Application of transcription factor BnaMYB52 and its encoding gene in regulating oil and lignin content in rapeseed

Abstract

The present invention discloses a transcription factor <h2 style=";text-align:left;direction:ltr">BnaMYB52 Application of the transcription factor in regulating the oil content and lignin content of rapeseed seeds <h2 style=";text-align:left;direction:ltr"> BnaMYB52 The amino acid sequence is as shown in SEQ ID NO.5, or other amino acid sequences with the same function as the protein derived from the amino acid sequence shown in SEQ ID NO.5 by substitution and / or deletion and / or addition of one or more amino acid residues. <h2 style=";text-align:left;direction:ltr"> BnaMYB52 Genes were overexpressed and gene edited, and it was found <h2 style=";text-align:left;direction:ltr"> BnaMYB52 The gene negatively regulates the oil content of rapeseed seeds and positively regulates the lignin content. The invention has very important application prospects in breeding high-oil-content rapeseed and improving the quality of rapeseed meal.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and seed and seedling cultivation, and specifically relates to a rapeseed MYB gene family gene ( BnaMYB52 The application of the gene and its encoded protein in breeding new rapeseed varieties, especially in creating rapeseed germplasm with high oil content and low lignin content. Background Art

[0002] Rapeseed meal is rich in methionine, cysteine, and antioxidants, making it a high-quality animal feed. Lignin, an anti-nutrient, reduces the nutritional value of rapeseed meal for animals. Therefore, research on functional genes that influence oil and lignin synthesis can further increase rapeseed oil content, improve meal quality, and enhance the profitability of rapeseed cultivation.

[0003] There are 126 R2R3-MYB members in the Arabidopsis genome, which can be clustered into 25 subgroups, including MYB52 Clustered into S21 subgroup, MYB52 and MYB54 The closest relative is MYB52 (Dubos et al 2010). Previous studies have shown that MYB52 interacts with ERF4 in Arabidopsis (at the protein level) and competitively binds to ERF4. PMEI6, PMEI14 and SBT1.7 The promoter of , thereby regulating the formation of seed coat mucilage (Shi et al 2018, Ding et al 2021). Another study showed that HbMYB52 When the gene is overexpressed in Arabidopsis, the formation of secondary wall in the stem is affected (Qiu Jian et al 2016). MYB52 The gene is also involved in the regulation of various adversities. Soybean roots were treated with ABA, low temperature (4°C), sodium chloride and PEG respectively. GmMYB52 The expression level of MYB52 Participate in the response to abiotic stress (Xu Ling et al 2017). Blast analysis based on the Brassica napus genome database (http: / / cbi.hzau.edu.cn / bnapus / ) showed that there are four MYB52The homologous genes are located on chromosomes A09 (BnaA09G0615900ZS), A08 (BnaA08G0259100ZS), and C08 (BnaC08G0471400ZS and BnaC08G0242900ZS). Analysis using the transcriptome database of Brassica napus Zhongshuang 11 (http: / / yanglab.hzau.edu.cn / ) showed that BnaA09G0615900ZS and BnaC08G0471400ZS were highly expressed in the siliques and stems 30 days after flowering; while BnaA08G0259100ZS and BnaC08G0242900ZS were only highly expressed in the stems. This indicates that the expression of BnaA09G0615900ZS in Brassica napus is high. MYB52 Homologous genes may have functional differentiation.

[0004] In the early stage, our research group used the seed husk rate of rapeseed related population for association analysis and identified a husk rate QTL on chromosome A09 (husk rate was significantly negatively correlated with oil content). Through comprehensive analysis of candidate genes, MYB52 As an important candidate gene. MYB52 In terms of gene function research, a previous study was conducted by Yu Ruilu (2022) in which the myb52 mutant of Arabidopsis thaliana was overexpressed in rapeseed. MYB52 The gene can restore the mucilage of mutant seeds to wild-type levels and affect the germination rate of seeds. However, this study did not investigate the effect of the gene on the seed epidermis of the mutant in rapeseed. MYB52 Functional studies were conducted, and the oil content of seeds was not measured and analyzed. MYB52 It is involved in many important biological processes such as seed coat mucilage, secondary wall development, fiber composition, husk rate, and stress response, but its genetic and molecular mechanisms need to be further studied.

