Vestibular supporting cell promoters and uses thereof

Abstract

The present disclosure relates to vestibular supporting cell promoters and uses thereof. The present disclosure provides polynucleotides containing the SLC6A14 promoter, as well as vectors containing the polynucleotides, which can be used to promote expression of transgenes in vestibular supporting cells. The polynucleotides described herein can be operably linked to a transgene, such as a transgene encoding a therapeutic protein, to promote vestibular supporting cell expression of the transgene. The polynucleotides described herein can be operably linked to a therapeutic transgene and used to treat a subject having or at risk of having vestibular dysfunction.

Description

[0001] This application is a divisional application of the invention patent with application date of November 4, 2020, application number 202080091035.4, and invention name “Vestibular supporting cell promoter and its use”. Background Art

[0002] Vestibular dysfunction is a major public health problem that has a profound impact on quality of life. Approximately 35% of American adults aged 40 and over exhibit balance disorders, and this proportion increases significantly with age, leading to disruption of daily activities, mood and cognitive decline, and an increased prevalence of falls in the elderly. Vestibular dysfunction is usually acquired and has a variety of causes, including disease or infection, head trauma, ototoxic medications, and aging. A common factor in the etiology of vestibular dysfunction is damage to the vestibular hair cells in the inner ear. Therefore, therapies aimed at restoring hair cell function would benefit patients with vestibular dysfunction. Vestibular supporting cells are known to spontaneously differentiate into hair cells after injury and can therefore be used as a therapeutic target suitable for restoring hair cell function. Summary of the invention

[0003] The present invention provides compositions and methods for promoting expression of target genes (e.g., genes that promote or improve hair cell or supporting cell function, regeneration, maturation, proliferation, or survival) in specific cell types. The compositions and methods described herein relate to solute carrier family 6 member 14 (SLC6A14) promoter sequences that stimulate transcription of transgenes in vestibular supporting cells (VSCs) of the inner ear. The SLC6A14 promoter sequences described herein can be operably linked to a transgene and can be administered to a patient to treat vestibular dysfunction (e.g., vertigo, dizziness, imbalance, bilateral vestibular disease, bilateral vestibular hypofunction, oscillopsia, or balance disorders).

[0004] In a first aspect, the invention provides a nucleic acid vector comprising a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to any one of SEQ ID NOs: 1-6. In some embodiments, the polynucleotide has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to SEQ ID NO: 1. In some embodiments, the polynucleotide has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to SEQ ID NO: 2. In some embodiments, the polynucleotide has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to SEQ ID NO: 3. In some embodiments, the polynucleotide has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to SEQ ID NO: 4. In some embodiments, the polynucleotide has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to SEQ ID NO: 5. In some embodiments, the polynucleotide has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to SEQ ID NO: 6. In some embodiments, the polynucleotide has the sequence of SEQ ID NO: 3. In some embodiments, the polynucleotide has the sequence of SEQ ID NO: 4. In some embodiments, the polynucleotide has the sequence of SEQ ID NO: 5. In some embodiments, the polynucleotide has the sequence of SEQ ID NO: 6. In some embodiments, the polynucleotide has the sequence of SEQ ID NO: 2. In some embodiments, the polynucleotide has the sequence of SEQ ID NO: 1.

[0005] In some embodiments, the polynucleotide is operably linked to a transgenic. In some embodiments, the transgenic is a heterologous transgenic. In some embodiments, the transgenic contains a polynucleotide sequence encoding a protein (e.g., a therapeutic protein or a reporter protein), a short interfering RNA (siRNA), an antisense oligonucleotide (ASO), a nuclease (e.g., CRISPR-associated protein 9 (Cas9), a transcription activator-like effector nuclease (TALEN), a zinc finger nuclease (ZFN), or a guide RNA (gRNA)), or a microRNA. In some embodiments, the protein is a therapeutic protein.

[0006] In some embodiments, the polynucleotide is capable of directing vestibular supporting cell (VSC)-specific expression of a protein (eg, a therapeutic protein or a reporter protein), siRNA, ASO, nuclease, or microRNA in a mammalian VSC. In some embodiments, the VSC is a human VSC.

