submit the protein sequences of PEPCase family members of Cyperus oleifera to the Cell-PLoc2.0 (http: / / www.csbio.sjtu.edu.cn / bioinf / Cell-PLoc-2 / ) website to predict the subcellular localization of PEPCase family members of Cyperus oleifera;

[0039] The molecular weight of the proteins of the PEPC gene family members of Cyperus oleifera is between 110129.27 and 118148; the isoelectric points are between 5.74 and 6.24, and they are all acidic proteins; the hydrophilicity of the proteins is less than 0, and they are all hydrophilic proteins; the subcellular localization prediction results show that the family members are all located in the cytoplasm.

[0040] Table 1 Physicochemical properties and subcellular localization of PEPC family of Cyperus oleifera

[0041]

[0042] Example 2: Analysis of the gene structure, multiple sequence alignment, phylogeny and protein structure prediction of PEPC in Cyperus oleifera

[0043] Methods: Clustal Omega (https: / / www.ebi.ac.uk / Tools / msa / clustalo / ) was used to align the protein sequences of PEPC family members of Cyperus oleifera, and Jalview was used to visualize the alignment. The protein sequences of PEPC family members of Arabidopsis thaliana, rice, castor, sorghum, corn, soybean, Brachypodium distichum, and tomato were aligned using MEGA. 11 Score the maximum likelihood model, select the JTT+G model with the highest score, and use this to select the maximum likelihood method. The bootstrap repetition number is 1000, and a phylogenetic tree is established and plotted in Evoview (http: / / www.evolgenius.info / evolview / # / treeview); submit the protein sequences of the PEPCase family members of Cyperus oleifera to the SOPMA website (https: / / npsa-prabi.ibcp.fr / cgi-bin / npsa_automat.pl?page=npsa_sopma.html) to predict the protein secondary structure of the PEPCase family members of Cyperus oleifera; submit the protein sequences of the PEPCase family members of Cyperus oleifera to the SWISS-MODEL website (https: / / swissmodel.expasy.org / interactive) to predict the tertiary structure of the PEPCase family members of Cyperus oleifera.

[0044] Results: Figure 1 As shown, the annotation file of the cyperus oleifera genome showed that CePEPC-1 and CePEPC-3 contained 12 exon structures, CePEPC-2 contained 11 exon structures, and CePEPC-4 contained 20 exon structures, which was more fragmented.

[0045] like Figure 2 As shown in the figure, the results of multiple sequence alignment show that the PEPCase family of cyperus oleifera has multiple types of substrate binding sites. For example, motif (SWMGGDRDGNP[RN]VT) has a highly conserved PEP residue binding site W; motif (QEVM[IV]GYSDSGKDAGR[LF][ST]AAW) contains the PEP binding site M and also has a Mg residue binding site. 2+ D and HCO binding sites 3-The motif (GI[EG][STN]LRAIPW[IV]F[AS]WTQ) has a PEP binding site R and also a S / A binding site; the motif (G[TS][VI]GRGGGPT[HY]L) has a PEP binding site R; the motifs (EMV[FL]AK[GA]D[PV][GQ]) and ([LI][SHKE][LS]R[DL][SAP][YF]) have aspartate binding sites K or R, respectively.

[0046] like Figure 3 As shown in the figure, a maximum likelihood tree (ML) was constructed using 47 PEPCase protein sequences from 9 different species. The PTPC family contains 37 members, which can be further divided into five groups: PTPC I to PTPC V; the BTPC family is classified into one group. The PEPCase family members of Cyperus oleifera were classified into PTPC I, PTPC II, and BTPC groups, respectively.

[0047] The secondary structure prediction results of the PEPCase protein family of Cyperus oleifera (Table 2) show that the α-helix accounts for 58.51% to 62.07% of the CePEPC family members, and the random coil accounts for 27.77% to 32.22%, indicating that the α-helix and random coil play a major role in the formation of the tertiary structure. Figure 4 As shown in the figure, based on the three-dimensional structure prediction results, it was found that the structural characteristics were basically consistent with the secondary structure prediction results, among which the bacterial PEPCase - CePEPC-4 protein had a more significant structural difference with other proteins.