[0005] The present invention cloned rape BnaMYB52 Gene, use 35S Promoter activation BnaMYB52 The high expression of the gene resulted in rapeseed seeds with significantly reduced oil content and significantly increased lignin content. BnaMYB52 The mutants of the gene obtained rapeseed seeds with significantly increased oil content and significantly reduced lignin content. BnaMYB52 The gene plays an important role in regulating the accumulation of oil content and lignin synthesis in rapeseed seeds, and has important application prospects in creating rapeseed germplasm with high oil content and high quality cake. Summary of the Invention

[0006] The first object of the present invention is to provide a transcription factor BnaMYB52 Application in regulating seed oil content and lignin content.

[0007] BnaMYB52 There is one copy of the gene on rapeseed chromosomes A08 and A09, and two copies on rapeseed chromosome C08, which are BnaA08.MYB52 (BnaA08G0236300WE), BnaA09.MYB52 (BnaA09G0583300WE), BnaC08.MYB52-1 (BnaC08G0420000WE) and BnaC08.MYB52-2 (BnaC08G0199000WE). The nucleotide sequences of this gene are shown in the sequence listings as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4, respectively, and consist of 729 bp, 744 bp, 744 bp, and 729 bp. The protein sequences encoded by this gene are shown in the sequence listings as SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, and SEQ ID NO:8, respectively, and encode 242, 247, 247, and 242 amino acids, respectively.

[0008] The applicant used Agrobacterium-mediated genetic transformation method to transform BnaMYB52 The overexpression vector of the gene driven by the constitutive promoter was transformed into the genome of rapeseed to obtain BnaMYB52 Overexpressed rapeseed germplasm, and gene editing technology using CRISPR / Cas9 BnaMYB52 Then, the oil content and lignin content of seeds of overexpression and mutant transformed materials were measured and it was found that BnaMYB52 Negatively regulates rapeseed seed oil content and positively regulates lignin content.

[0009] The second object of the present invention is to provide a method for creating rapeseed germplasm with high oil content and low lignin content.

[0010] To achieve the above purpose, the applicant used Agrobacterium-mediated genetic transformation to transform the gene containing the transcription factor BnaMYB52 The CRISPR / Cas9 gene editing vector encoding the gene was transformed into the rapeseed genome, and the CRISPR / Cas9 gene editing technology was used to obtain BnaMYB52 Rapeseed varieties with missing gene function.

[0011] wherein the transcription factor BnaMYB52 The method for constructing a CRISPR / Cas9 gene editing vector encoding a gene includes the following steps:

[0012] 1) According to BnaMYB52 Screen gene editing targets and design primers based on gene and homologous gene sequences;

[0013] 2) Using the pCBC-DT1T2 plasmid as a template, perform PCR amplification using the designed primers;

[0014] 3) Ligate the PCR product with the pKSE401 plasmid by restriction enzyme digestion;

[0015] 4) Transform competent E. coli, screen positive clones and sequence them. The vector with the correct sequence is BnaMYB52 CRISPR / Cas9 gene editing vector.

[0016] Furthermore, the sequence of the gene editing target is:

[0017] sgRNA1:ATAACGCTGTAAAAACCAT;

[0018] sgRNA2: GCTGCGACGATTGGTTATGA.

[0019] The primer sequences are:

[0020] DT1-BsF: ATATATGGTCTCGATTG ATAACGCTGTTAAAAACCAT GTT

[0021] DT1-F0: TG ATAACGCTGTTAAAAACCAT GTTTTAGAGCTAGAAATAGC

[0022] DT2-R0: AAC TCATAACCAATCGTCGCAGC CAATCTCTTAGTCGACTCTAC

[0023] DT2-BsR: ATTATTGGTCTCGAAAC TCATAACCAATCGTCGCAGC CAA.

[0024] The beneficial effects of the present invention are:

[0025] The present invention first discovered BnaMYB52 This gene regulates seed oil and lignin content. Utilizing this gene can promote oil accumulation in rapeseed seeds, resulting in the production of high-oil rapeseed germplasm. It can also reduce the lignin content in rapeseed meal, improving its nutritional value and palatability for animals. This invention has significant potential applications in breeding high-oil rapeseed varieties and improving the quality of rapeseed meal. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Picture 1 : BnaA09.MYB52 Detection of gene overexpression plants. (a) PCR identification of T0 generation overexpression transgenic plants; (b) BnaA09.MYB52 qRT-PCR detection of overexpression plants. The values ​​in Figure b are mean ± SD.