[0007] In some embodiments, the therapeutic protein is Sal-like transcription factor 2 (Sall2), calmodulin-binding transcription activator 1 (Camta1), Hes-related family BHLH transcription factor with YRPW motif 2 (Hey2), Gata binding protein 2 (Gata2), Hes-related family BHLH transcription factor with YRPW motif 1 (Hey1), ceramide synthase 2 (Lass2), SRY box 10 (Sox10), GATA binding protein 3 (Gata3), Cut-like homeobox 1 (Cux1), nuclear receptor subfamily 2F group member (Nr2f1), Hes-related family BHLH transcription factor (Hes1), RAR-related orphan receptor B (Rorb), Jun proto-oncogene AP-1 transcription factor subunit (Jun), zinc finger protein 667 (Zfp667), LIM homeobox 3 (Lhx3), nonsense helix-loop-helix 1 (Nhlh1), MAX dimerization protein 4 (Mxd4), MIZ-1 type zinc finger (Zmiz1), myelin transcription factor 1 (Myt1), signal transducer and activator of transcription 3 (Stat3), BarH-like homeobox 1 (Barhl1), thymocyte selection-related high-mobility group box (Tox), Prospero homeobox 1 (Prox1), nuclear factor IA (Nfia), thyroid hormone receptor beta (Thrb), MYCL proto-oncogene BHLH transcription factor (Mycl1), lysine demethylase 5A (Kdm5a), CAMP response element binding protein 3-like 4 (Creb3I4), ETS variant 1 (Etv1), paternally expressed 3 (Peg3), BTB domain and CNC homolog 2 (Bach2), ISLLIM homeobox 1 (Isl1), zinc finger and BTB domain-containing 38 (Zbtb38), limb bud and heart development (Lbh), Tubby bipartite transcription factor (Tub), ubiquitin C (Hmg20), RE1 silencing transcription factor (Rest), zinc finger protein 827 (Zfp827), AF4 / FMR2 family member 3 (Aff3), PBX / knotted 1 homeobox 2 (Pknox2), AT-rich interaction domain 3B (Arid 3b), MLX-interacting protein (Mlxip), zinc finger protein (Zfp532), IKAROS family zinc finger 2 (Ikzf2), Sal-like transcription factor 1 (Sall1), SIX homeobox 2 (Six2), Sal-like transcription factor 3 (Sall3), Lin-28 homolog B (Lin28b), regulatory factor X7 (Rfx7), brain-derived neurotrophic factor (Bdnf), growth factor-independent 1 transcriptional repressor (Gfi1), POU4-like homeobox 3 (Pou4f3), MYC proto-oncogene BHLH transcription factor (Myc), β-catenin (Ctnnb1), SRY box 2 (Sox2), SRY box 4 (Sox4), SRY box 11 (Sox11), TEA domain transcription factor 2 (Tead2), aregulated BHLH transcription factor 1 (Atoh1), or Atoh1 variants. In some embodiments, the Atoh1 variant has one or more amino acid substitutions selected from the group consisting of: S328A, S331A, S334A, S328A / S331A, S328A / S334A, S331A / S334A, and S328A / S331A / S334. In some embodiments, the therapeutic protein is Atoh1 (eg, human Atoh1). In some embodiments, the Atoh1 protein comprises the sequence of SEQ ID NO: 10 or a variant thereof having one or more (eg, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) conservative amino acid substitutions. In some embodiments, no more than 10% (10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less) of the amino acids in the Atoh1 protein variant are conservative amino acid substitutions.In some embodiments, the Atoh1 protein is encoded by the sequence of SEQ ID NO:11.

[0008] In some embodiments, the nucleic acid vector further comprises an inverted terminal repeat (ITR). In embodiments where the nucleic acid vector comprises a polynucleotide of the invention operably linked to a transgene, the nucleic acid vector comprises a first ITR sequence 5' of the polynucleotide and a second ITR sequence 3' of the transgene. In some embodiments, the ITR is an AAV2 ITR. In some embodiments, the ITR has at least 80% sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity) with the AAV2 ITR.

[0009] In some embodiments, the nucleic acid vector further comprises a polyadenylation (poly(A)) sequence. In some embodiments, the poly(A) sequence is a bovine growth hormone (bGH) poly(A) signal sequence. In embodiments where the nucleic acid vector comprises a polynucleotide of the invention operably linked to a transgene, the poly(A) sequence is located 3' to the transgene. In embodiments where the nucleic acid vector comprises a first and a second ITR sequence and a polynucleotide of the invention operably linked to a transgene, the poly(A) sequence is located 3' to the transgene and 5' to the second ITR sequence.