[0048] Table 2 SOPMA secondary structure prediction results

[0049]

[0050] Example 3: Analysis of cis-acting elements in the promoter region of CePEPC gene

[0051] Methods: From the chromosome-level genomic data of Cyperus oleraceus, the 2000 bp sequence upstream of the 5' end of the coding region of each member of PEPCase of Cyperus oleraceus was extracted using Gtf / Gff3 SequenceExtract of TBtools and submitted to plantCARE (https: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) website for promoter cis-acting element prediction. After downloading the prediction results, R and Excel were used to draw the functional distribution map of the corresponding acting elements.

[0052] Results: The functional distribution of cis-acting elements of PEPCase family members in Cyperus oleifera is as follows: Figure 5As shown, CePEPC-1 has 6 hormone response elements, 5 environmental stress-related elements, and 6 light response elements; CePEPC-2 has 3 growth-related elements, 8 hormone response elements, 9 environmental stress-related elements, and 6 light response elements; CePEPC-3 has 4 hormone response elements, 11 environmental stress-related elements, and 9 light response elements; CePEPC-4 has 2 growth-related elements, 4 hormone response elements, 3 environmental stress-related elements, and 8 light response elements. It can be found that the cis-acting elements of CePEPC-2 and CePEPC-4 have diverse functions, and the sum of cis-acting elements with clear biological functions in CePEPC-2 and CePEPC-3 is the largest, suggesting that CePEPC-2 may play an important role in the growth and development of Cyperus oleifera. These results further support the role of CePEPC genes in regulating growth and development, as well as responding to biotic and abiotic stresses during the development of Cyperus oleifera.

[0053] Example 4: Screening PEPC characteristic genes using public Cyperus oleifera transcriptome data

[0054] Methods: Download RNA-seq data of Cyperus oleiferus tubers from NCBI (project number SRP314275, https: / / www.ncbi.nlm.nih.gov / Traces / study / ?acc=SRP314275&o=acc_s%3Aa). In this public data, the experimental samples were Cyperus oleiferus tubers from Xinjiang (denoted as XJ) and Yunnan (denoted as YN) varieties at 40, 85, and 120 days after sowing, and mature leaves, young leaves, rhizomes, roots, leaf sheaths, and stem tips of Cyperus oleiferus varieties from Xinjiang (denoted as XJ) and Yunnan (denoted as YN) varieties at 40 days after sowing, with three biological replicates in each group. Trim-galore was used to cut sequencing data with low quality (Phred quality score < 25, output reads length threshold < 35bp), and the nucleic acid sequence files in the Cyperus oleraceus chromosome-level sequencing project (CNA0051961) were used as the objects for establishing the reference group. Salmon was used for quantitative calculation, and the expression data of various Cyperus oleraceus varieties in the dataset at 40 days after sowing were sorted out. The TPM (Transcripts Per Million) expression data of CePEPC-1~4 were visualized.

[0055] Results: The Salmon quantitative results showed that the public RNA-seq dataset had a 70% to 78% fit with the Cyperus oleifera genome sequence, with a high degree of alignment. The quantitative results were credible and relatively accurate.

[0056] Based on the public transcriptome data, we can obtain the expression profiles of each member of the CePEPC gene family in various parts of the cyperus oleifera plant (mature leaves, young leaves, rhizomes, roots, leaf sheaths, stem tips, and tubers) at 40 days after sowing. Figure 6 It can be seen that CePEPC-1 and CePEPC-2 have high levels of expression in all parts of the plant 40 days after sowing, among which CePEPC-2 is most obviously expressed in mature leaves, and the expression levels in other parts are similar to or slightly higher than CePEPC-1. However, CePEPC-3 and CePEPC-4 are almost not expressed in all parts of the plant 40 days after sowing.