[0027] Picture 2 :rape BnaMYB52 Identification of mutants. sgRNA1 and sgRNA2 are located in genes BnaMYB52 The exon region of sgRNA1 and BnaMYB52 Four homologous genes matched, while sgRNA2 only matched BnaA09.MYB52 and BnaC08.MYB52- 1 match. bnamyb52-1 and bnamyb52-2 Both BnaMYB52 Edited homozygous quadruple mutant.

[0028] Picture 3 :rape BnaMYB52 Phenotypic identification of oil content and lignin content in overexpression and mutant materials. (a) Analysis of oil content in rapeseed seeds using near-infrared spectroscopy. (b) Determination of seed lignin content. * indicates the presence of a lignin residue in the Student's t In test P <0.05, ** indicates that the t In test P <0.01. DETAILED DESCRIPTION

[0029] The present invention is further defined below with reference to specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the invention. Experimental procedures in the following examples, where specific conditions are not specified, were generally performed under conventional conditions, such as those described in the reference book "Molecular Cloning: A Laboratory Manual" (New York: Cold Spring Harbor Laboratory, 1989), or according to the methods recommended in the manufacturer's manual.

[0030] Description of Sequence Listing:

[0031] Sequence Listing SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 are genes cloned from Brassica napus Westar BnaA08.MYB52 (BnaA08G0236300WE), BnaA09.MYB52 (BnaA09G0583300WE), BnaC08.MYB52-1 (BnaC08G0420000WE) and BnaC08.MYB52-2 The nucleotide sequences of the three genes (BnaC08G0199000WE) are 729 bp, 744 bp, 744 bp and 729 bp in length, respectively.

[0032] Sequence Listing SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8 are genes isolated from Brassica napus Westar BnaA08.MYB52 (BnaA08G0236300WE), BnaA09.MYB52 (BnaA09G0583300WE), BnaC08.MYB52-1 (BnaC08G0420000WE) and BnaC08.MYB52-2 The protein sequences encoded by (BnaC08G0199000WE) encode 242, 247, 247 and 242 amino acids, respectively.

[0033] Example 1 Rapeseed BnaA09.MYB52 Gene cloning

[0034] MYB52 The gene, encoding the MYB DOMAIN protein, belongs to the MYB gene family. MYB52 There are four copies in rapeseed, one copy each on chromosomes A08 and A09, and two copies on chromosome C08, which are BnaA08.MYB52 (BnaA08G0236300WE), BnaA09.MYB52 (BnaA09G0583300WE), BnaC08.MYB52-1 (BnaC08G0420000WE) and BnaC08.MYB52-2 (BnaC08G0199000WE). Among them, BnaA09.MYB52 and BnaC08.MYB52-1 The nucleotide sequences of the two proteins have the highest similarity, as shown in SEQ ID NO: 2 and SEQ ID NO: 3 in the sequence listing, and the amino acid sequences are shown in SEQ ID NO: 6 and SEQ ID NO: 7. BnaA09.MYB52 The nucleotide sequence is 744 bp in length and encodes 247 amino acids.

[0035] (1) RNA extraction

[0036] Total RNA was extracted using TansZol (catalog number ET101) from Quanshijin. Brassica napus seeds at 40 days of age were ground in liquid nitrogen. 100 mg of the ground sample was transferred to a 1.5-mL centrifuge tube, and 1 mL of TransZol was added. The tube was vigorously inverted several times to mix thoroughly and allowed to stand at room temperature for 5 minutes. 0.2 mL of chloroform was added, and the tube was vigorously shaken for 15 seconds and incubated at room temperature for 3 minutes. The tube was centrifuged at 10,000 × g for 15 minutes at 4°C. At this time, the sample separated into three layers: a colorless aqueous phase (upper layer), a middle layer, and a pink organic phase (lower layer). The colorless aqueous phase was transferred to a new centrifuge tube, 0.5 mL of isopropanol was added, the tube was inverted to mix thoroughly, and the tube was incubated at room temperature for 10 minutes. The tube was centrifuged at 10,000 × g for 10 minutes at 4°C. The supernatant was removed, and a gelatinous precipitate formed on the sides and bottom of the tube. 1 mL of 75% ethanol (prepared with DEPC-treated water) was added and vortexed vigorously. The tube was centrifuged at 7,500 × g for 10 minutes. Centrifuge at 4°C for 5 minutes; discard the supernatant and air-dry the pellet at room temperature. Dissolve the pellet in 50-100 μL of RNA dissolution buffer and incubate at 55°C for 10 minutes. Determine the RNA concentration using a Nanodrop analyzer. Assess RNA purity by OD260 / OD280 of 1.8 < 2.0. Also, perform 1 μL of the extracted total RNA on a 1% agrose electrophoresis to check its integrity.