[0010] In some embodiments, the nucleic acid vector further comprises a Woodchuck post-transcriptional regulatory element (WPRE). In some embodiments, the WPRE has a sequence of SEQ ID NO: 14 or SEQ ID NO: 15. In embodiments where the nucleic acid vector comprises a polynucleotide of the invention operably linked to a transgene, the WPRE is located 3' to the transgene. In embodiments where the nucleic acid vector comprises a polynucleotide of the invention operably linked to a transgene and a poly(A) sequence, the WPRE is located 3' to the transgene and 5' to the poly(A) sequence.

[0011] In some embodiments, the nucleic acid vector contains a polynucleotide sequence comprising the sequence of nucleotides 233-2922 of SEQ ID NO:7.

[0012] In some embodiments, the nucleic acid vector of the present invention includes a SLC6A14 promoter (e.g., a polynucleotide of any one of SEQ ID NOs: 1-6) operably linked to a polynucleotide sequence encoding human Atoh1 (human ATOH1 protein = RefSeq Accession No. NP_005163 (SEQ ID NO: 10); mRNA sequence = RefSeq Accession No. NM_005172). In some more specific embodiments, the nucleic acid vector of the present invention includes a SLC6A14 promoter of SEQ ID NO: 4 operably linked to a polynucleotide sequence encoding human Atoh1 (e.g., a polynucleotide sequence encoding SEQ ID NO: 10, such as a polynucleotide sequence of SEQ ID NO: 11). In some even more specific embodiments, the nucleic acid vector includes, in 5' to 3' order, a first inverted terminal repeat; a SLC6A14 promoter of SEQ ID NO: 4; a polynucleotide sequence encoding human Atoh1 operably linked to the SLC6A14 promoter; a polyadenylation sequence; and a second inverted terminal repeat. In other more specific embodiments, the nucleic acid vector comprises, in 5' to 3' order, a first inverted terminal repeat; a SLC6A14 promoter of SEQ ID NO:4; a polynucleotide sequence encoding human Atoh1 operably linked to the SLC6A14 promoter; a woodchuck posttranscriptional regulatory element (WPRE); a polyadenylation sequence; and a second inverted terminal repeat. In an even more specific embodiment, the nucleic acid vector comprises nucleotides 233-2922 of SEQ ID NO:7 flanked by inverted terminal repeats. In an even more specific embodiment, the nucleic acid vector comprises nucleotides 233-2922 of SEQ ID NO:7 flanked by inverted terminal repeats, wherein the 5' inverted terminal repeat has at least 80% sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to nucleotides 1-130 of SEQ ID NO:7; and wherein the 3' inverted terminal repeat has at least 80% sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) to nucleotides 1-130 of SEQ ID NO:7; and Nucleotides 3010-3139 of NO:7 have at least 80% sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity).

[0013] In some embodiments, the nucleic acid vector is a viral vector, a plasmid, a cosmid or an artificial chromosome. In some embodiments, the nucleic acid vector is a viral vector selected from the group including adeno-associated virus (AAV), adenovirus and lentivirus. In some embodiments, the viral vector is an AAV vector. In some embodiments, the AAV vector has AAV1, AAV2, AAV2quad (YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eB or PHP.S capsid. In some embodiments, the AAV vector has an AAV1 capsid. In some embodiments, the AAV vector has an AAV9 capsid. In some embodiments, the AAV vector has an AAV6 capsid. In some embodiments, the AAV vector has an AAV8 capsid. In some embodiments, the AAV vector has an Anc80 capsid. In some embodiments, the AAV vector has an Anc80L65 capsid. In some embodiments, the AAV vector has a DJ / 9 capsid. In some embodiments, the AAV vector has a 7m8 capsid. In some embodiments, the AAV vector has an AAV2 capsid. In some embodiments, the AAV vector has a PHP.B capsid. In some embodiments, the AAV vector has an AAV2quad (YF) capsid. In some embodiments, the AAV vector has a PHP.S capsid. In some embodiments, the AAV vector has a PHP.eB capsid. In some embodiments, the AAV vector has an AAV3 capsid. In some embodiments, the AAV vector has an AAV4 capsid. In some embodiments, the AAV vector has an AAV5 capsid. In some embodiments, the AAV vector has an AAV7 capsid.

