CRISPR-Cas12f1-based gene editing tool and application thereof

Abstract

The invention discloses a gene editing tool based on CRISPR-Cas12f1 and application of the gene editing tool. The gene editing tool comprises a plasmid pET-Cas12f1 for expressing endonuclease Cas12f1, and the plasmid comprises a PgrcA promoter, a Cas12f1 nuclease gene, a lambda-RED recombination system gene, an araC protein gene and a ParaC promoter; the invention discloses an auxiliary plasmid pACYC-sgRNA-sacB for guiding Cas12f1, and the plasmid comprises a PJ23119 promoter, an sgRNA sequence, a sacB gene and a replicon P15A. The genome editing tool can realize gene editing in Escherichia coli, and the efficiency of gene knockout after multiple rounds of editing of strains is remarkably improved. The gene editing system is used for gene knockout, and the problem that the efficiency is greatly reduced after a traditional gene editing tool is used for multiple rounds of editing is solved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a gene editing tool based on CRISPR-Cas12f1 and an application thereof. Background Art

[0002] As a model microbial strain, Escherichia coli is a common host in molecular biology and has important application value in industrial fermentation. It is extremely important to establish an efficient gene editing method in Escherichia coli. pCas combined with pTargetF is currently the most widely used set of plasmid tools (Jiang Y, Chen B, et al. Appl Environ Microbiol, 2015). However, in the actual strain transformation process, using this system, as the number of transformation steps increases, its editing efficiency is significantly reduced, and many gene operations, especially gene insertions, can no longer be completed, which seriously hinders iterative gene editing. Studies have shown that this phenomenon is mainly due to the inactivation of Cas9 nuclease caused by point mutations and transposition insertions, resulting in a large number of false positives (LiQ, Sun B, Chen J, et al. Acta Biochimica et Biophysica Sinica, 2021). Summary of the invention

[0003] To overcome the above difficulties, we introduced the Cas12f1 nuclease, which is only one-third the size of Cas9. The probability of inactivation will be greatly reduced, which can greatly improve the efficiency of gene editing.

[0004] Therefore, the first object of the present invention is to provide an efficient Escherichia coli gene editing tool, which includes the following technical solutions:

[0005] A CRISPR-Cas12f1-based Escherichia coli genome editing tool, comprising a plasmid pET-Cas12f1 for expressing the endonuclease Cas12f1, the plasmid comprising P grcA Promoter, Cas12f1 nuclease gene, λ-RED recombination system gene, araC protein gene, P araC Promoter.

[0006] The above-mentioned Cas12f1 nuclease gene is a Cas12f1 nuclease gene derived from Sulfatobacillus oxidans, and can also be a cas nuclease gene derived from other microorganisms.

[0007] Preferably, the nucleotide sequence of Cas12f1 in the plasmid pET-Cas12f1 is shown in SEQ ID NO:1.

[0008] In order to realize the gene editing function, the above-mentioned E. coli genome editing tool also includes another guide plasmid pACYC-sgRNA used in conjunction with the plasmid pET-Cas12f1, so that the above-mentioned E. coli genome editing tool is a dual-plasmid system.

[0009] The pACYC-sgRNA plasmid includes P J23119 Promoter, sgRNA sequence, sacB gene, replicon P15A.

[0010] Preferably, the nucleotide sequence of sgRNA in the plasmid pACYC-sgRNA is shown in SEQ ID NO:2.

[0011] The present invention also provides a method for constructing the above-mentioned plasmid pET-Cas12f1, which comprises the following steps:

[0012] Using the pCas plasmid reported in the literature (Jiang Y, Chen B, et al. Appl Environ Microbiol, 2015) as a template, PCR amplified the λ-RED recombinase gene fragment; P was amplified from the genomic DNA of Escherichia coli W3110. grcA fragments; fully synthesized Cas12f1; amplified the resistance gene and replicon sequence using the pET30a plasmid as a template, and assembled the above fragments to obtain the pET-Cas12f1 plasmid.

[0013] The second object of the present invention is to provide the application of the above-mentioned gene editing tool in Escherichia coli gene editing.

[0014] The gene editing includes gene knockout.