[0037] (2) cDNA synthesis

[0038] Reverse transcription was performed using the All-Gold EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (Catalog No. AE311). Using 1 μg of total RNA as template, 1 μL of Anchored Oligo (dT)18 Primer, 10 μL of 2× ES Reaction Mix, 1 μL of EasyScript® RT / RI Enzyme Mix, and 1 μL of gDNA Remover were added, followed by RNase-free water to 20 μL. The system was gently mixed and incubated at 42°C for 30 minutes to synthesize first-strand cDNA and remove gDNA. The EasyScript® RT / RI and gDNA Remover were inactivated by heating at 85°C for 5 seconds. The synthesized cDNA was dissolved in 180 μL of RNase-free water and set aside.

[0039] (3) BnaA09.MYB52 Gene amplification

[0040] The above cDNA was used as template and the forward primer sequence was BnaA09.MYB52-pCAMBIA2306-F: 5' ACGGGGGACGAGCTCGGTACC ATGATGTGTAGTCGAGGACAT 3', reverse primer sequence is BnaA09.MYB52-pCAMBIA2306-R: 5' TTGGTCGACTCTAGAGGATCC ACATAAACTCTGAGAGGCA 3', amplified BnaA09.MYB52 Full-length CDS fragment (stop codon removed). PCR amplification was performed using I-5™ 2× High-Fidelity Master Mix (TSINGKE Biologica technology). The PCR amplification system was as follows:

[0041] 2×I-5™ 2×High-Fidelity Master Mix 25 μL

[0042] Primer Forward (10 μmoL / L)2.5 μL

[0043] Primer Reverse (10 μmoL / L)2.5 μL

[0044] cDNA 3 μL

[0045] ddH2O 17 μL

[0046] PCR amplification program: total denaturation at 98°C for 1 min; denaturation at 98°C for 15 sec, annealing at 58°C for 15 sec, extension at 72°C for 30 sec, 34 circles; total extension at 72°C for 5 min.

[0047] The amplified product was detected by agarose gel electrophoresis, and a 729 bp BnaA09.MYB52 The full-length CDS sequence was recovered using the Tiangen Agarose Gel Extraction Kit (http: / / www.tiangen.com / ).

[0048] Example 2 BnaA09.MYB52 Construction of gene overexpression transformation vector

[0049] (1) Use fast restriction endonuclease Kpn I and Bam The vector pCAMBIA2306 was digested with HI double enzymes. The double enzyme digestion system is as follows:

[0050] 5×Fast digestion buffer:10 μL

[0051] Kpn I: 1 μL

[0052] Bam HI: 1 μL

[0053] Recovered product / plasmid: 20 μL

[0054] ddH2O: 18 μL

[0055] The enzyme digestion reaction was carried out in a 37°C water bath for 3 hours, and the digestion product was recovered using the Tiangen DNA purification kit.

[0056] (2) The gene CDS fragment was ligated into the vector 35S-pCAMBIA2306, which contains a constitutive expression promoter and an antibiotic marker.

[0057] The connection method is as follows:

[0058] BnaA09.MYB52 Amplified fragment: 6 μL

[0059] Fragments recovered after vector digestion: 1 μL

[0060] Exnase II (Vazyme): 1 μL

[0061] 5×CE II buffer: 2 μL

[0062] Ligation reaction conditions: 37°C for 30 min.