[0057] Since the expression levels of CePEPC-3 and CePEPC-4 at the transcriptome level were extremely low, the possibility of their being related to the growth and development of Cyperus oleifera was low; 4 The main site of action of the plant is mature leaves, and the expression level of CePEPC-1 in mature leaves is far less than that of CePEPC-2. Based on the comprehensive functional prediction and transcriptome expression results, since the relationship between CePEPC-2 and growth and development, environmental response and photosynthesis is most obvious in the PEPCase family of Cyperus oleifera, and it has a very high level of expression in the photosynthesis site 40 days after sowing, when Cyperus oleifera growth has not yet entered the vigorous period, it shows the rationality of using the CePEPC-2 gene to represent the PEPCase gene family of Cyperus oleifera and to conduct subsequent studies on the physiological processes of Cyperus oleifera. Since the temporal expression pattern of CePEPC-2 in mature leaves has not been studied, we explored the temporal expression of CePEPC-2 in mature leaves of Cyperus oleifera.

[0058] Example 5: RT-qPCR of CePEPC-2 gene in mature leaves of Cyperus oleifera

[0059] Methods: The Yuyousha 2 (Y2) cyperus oleifera variety was planted in the experimental field, and fresh mature leaf samples of about 0.1 g were collected from the Y2 variety 30 days after emergence (first growth period), 60 days after emergence (second growth period) and 90 days after emergence (third growth period), and placed in a centrifuge tube marked with the sample number, and then frozen in liquid nitrogen. Three biological replicates were taken for the number of leaves collected from each individual plant and the number of selected plants, which were used as samples for the determination of the temporal changes in the expression of the CePEPC-2 gene. Total RNA was extracted from the collected leaf samples using the total RNA extraction kit of Nanjing Novezan Company; CePEPC-2 primers were designed in NCBI Primer-BLAST and Primer 6:

[0060] 1F: GGAGATTCAAGCAGCATTCAGA (SEQ ID NO. 1);

[0061] 1R: TGTTCTTCAGAGCGGTGTCA (SEQ ID NO. 2).

[0062] Use 18s rRNA internal reference gene primers and verify the correctness:

[0063] Positive strand: TCGGTCCTATTGTGTTGGC (SEQ ID NO. 3);

[0064] Anti-strand: CGCAGTTGTTCGTCTTTCA (SEQ ID NO. 4).

[0065] The extracted RNA was reverse transcribed using the Novozyme HiSript III 1st Strand cDNA Synthesis Kit; the PCR specific amplification conditions were: 94°C for 5 min; 94°C for 30 s, 60°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 10 min. The SYBR dye method was used for qPCR detection and quantification, and the qPCR conditions were: 95°C pre-incubation for 10 min; 95°C for 10 s, 59°C for 30 s, 72°C for 32 s, 40 cycles; 95°C for 15 s; 65°C for 1 min; 97°C for 1 s; 40°C for 30 s. The relative quantification was calculated using the 2-ΔΔCt method, and the plot was drawn using Graphpad Prism 9.

[0066] Results: Y2 cyperus oleifera leaves from three growth periods were collected as materials for RNA extraction. The results of NanoDrop2000 showed that the extracted RNA had high purity; primers for CePEPC-2 were designed using primer design software, and the theoretical length of the PCR product was within 200bp; 18s rRNA internal reference gene primers were verified to be feasible, and the theoretical length of the PCR product was within 200bp. The first strand of cDNA after reverse transcription was mixed with primers and PCR Mix system for PCR. Figure 7 As shown, the electrophoretic bands obtained under this condition have strong specificity.

[0067] qPCR experiments were performed using the verified primers and reverse transcribed cDNA. -ΔΔCt After conversion, the gene expression level in the first growth period Y2 was used as the standard, and the following results were obtained: Figure 8 The data shown in the figure show that the expression of CePEPC-2 in leaves was stable at a certain level before the second growth period (60 days after sowing), and the expression level increased significantly in the third growth period (90 days after sowing).