[0015] In a preferred embodiment, the above application comprises the following steps:

[0016] 1) The plasmid pET-Cas12f1 was transformed into Escherichia coli competent cells and screened on LB solid plates containing kanamycin at 37°C;

[0017] 2) Pick positive clones, prepare electroporation competent cells, and add arabinose 1 hour before centrifugation to induce RED recombinase expression;

[0018] 3) The guiding plasmid pACYC-sgRNA was transferred into competent cells by electroporation, and the bacterial solution was spread on LB solid plates containing kanamycin and chloramphenicol. After overnight culture at 37°C, the clones were verified and screened;

[0019] 4) Positive clones were picked and cultured overnight at 37°C in LB liquid medium. The bacterial liquid was aspirated and streaked on a sucrose-containing LB solid plate to separate single bacteria. Single colonies were identified on a chloramphenicol-resistant LB plate to verify the elimination of the pACYC-sgRNA plasmid and obtain the edited strain.

[0020] The Escherichia coli gene editing tool pET-Cas12f1 / pACYC-sgRNA of the present invention is an efficient dual-plasmid system that can achieve efficient knockout of target genes in strains that have undergone multiple rounds of gene editing. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is the pET-Cas12f1 / pACYC-sgRNA gene editing tool.

[0022] Figure 2 It is the pACYC-Cas12f1 / pET-sgRNA gene editing tool.

[0023] Figure 3 The pET-Cas12f1 / pACYC-sgRNA gene editing tool was used to knock out Pgi in wild-type Escherichia coli W3110.

[0024] Figure 4 The pET-Cas12f1 / pACYC-sgRNA gene editing tool was used to knock out Pgi in WS000 bacteria.

[0025] Figure 5 The pACYC-Cas12f1 / pET-sgRNA gene editing tool was used to knock out Pgi in wild-type Escherichia coli W3110.

[0026] Figure 6 The pACYC-Cas12f1 / pET-sgRNA gene editing tool was used to knock out Pgi in WS000 bacteria.

[0027] Figure 7 The pCas / pTargetF gene editing tool was used to knock out Pgi in WS000 bacteria.

[0028] Figure 8 It is the pET-Cas12f1 / pACYC-sgRNA-sacB gene editing tool. DETAILED DESCRIPTION

[0029] In order to enable those skilled in the art to better understand the solution of the present invention, the present invention is further described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0030] Unless otherwise specified, the reagents involved in the embodiments of the present invention are all commercially available products and can be purchased through commercial channels.

[0031] Example 1: Construction of Cas12f1 expression vector pET-Cas12f1

[0032] The plasmid backbone was amplified by PCR using the primers pET30a-F / R in Table 1 with plasmid pET30a as the template; the λ-RED recombinase gene fragment was amplified by PCR using the primers RED-F / R with plasmid pCas (Jiang Y, Chen B, et al. Appl Environ Microbiol, 2015) as the template; the P grcA Fragment; Using primers As12f1-F / R, the Cas12f1 fragment (SEQ ID NO: 1) was cloned by PCR with the synthesized Cas12f1 gene as a template. Finally, the above four fragments were constructed into plasmid pET-Cas12f1 using a seamless cloning kit.

[0033] Table 1 Primers used in the present invention

[0034]

[0035]

[0036]

[0037] SEQ ID NO.1

[0038] atgatcaaggtttacagatacgaaatcgttaagccattggacttggactggaaggaattcggtactatcttgagacaattgcaacaagaaacta

[0039] gattcgctttgaacaaggctactcaattggcttgggaatggatgggttctcttctgactacaaggacaaccacggtgaatacccaaagtctaag

[0040] gacatcttgggttacactaacgttcacggttacgcttaccacactatcaagactaaggcttacagattgaactctggtaacttgtctcaaactatca

[0041] agagagctactgacagattcaaggcttaccaaaaggaaatcttgagaggtgacatgtctatcccatcttacaagagagacatcccattggactt

[0042] gatcaaggaaaacatctctgttaacagaatgaaccacggtgactacatcgcttctttgtctttgttgtctaacccagctaagcaagaaatgaacgt

[0043] tagagaaagatctctgttatcatcatcgttagaggtgctggtaagactatcatggacagaatcttgtctggtgaataccaagtttctgcttctcaa

[0044] atcatccacgacgacagaaagaacaagtggtacttgaacatctcttacgacttcgaaccacaaactagagttttggacttgaacaagatcatgg

[0045] gtatcgacttgggtgttgctgttgctgtttacatggctttccaacacactccagctagatacaagttggaaggtggtgaaatcgaaaacttcagaa

[0046] gacaagttgaatctagaagaatctctatgttgagacaaggtaagtacgctggtggtgctagaggtggtcacggtagagacaagagaatcaag

[0047] ccaatcgaacaattgagagacaagatcgctaacttcagagacactactaaccacagatactctagatacatcgttgacatggctatcaaggaa

[0048] ggttgtggtactatccaaatggaagacttgactaacatcagagacatcggttctagattcttgcaaaactggacttactacgacttgcaacaaaa

[0049] gatcatctacaaggctgaagaagctggtatcaaggttatcaagatcgacccacaatacacttctcaaagatgttctgaatgtggtaacatcgact

[0050] ctggtaacagaatcggtcaagctatcttcaagtgtagagcttgtggttacgaagctaacgctgactacaacgctgctagaaacatcgctatcccaaacatcgacaagatcatcgctgaatctatcaagtaa.