[0063] (3) Transformation into E. coli DH5α:

[0064] Pipette 10 µL of the ligation product into 50 µL of DH5α competent cells, pipette and mix thoroughly, and place on ice for 30 minutes. Incubate in a 42°C water bath for 1.5 minutes, then place on ice for 3 minutes. Add 400 µL of antibiotic-free liquid LB medium and activate in a shaker at 37°C, 150 rpm for 45-60 minutes. Pipette 200 µL of the activated bacterial solution onto solid LB medium with the corresponding resistance and incubate at 37°C inverted for 12-16 hours. Positive clones were then screened and identified by enzyme digestion. Three positive clones were selected for sequencing, and the analysis results showed that BnaA09.MYB52 The CDS sequence of the gene was successfully connected to the vector, and the plant expression vector 35S-pCAMBIA2306 for the transformed plant was successfully constructed. - BnaA09.MYB52.

[0065] (4) Introduce the correctly constructed recombinant plasmid vector into Agrobacterium strain GV3101, select positive single clones and store them in a -80℃ refrigerator. The introduction method is as follows:

[0066] a. Clean the cuvette: First, rinse with pure water, then with ultrapure water, discard, and then rinse with anhydrous ethanol (using a 1 mL pipette tip). Discard the anhydrous ethanol and place on a clean bench to dry.

[0067] b. Take 50 μL of competent Agrobacterium GV3101;

[0068] c. Take 1 μL of the correctly constructed recombinant plasmid and add it to 50 μL of competent medium. Mix thoroughly by gently pipetting to avoid creating bubbles.

[0069] d. Place the washed and dried electric rotating cup in ice to pre-cool, and then pour the above mixture against the wall of the cup;

[0070] e. Adjust the electroporator to 1800 V;

[0071] f. Remove the electroporation cup from the ice and wipe the outer wall of the electroporation cup with absorbent paper;

[0072] g. Place the rotating cup into the instrument and press the "push" button twice in succession. If you hear a "beep" sound after a few seconds, the process is successful.

[0073] h. After successful electroporation, add 400 μL of antibody-free LB to the cuvette, pipette to mix, and transfer to a sterile centrifuge tube.

[0074] i. Activate at 28°C for approximately 1 hour. Apply 100 μL of the solution to a plate containing the corresponding resistance. Seal with sealing film and incubate upside down at 28°C for 2 days. Perform spot detection.

[0075] (5) Agrobacterium colony detection

[0076] Select colonies and culture them in double-antibody LB medium at 28°C for 1 hour. Take an appropriate amount of bacterial solution for PCR detection and save the positive Agrobacterium bacterial solution.

[0077] Example 3 BnaMYB52- Construction of CRISPR vectors

[0078] Generate rapeseed using the sgRNA-Cas9 system from Chen Qijun's team at the College of Life Sciences, China Agricultural University BnaMYB52 Mutants. The experimental steps are as follows:

[0079] (1) Log in to the website http: / / crispr.hzau.edu.cn / CRISPR2 / and select the target sgRNA1:ATAACGCTGTTAAAAACCAT and sgRNA2:GCTGCGACGATTGGTTATGA, which are located in the gene BnaA09.MYB52 and BnaC08.MYB52-1 The second exon region of BnaA08.MYB52 and BnaC08.MYB52-2Only sgRNA1 is located in the second exon of the gene. Therefore, sgRNA1 can target all BnaMYB52 Gene ， While sgRNA2 can target BnaA09.MYB52 and BnaC08.MYB52-1 .

[0080] (2) Primer design

[0081] DT1-BsF: ATATATGGTCTCGATTG ATAACGCTGTTAAAAACCAT GTT

[0082] DT1-F0: TG ATAACGCTGTTAAAAACCAT GTTTTAGAGCTAGAAATAGC

[0083] DT2-R0: AAC TCATAACCAATCGTCGCAGC CAATCTCTTAGTCGACTCTAC

[0084] DT2-BsR: ATTATTGGTCTCGAAAC TCATAACCAATCGTCGCAGC CAA

[0085] (3) PCR amplification: Four-primer PCR amplification was performed using pCBC-DT1T2 diluted 100-fold as the template. DT1-BsF and DT2-BsR were normal primer concentrations; DT1-F0 and DT2-R0 were diluted 20-fold. The amplification system was:

[0086] 2×I-5™ 2×High-Fidelity Master Mix: 25 μL

[0087] DT1-BsF (10 μmol / L): 2 μL

[0088] DT2-BsR (10 μmol / L): 2 μL

[0089] DT1-F (0.5 μmol / L): 2 μL

[0090] DT2-R0 (0.5 μmol / L): 2 μL

[0091] pCBC-DT1T2 plasmid: 3 μL

[0092] ddH2O: 14 μL

[0093] PCR amplification program: total denaturation at 98°C for 1 min; denaturation at 98°C for 15 sec, annealing at 56°C for 25 sec, extension at 72°C for 25 sec, 34 circles; total extension at 72°C for 5 min.