[0068] In summary, we discovered four members of the PEPCase family of Cyperus oleifera, screened out the characteristic gene CePEPC-2, and simultaneously demonstrated the temporal expression pattern of the gene CePEPC-2 in mature leaves, which laid a solid foundation for further research on the biological impact of PEPCase of Cyperus oleifera.

[0069] Example 6, Conclusion and Application

[0070] Phosphoenolpyruvate carboxylase (PEPCase) is a 4 As an important carbon fixation enzyme in the photosynthetic pathway, it is also involved in non-photosynthetic processes such as oil synthesis, C / N distribution, seed and fruit growth and maturity, and stress resistance regulation. As an emerging oil crop, Cyperus esculentus L. has high oil yield, short growth period, and strong stress resistance. However, its genetic mechanism is still unclear, which greatly hinders the large-scale planting of Cyperus esculentus. Here, we took the PEPC gene as the starting point, using the existing Cyperus esculentus genome and transcriptome data, and identified four Cyperus esculentus PEPC genes through gene mining, phylogenetic analysis, functional structure prediction, gene family transcriptome expression data analysis and RT-qPCR. They were named CePEPC-1~4 and classified into three PEPCase subfamilies; cis-acting element analysis showed that the promoter region of the CePEPC gene had a variety of elements related to growth and development and plant stress resistance, indicating their role in Cyperus esculentus development and stress. Based on the transcriptome expression data of gene family members, we found that the expression level of CePEPC-2 in mature leaves was significantly higher than that of other members, and the results of RT-qPCR showed the temporal expression pattern of CePEPC-2 in Cyperus oleifera. This study can provide a reference for high-yield screening of Cyperus oleifera.

[0071] In this study, we discovered and named four members of the PEPC gene family of Cyperus oleifera for the first time, and screened out CePEPC-2 as the characteristic gene of the PEPC family of Cyperus oleifera; using molecular biological methods, we revealed the relationship between the expression level of the CePEPC-2 gene of Cyperus oleifera and the growth period of Cyperus oleifera. The expression level of the CePEPC-2 gene in the photosynthesis site is much higher than that of CePEPC-1, CePEPC-3, and CePEPC-4, so the CePEPC-2 gene can be used as a molecular marker to identify the PEPCase activity in Cyperus oleifera.

[0072] In the breeding process, the expression level of CePEPC-2 gene or its specific gene polymorphism can be detected to screen out cyperus oleiferus strains with excellent growth characteristics and high yield potential. Individuals with high and stable CePEPC-2 expression during the key growth period can be selected for breeding and selection, which is expected to improve the yield and quality of cyperus oleiferus, accelerate the breeding process and reduce breeding costs.

[0073] As a characteristic gene, CePEPC-2's expression changes can better reflect the changes in the physiological characteristics of Cyperus oleifera in different growth periods compared with other members of the gene family. It can be used to characterize the growth state of Cyperus oleifera and can serve as a key molecular marker to help researchers more accurately study the growth and development regulation mechanism of Cyperus oleifera, study its upstream and downstream regulatory factors in different growth periods and the genes and proteins that interact with them, and construct a molecular regulatory network for the growth and development of Cyperus oleifera.

[0074] CePEPC-2 can also be used as a biosensor to develop precision agriculture technology based on gene expression monitoring. By real-time monitoring the expression changes of the CePEPC-2 gene during field planting of cyperus rotundus, the growth status of cyperus rotundus and its response to the environment can be understood in a timely manner. For example, when abnormal CePEPC-2 expression is detected, it may indicate problems such as insufficient soil fertility, water stress, or pests and diseases. Therefore, targeted measures such as fertilization, irrigation, or pest and disease control can be taken to achieve precise management of cyperus rotundus planting and improve agricultural production efficiency and resource utilization efficiency.