[0051] Example 2: Construction of sgRNA expression vector pACYC-sgRNA

[0052] The plasmid backbone fragment was amplified by PCR using the primers pACYC-F / R in Table 1 and the plasmid pACYCDuet as a template; the sgRNA fragment (SEQID NO: 2) was cloned by PCR using the primers As12f1-gRNA-F / R and the synthesized sgRNA gene as a template. Finally, the two fragments were combined into the plasmid pACYC-sgRNA using a seamless cloning kit.

[0053] SEQ ID NO.2

[0054] ttgacagctagctcagtcctaggtataat attcgtcggttcagcgacgataagccgagaagtgccaat aaaactgttaagtggtttggtaacgc

[0055] tcggtaaggtagccaaaaggctgaaactccgtgcacaaagaccgcacggacgcttcacatatagctca taaacaagggtttgcgagctagct tgtggagtgtgaac The pJ23119 promoter is in italics and the sgRNA is underlined.

[0056] Example 3: Construction of Cas12f1 expression vector pACYC-Cas12f1

[0057] The plasmid backbone fragment was amplified by PCR using the primers pACYC-F0329 / pACYC-R0329 in Table 1 with the plasmid pACYCDuet as the template; the RED-P fragment was cloned by PCR using the primers AsCas12f-F0329 / AsCas12f-F0329 with the pET-Cas12f1 plasmid as the template. grcA -Cas12f1 fragment. Finally, the above two fragments were constructed into plasmid pACYC-Cas12f1 using a seamless cloning kit.

[0058] Example 4: Construction of sgRNA expression vector pET-sgRNA

[0059] The plasmid backbone fragment was amplified by PCR using the primers pET30a-F0329 / pET30a-R0329 in Table 1 with plasmid pET30a as the template; the P was cloned by PCR using the primers gRNA-F0329 / gRNA-R0329 with pACYC-sgRNA as the template. J23119 -sgRNA fragment. Finally, the above two fragments were constructed into plasmid pET-sgRNA using a seamless cloning kit.

[0060] Example 5: Gene editing mediated by the pET-Cas12f1 / pACYC-sgRNA system in Escherichia coli

[0061] First, the plasmid pET-Cas12f1 was transformed into wild-type Escherichia coli W3110 and WS000 bacteria from the literature (Su B, LaiP, et al. Bioresour Technol, 2024) to prepare competent cells. For the knockout of the pgi gene, the primers As12f1-sgRNA-pgi-F0508 / As12f1-sgRNA-pgi-R0508 were used to construct the guide plasmid pACYC-sgRNA-Pgi. Pgi-UP-F / R amplified the upstream homology arm, Pgi-DOWN-F / R amplified the downstream homology arm, and overlapping PCR constructed the knockout target block. The guide plasmid pACYC-sgRNA and the knockout target block were introduced into competent cells containing the pET-Cas12f1 plasmid, spread on kanamycin and chloramphenicol LB plates, and the primers Pgi-UP-F / Pgi-CHECK-R were used to identify positive clones. From Figure 3 and 4 It can be seen that the positive cloning rates in wild-type Escherichia coli W3110 and WS000 were 100% and 90%, respectively.

[0062] Example 6: Gene editing mediated by the pACYC-Cas12f1 / pET-sgRNA system in Escherichia coli

[0063] First, the plasmid pACYC-Cas12f1 was transformed into wild-type Escherichia coli W3110 and WS000 bacteria from the literature (Su B, LaiP, et al. Bioresour Technol, 2024) to prepare competent cells. For the knockout of the pgi gene, the primers As12f1-sgRNA-pgi-F0508 / As12f1-sgRNA-pgi-R0508 were used to construct the guide plasmid pET-sgRNA-Pgi. Pgi-UP-F / R amplified the upstream homology arm, Pgi-DOWN-F / R amplified the downstream homology arm, and overlapping PCR constructed the knockout target block. The guide plasmid pET-sgRNA and the knockout target block were introduced into competent cells containing the pACYC-Cas12f1 plasmid, spread on kanamycin and chloramphenicol LB plates, and the primers Pgi-UP-F / Pgi-CHECK-R were used to identify positive clones. From Figure 5 and 6 It can be seen that the positive cloning rates in wild-type Escherichia coli W3110 and WS000 were 40% and 0, respectively.