[0094] (4) Purify and recover the PCR product and establish the following restriction-ligation system:

[0095] PCR fragment: 2 μL

[0096] pKSE401: 2 μL

[0097] 10×NEB T4 Buffer: 1.5 μL

[0098] 10× BSA: 1.5 μL

[0099] BsaI (NEB): 1 μL

[0100] T4 Ligase (NEB): 1 μL

[0101] ddH2O: 6 μL

[0102] Reaction conditions: 5 h at 37°C, 5 min at 50°C, 10 min at 80°C

[0103] (5) Transformation into E. coli DH5α: Take 5 μL of the competent E. coli, screen on a Kan plate, identify the positive clones by PCR and sequence them. The vector with the correct sequencing is BnaMYB52 CRISPR vectors.

[0104] (6) Introduce the correctly constructed recombinant plasmid vector into Agrobacterium strain GV3101, select the positive single clone and store it in a -80℃ refrigerator. The introduction method is as follows:

[0105] a. Clean the cuvette: First, rinse with pure water, then with ultrapure water, discard, and then rinse with anhydrous ethanol (using a 1 ml pipette tip). Discard the anhydrous ethanol and place on a clean bench to dry.

[0106] b. Take 50 μl of competent Agrobacterium GV3101;

[0107] c. Take 1 μl of the correctly constructed recombinant plasmid and add it to 50 μl of competent medium. Mix thoroughly by gently pipetting to avoid creating bubbles.

[0108] d. Place the washed and dried electric rotating cup in ice to pre-cool, and then pour the above mixture against the wall of the cup;

[0109] e. Adjust the electroporator to 1800 V;

[0110] f. Remove the electroporation cup from the ice and wipe the outer wall of the electroporation cup with absorbent paper;

[0111] g. Place the rotating cup into the instrument and press the "push" button twice in succession. If you hear a "beep" sound after a few seconds, the process is successful.

[0112] h. After successful electroporation, add 400 μl of antibody-free LB to the cuvette, pipette a few times, and transfer to a sterile centrifuge tube.

[0113] i. Activate at 28°C for about 2 hours. Apply 100 μl of the solution to the plate containing the double antibody, seal with sealing film, and incubate upside down at 28°C incubator for 2 days. Perform spot detection.

[0114] (7) Agrobacterium colony detection

[0115] Select colonies and culture them in double-antibody LB medium at 28°C for 2 hours. Take an appropriate amount of bacterial solution for PCR detection and save the positive Agrobacterium bacterial solution.

[0116] Example 4 Genetic transformation experiment

[0117] (1) Genetic transformation of rapeseed

[0118] For the constructed BnaA09.MYB52 Overexpression vectors and BnaMYB52 -CRISPR vectors were used for genetic transformation of rapeseed using Agrobacterium-mediated genetic transformation. The receptor for rapeseed transformation in this invention was Brassica napus Westar. The specific operation process is detailed in the reference: An efficient Agrobacterium-mediated transformation method using hypocotyl as explants for Brassica napus .

[0119] (2) Identification of overexpression transformed cells

[0120] The genomic DNA of the obtained rapeseed overexpression transformed plant was extracted, and the insertion of the exogenous gene fragment was detected by PCR. The overexpression backbone vector in the present invention was 35S-pCAMBIA2306. The primer pCAMBIA2306-R (5'-CATGGTGGCAAATTCTGATCC-3') was designed on the vector backbone. PCR was performed by combining the vector backbone primer with the exogenous fragment primer (the sequence of BnaA09.MYB52-pCAMBIA2306-F is shown in Example 1). The transgenic seedlings were detected at the PCR level ( Picture 1a). The PCR system was as follows: Taq polymerase mix 5 µL; pCAMBIA2306-R (10 µmol / L) 0.5 µL; BnaA09.MYB52-pCAMBIA2306-F (10 µmol / L) 0.5 µL; gDNA 1 µL; ddH2O 3 µL. PCR conditions: total denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 58°C for 30 sec, extension at 72°C for 1 min, 34 circles; total extension at 72°C for 5 min.