[0075] Sequence analysis and expression profile determination of CePEPC-2 gene can also be performed on cyperus oleiferus germplasm resources from different sources, and germplasm resources can be classified and evaluated according to gene sequence differences and expression characteristics, so as to screen out germplasm resources with excellent CePEPC-2 gene characteristics. For example, 50 cyperus oleiferus germplasm resources from different countries and regions were sequenced and analyzed for CePEPC-2 gene. The results showed that the CePEPC-2 gene sequence of germplasm resources from a specific region had unique variations, and the expression level was higher during the vigorous growth period. The yield and oil content of cyperus oleiferus in the region were also relatively high. This can make germplasm resources with such CePEPC-2 gene characteristics the focus of preservation and utilization, and provide support for the accurate identification and effective utilization of cyperus oleiferus germplasm resources.

[0076] It is also possible to collect cyperus oleiferus plants from different geographical regions in the natural population of cyperus oleiferus to construct a primary cyperus oleiferus natural population library, and to detect the expression of the CePEPC-2 gene in cyperus oleiferus to achieve the initial screening of potential excellent germplasm resources and establish an effective method for screening germplasm resources. The method first collects cyperus oleiferus plant samples from different ecological regions and records their growth environment and characteristics. Subsequently, genomic DNA is extracted using a DNA extraction kit suitable for plant tissues, and its concentration and purity are measured by a spectrophotometer to ensure the effectiveness of subsequent PCR amplification. Next, specific primers for the CePEPC-2 gene are designed for PCR amplification, and the relative expression of the gene is measured using real-time quantitative PCR (qPCR) technology. Finally, the samples were classified according to the expression level of CePEPC-2, and the high-expression population was screened out to construct a secondary natural population sub-library H of Cyperus oleifera, and the low-expression population was screened out to construct a secondary natural population sub-library L of Cyperus oleifera. The constructed sub-libraries H and L were analyzed, and it was found that the plants in sub-library H may have advantages in certain traits related to high PEPCase activity and may have strong ability in the carbon assimilation pathway, which can be used for the subsequent breeding of Cyperus oleifera varieties with efficient photosynthetic carbon fixation ability under specific environments; while the plants in sub-library L may have unique characteristics in other aspects and can be used as a resource for breeding Cyperus oleifera varieties with special quality or stress resistance. Hybrid breeding or molecular breeding is carried out in H or L respectively. For example, in sub-bank H, plants with complementary excellent traits are selected for hybridization. Through screening and identification of hybrid offspring, target superior germplasm is quickly constructed, such as cyperus oleiferus varieties with high biomass and high photosynthetic efficiency; in sub-bank L, other beneficial genes can be introduced for molecular breeding based on its low CePEPC-2 expression characteristics to cultivate cyperus oleiferus varieties with good quality that are adaptable to specific adverse conditions. Through this method, cyperus oleiferus resources with high yield potential and excellent growth characteristics can be quickly identified, thereby promoting the improvement and breeding process of cyperus oleiferus.

[0077] It is also possible to collect cyperus oleiferus plants from different geographical regions from the natural population of cyperus oleiferus to construct a primary natural population library of cyperus oleiferus, collect fresh leaves for gene expression detection, and record the biomass accumulation of each plant in the same growth cycle (which can be determined by weighing the sum of the dry weight of the aboveground and underground parts of the plant), comprehensively analyze the data of CePEPC-2 expression and biomass accumulation, and screen out plants with relatively low CePEPC-2 expression and high biomass accumulation. These screened plants are used to construct a secondary natural population sub-library X of cyperus oleiferus. Since low CePEPC-2 expression may mean that more carbon flow flows to the fatty acid synthesis pathway during oil synthesis rather than being consumed in large quantities by PEPCase in other metabolic pathways, and high biomass accumulation provides more raw material basis for oil synthesis, sub-library X can be used as an initial resource library for high-yield cyperus oleiferus germplasm improvement. Hybrid breeding or molecular breeding is performed in sub-bank X: In hybrid breeding, plants with different excellent traits (such as different fatty acid compositions, pest and disease resistance, etc.) and CePEPC-2 expression and biomass accumulation that meet the requirements are selected for hybridization, and the hybrid offspring are screened and identified for multiple generations, focusing on the changes in oil content, yield and other related traits, and quickly constructing high-yield Cyperus oleifera varieties; in terms of molecular breeding, gene editing or transgenic operations can be performed on other key genes related to oil synthesis to further improve the oil production capacity of Cyperus oleifera in sub-bank X, and combined with the regulation of CePEPC-2 gene expression, new Cyperus oleifera varieties with higher oil production performance and adaptability to different planting environments can be cultivated.