[0064] Example 7: Gene editing mediated by the pCas / pTargetF system in Escherichia coli

[0065] First, the plasmid pCas in the literature (Jiang Y, Chen B, et al. Appl Environ Microbiol, 2015) was transformed into the WS000 bacteria from the literature (Su B, Lai P, et al. Bioresour Technol, 2024) to prepare competent cells. For the knockout of the pgi gene, the primers pgi-CRISPR-F / R were used to construct the guide plasmid pTargetF-Pgi. Pgi-UP-F / R amplified the upstream homology arm, Pgi-DOWN-F / R amplified the downstream homology arm, and overlapping PCR constructed the knockout target block. The knockout plasmid pTargetF and the knockout target block were introduced into the competent cells containing the pCas plasmid, spread on kanamycin and chloramphenicol LB plates, and the primers Pgi-UP-F / Pgi-CHECK-R were used to identify the positive clones. From Figure 7 It can be seen that the positive cloning rate is only 30%.

[0066] Example 8: Construction of sgRNA expression vector pACYC-sgRNA-sacB

[0067] In order to facilitate multiple rounds of gene manipulation, we introduced the sacB gene (GenBank accession number GeneID: 936413) into the guide plasmid. After the knockout was completed, sucrose reverse screening was used to remove the guide plasmid and proceed to the next step of gene knockout. The pACYC-sgRNA fragment was amplified by PCR using the primers pACYC-As12f1-sgRNA-F / R in Table 1 with the plasmid pACYC-sgRNA as a template; the P grcA The sacB fragment was cloned by PCR using primers sacB-F0514 / sacB-R0626 and the Bacillus subtilis genome (GenBank accession number GCA_000009045.1) as a template. Finally, the three fragments were constructed into the plasmid pACYC-sgRNA-sacB using a seamless cloning kit.

[0068] The above are only preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limiting the present invention, and the protection scope of the present invention should be based on the scope defined by the claims. For ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit and scope of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A gene editing tool based on CRISPR-Cas12f1, comprising a plasmid pET-Cas12f1 for expressing the endonuclease Cas12f1, the plasmid comprising P grcA Promoter, Cas12f1 nuclease gene, λ-RED recombination system gene, araC protein gene, P araC Promoter.

2. The gene editing tool according to claim 1, characterized in that The nucleotide sequence of Cas12f1 in the plasmid pET-Cas12f1 is shown in SEQ ID NO:

1.

3. The gene editing tool according to claim 1, characterized in that The guide plasmid pACYC-sgRNA is also included, making the gene editing tool a two-plasmid system.

4. The gene editing tool according to claim 3, characterized in that The pACYC-sgRNA plasmid includes P J23119 Promoter, sgRNA sequence, sacB gene, replicon P15A.

5. The gene editing tool according to claim 3, characterized in that The nucleotide sequence of sgRNA in the plasmid pACYC-sgRNA is shown in SEQ ID NO:

2.

6. The gene editing tool according to claim 1, characterized in that The construction steps of the plasmid pET-Cas12f1 are as follows: using primers pET30a-F / R to amplify the resistance gene and replicon sequence using the pET30a plasmid as a template; using primers RED-F / R to amplify the λ-RED recombinase gene fragment using the pCas plasmid as a template; using primers grcA-F / R to amplify the P grcA fragment; using primers As12f1-F / R, the Cas12f1 fragment was amplified with the synthetic Cas12f1 gene as a template; after assembling the above fragments, the pET-Cas12f1 plasmid was obtained.

7. The gene editing tool according to claim 6, characterized in that The sequence of the primer pET30a-F / R is shown in SEQ ID NO: 3-4, the sequence of the primer RED-F / R is shown in SEQ ID NO: 5-6, the sequence of the primer grcA-F / R is shown in SEQ ID NO: 7-8, and the sequence of the primer As12f1-F / R is shown in SEQ ID NO: 9-10.

8. Use of the gene editing tool as described in any one of claims 1 to 7 in Escherichia coli gene editing.

9. The use according to claim 8, characterized in that The gene editing includes gene knockout.

Images