[0121] qRT-PCR was performed on transgenic rapeseed seedlings obtained by PCR to detect gene expression. RNA was extracted from leaves of individual transformed plants and cDNA was synthesized (using the same method as in Example 1). Quantitative primers were designed using Primer 5 software, with product sizes ranging from 80 to 250 bp. After design, BLAST comparison was performed with reference sequences to ensure the specificity of primers BnMYB52-RT-F (5'-ACCGCAAGCACTATCAGTTATCC-3') and BnMYB52-RT-R (5'-GTTGTGATTGTGGCTGTGTTCAG-3'). BnaACTIN7-L (5'-CGCGCCTAGCAGCATGAA-3') and BnaACTIN7-R (5'-GTTGGAAAGTGCTGAGAGATGCA-3') were used as internal reference primers for rapeseed qRT-PCR (see Zhou et al. 2012 for details). BnMs3 is required for tapetal differentiation and degradation, microsporeseparation, and pollen-wall biosynthesis in Brassica napus ). The reaction system is:

[0122] cDNA diluted 10-fold: 6.9 μL

[0123] Primer 1 (10 μM): 0.3 μL

[0124] Primer 2 (10 μM): 0.3 μL

[0125] 2×TransStart® Green qPCR SuperMix: 7.5 μL

[0126] The reaction program was as follows: 94°C for 30 s, followed by 45 cycles of 94°C for 10 s, 60°C for 15 s, and 72°C for 30 s. Melting curves were drawn. qRT-PCR was performed in a Bio-Rad CFX96 Real-Time System.

[0127] Normalization was performed based on the internal reference primers, and delta-deltathreshold cycle relative quantification (2 -ΔΔCT ) method. Finally, the relative expression levels of rapeseed overexpression transformed plants OE-1 and OE-2 were obtained by analysis ( Picture 1 b).

[0128] (3) Identification of CRISPR-transformed strains

[0129] The obtained rapeseed CRISPR transformed individual plants were sequenced to screen rapeseed mutants. First, the Cas9 protein was identified using primers Cas9-570-F (5'-AGACCGTGAAGGTTGTGGAC-3') and Cas9-570-R (5'-TAGTGATCTGCCGTGTCTC-G-3'), and the target gene was specifically amplified and sequenced for the Cas9 protein-positive individual plants. The method for specific amplification of the target gene was as follows: specific amplification was performed using primers MYB52(A8)-CRISPR-F (5'-GAGATGGTTTAATCAACTGGATCC-3') and MYB52(A8)-CRISPR-R (5'-CATCAGGTTCTACTCGAATGCAC-3') respectively. BnaA08.MYB52 MYB52(A9)-CRISPR-F (5'-GAATCCTAGAATTAACCGAAACCC-3') and MYB52(A9)-CRISPR-R (5'-ATAAGAAGTTGCAGACTTGTTGCA-3') specific amplification BnaA09.MYB52 MYB52(C8-1)-CRISPR-F (5'-TCCTAGAATTAACCGAAACCCGT-3') and MYB52(C8-1)-CRISPR-R (5'-CACACAAGCAAGCATGTGCATAT-3') specific amplification BnaC08.MYB52-1 MYB52(C8-2)-CRISPR-F (5'-AGATGGTTTAATCAACTGGATCCT-3') and MYB52(C8-2)-CRISPR-R (5'-GATGTCTGTCCTTCTACTTGCCA-3') specific amplification BnaC08.MYB52-2 , the amplification method is as follows:

[0130] The PCR system consisted of 20 μL of 2× Taq Master Mix, 2 μL of DNA template, 1.6 μL of primer F, 1.6 μL of primer R, and ddH₂O to 40 μL. PCR conditions included denaturation at 94°C for 5 min, denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 30 sec, 32 circles, and a total extension at 72°C for 5 min.