[0078] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that numerous changes, modifications, substitutions and variations may be made to the examples without departing from the principles and spirit of the invention, the scope of the invention being defined by the appended claims and their equivalents.

[0079] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0080] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.

Claims

1. A PEPC gene combination of Cyperus oleifera, characterized in that: The gene combination uses four members of the newly developed cyperus oleifera PEPC gene family as independent gene elements, specifically including any of the above-mentioned independent gene elements and any combination thereof; the four members of the cyperus oleifera PEPC gene family are CePEPC-1, CePEPC-2, CePEPC-3, and CePEPC-4, respectively, and the nucleotide sequences of the four members of the cyperus oleifera PEPC gene family are shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.

8.

2. Application of the gene combination of claim 1 in the analysis of PEPCase activity of Cyperus oleifera and in the screening, preliminary screening, identification and auxiliary identification of Cyperus oleifera germplasm resources based on PEPCase function.

3. Genotypic molecular markers related to PEPCase activity in Cyperus oleifera, characterized in that: The genotype molecular marker is gene CePEPC-2.

4. Use of the genotype molecular marker according to claim 3, by detecting the expression level of the genotype molecular marker CePEPC-2, to analyze the activity of PEPCase in Cyperus oleifera and to screen, preliminarily screen, identify and assist in identifying Cyperus oleifera germplasm resources based on the PEPCase function.

5. The method according to claim 4, wherein among natural populations of Cyperus oleifera, Cyperus oleifera plants from different geographical regions are collected to construct a primary natural population library of Cyperus oleifera, and the expression level of the genotype molecular marker CePEPC-2 is detected to achieve a preliminary screening of potential excellent germplasm resources; comprising: A secondary natural population sub-library H of Cyperus oleifera was constructed by screening out high-expression populations, and a secondary natural population sub-library L of Cyperus oleifera was constructed by screening out low-expression populations. H and L were used as initial wild Cyperus oleifera germplasm banks for subsequent different breeding directions, respectively. Hybrid breeding or molecular breeding was carried out in H or L, respectively, to quickly construct the target superior germplasm.

6. The use according to claim 4, wherein from the natural population of Cyperus oleifera, Cyperus oleifera plants from different geographical regions are collected to construct a primary Cyperus oleifera natural population library, and by detecting the expression of the genotype molecular marker CePEPC-2 and the biomass accumulation of the plants in the same growth cycle, plants with relatively low CePEPC-2 expression and high biomass accumulation are selected to construct a secondary Cyperus oleifera natural population sub-library X as an initial resource library for improving the germplasm of high-yield Cyperus oleifera, and hybrid breeding or molecular breeding is carried out within X to quickly construct high-yield Cyperus oleifera varieties.

7. A primer pair for specific PCR amplification of the genotype molecular marker according to claim 3, comprising a forward primer 1F and a reverse primer 1R; The nucleotide sequence of the forward primer 1F is shown in SEQ ID NO.1; The nucleotide sequence of the reverse primer 1R is shown in SEQ ID NO.

2.

8. A detection kit, characterized in that: Contains the primer pair according to claim 7 and a PCR amplification reagent.

9. Use of the primer pair according to claim 7 or the kit according to claim 8 in identifying, screening, and regulating PEPCase activity in Cyperus oleifera, and in breeding for regulating PEPCase activity in Cyperus oleifera.

10. Use of the genotype molecular marker according to claim 3, the primer pair according to claim 7, or the kit according to claim 8 in constructing a molecular identity card of Cyperus oleifera.

Images