[0131] The PCR products of the amplified target fragments were sequenced, and the sequencing results were analyzed using the DSDecode online website (http: / / skl.scau.edu.cn / dsdecode / ) to analyze the editing status of the target site. The sequencing results showed that BnaMYB52 Two independent mutant lines in which all four homologous genes were edited ( bnamyb52-1 and bnamyb52-2 ; Picture 2 ).

[0132] Example 5 Phenotypic Analysis of Overexpression and Mutant Materials

[0133] ① Determination of rapeseed seed oil content using near-infrared analyzer

[0134] The quality of rapeseed seeds harvested at maturity was analyzed using a near-infrared analyzer to obtain seed oil content data. The instrument was provided by the National Rapeseed Engineering Technology Research Center of Huazhong Agricultural University. For detailed operation procedures, please refer to the reference: Establishment of mathematical models of NIRS analysis for oil and protein contents in seed of Brassica napus .

[0135] The results of oil content showed that the oil content of the receptor background material Westar was 38.34±1.38, and the mutant material bnamyb52-1 and bnamyb52-2 The oil contents of OE-1 and OE-2 were 40.49±1.62% and 39.86±1.25%, respectively, while the average oil contents of seeds of OE-1 and OE-2 were 36.67±0.74% and 36.23±1.61%, respectively. Statistical analysis showed that the oil contents of the two mutants were significantly increased compared with the wild type, while the oil content of OE was significantly decreased ( Picture 3 a).

[0136] ②Measure seed lignin using a lignin content detection kit

[0137] Lignin content was extracted and measured using the BOXBIO lignin content detection kit (AKSU010M) from rapeseed seeds harvested at maturity. The method was referred to the kit instructions. The results showed that the lignin content of the seeds of the receptor background material Westar was 15.80±1.50, and the mutant material bnamyb52-1 and bnamyb52-2 The seed lignin contents of OE-1 and OE-2 were 10.71±2.80% and 10.48±1.74%, respectively, while the average seed lignin contents of OE-1 and OE-2 were 18.65±2.07% and 18.79±2.14%, respectively. Statistical analysis showed that the seed lignin contents of the two mutants were significantly reduced compared with the wild type, while the seed lignin content of OE was significantly increased ( Picture 3 b).

[0138] In summary, genes BnaMYB52 It plays an important role in regulating the oil content and lignin content of rapeseed seeds.

Claims

1. A method for increasing the oil content of rapeseed, characterized in that: Agrobacterium-mediated genetic transformation was used to introduce transcription factors BnaMYB52 The CRISPR / Cas9 gene editing vector encoding the gene was transformed into the rapeseed genome, and the CRISPR / Cas9 gene editing technology was used to obtain a rapeseed variety in which the functions of four homologous genes were simultaneously deleted. The nucleotide sequences of the four homologous genes are shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4, respectively, and the encoded protein sequences are shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8, respectively.

2. The method for increasing the oil content of rapeseed according to claim 1, wherein The transcription factor BnaMYB52 The method for constructing a CRISPR / Cas9 gene editing vector encoding a gene includes the following steps: 1) Screening gene editing targets and designing primers based on the four homologous gene sequences; 2) Using the pCBC-DT1T2 plasmid as a template, perform PCR amplification using the designed primers; 3) Ligate the PCR product with the pKSE401 plasmid by restriction enzyme digestion; 4) Transform competent E. coli, screen for positive clones, and sequence them. The correctly sequenced vector is the CRISPR / Cas9 gene editing vector encoding the transcription factor BnaMYB52 gene.

3. The method for increasing the oil content of rapeseed according to claim 2, wherein: The sequences of the gene editing targets are: sgRNA1: ATAACGCTGTTAAAAACCAT; sgRNA2: GCTGCGACGATTGGTTATGA.

4. The method for increasing the oil content of rapeseed according to claim 3, wherein: The primer sequences are: DT1-BsF: ATATATGGTCTCGATTGATAACGCTGTTAAAAACCATGTT DT1-F0: TGATAACGCTGTTAAAAACCATGTTTTAGAGCTAGAAATAGC DT2-R0: AACTCATAACCAATCGTCGCAGCCAATCTCTTAGTCGACTCTAC DT2-BsR:ATTATTGGTCTCGAAACTCATAACCAATCGTCGCAGCCAA.

Images