[0014] It will be understood by one of ordinary skill in the art that production of the viral vectors of the invention generally requires the use of the plasmids of the invention and additional plasmids that provide the elements required for suitable viral packaging and viability (e.g., for AAV, plasmids that provide the appropriate AAV rep gene, cap gene, and other genes (e.g., E2A and E4)). The combination of those plasmids in the production cell line produces the viral vector. However, it will be understood by one of ordinary skill in the art that for any given pair of inverted terminal repeat sequences (e.g., SEQ ID NO: 7, 8, or 9) in the transfer plasmid of the invention used to produce the viral vector, the corresponding sequence in the viral vector may be altered due to the ITRs adopting a "flip" or "flop" orientation during recombination. Thus, the sequence of the ITRs in the transfer plasmid is not necessarily the same sequence found in the viral vector prepared therefrom. However, in some very specific embodiments, the viral vectors of the invention comprise nucleotides 1-3139 of SEQ ID NO: 7.

[0015] In another aspect, the present invention provides a composition comprising the nucleic acid vector of the present invention. In some embodiments, the composition further comprises a pharmaceutically acceptable carrier, diluent or excipient.

[0016] In another aspect, the invention provides polynucleotides having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to any one of SEQ ID NOs: 1-6 operably linked to a transgene. In some embodiments, the polynucleotide has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to SEQ ID NO: 1. In some embodiments, the polynucleotide has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to SEQ ID NO: 2. In some embodiments, the polynucleotide has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to SEQ ID NO: 3. In some embodiments, the polynucleotide has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to SEQ ID NO: 4. In some embodiments, the polynucleotide has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to SEQ ID NO: 5. In some embodiments, the polynucleotide has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to SEQ ID NO: 6. In some embodiments, the polynucleotide has the sequence of SEQ ID NO: 3. In some embodiments, the polynucleotide has the sequence of SEQ ID NO: 4. In some embodiments, the polynucleotide has the sequence of SEQ ID NO: 5. In some embodiments, the polynucleotide has the sequence of SEQ ID NO: 6. In some embodiments, the polynucleotide has the sequence of SEQ ID NO: 2. In some embodiments, the polynucleotide has the sequence of SEQ ID NO: 1.

[0017] In some embodiments, the transgene is a heterologous transgene. In some embodiments of the foregoing aspects, the transgene encodes a protein (e.g., a therapeutic protein or a reporter protein), siRNA, ASO, a nuclease (e.g., Cas9, TALEN, ZFN, or gRNA), or a microRNA. In some embodiments, the protein is a therapeutic protein.

[0018] In some embodiments, the therapeutic protein is Sox9, Sall2, Camtal, Hey2, Gata2, Hey1, Lass2, Sox10, Gata3, Cux1, Nr2f1, Hes1, Rorb, Jun, Zfp667, Lhx3, Nhlh1, Mxd4, Zmiz1, Myt1, Stat3, Barhl1, Tox, Prox1, Nfia, Thrb, Mycl1, Kdm5a, Creb314, Etv1, Peg3, Bach2, Isl1, Zbtb38, Lbh, Tub, Hmg20, Rest, Zfp827, Af f3, Pknox2, Arid3b, Mlxip, Zfp532, Ikzf2, Sall1, Six2, Sall3, Lin28b, Rfx7, Bdnf, Gfi1, Pou4f3, Myc, Ctnnb1, Sox2, Sox4, Sox11, Tead2, Atoh1, or an Atoh1 variant (e.g., an Atoh1 variant having one or more amino acid substitutions selected from the group consisting of: S328A, S331A, S334A, S328A / S331A, S328A / S334A, S331A / S334A, and S328A / S331A / S334). In some embodiments, the therapeutic protein is Atoh1 (e.g., human Atoh1). In some embodiments, the Atoh1 protein comprises the sequence of SEQ ID NO: 10 or a variant thereof having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) conservative amino acid substitutions. In some embodiments, no more than 10% (10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less) of the amino acids in the Atoh1 protein variant are conservative amino acid substitutions. In some embodiments, the Atoh1 protein consists of the sequence of SEQ ID NO: 10. In some embodiments, the Atoh1 protein is encoded by the sequence of SEQ ID NO: 11.

[0019] In another aspect, the present invention provides a cell (e.g., a mammalian cell, e.g., a human cell, e.g., a VSC) comprising a polynucleotide or a nucleic acid vector of any one of the aforementioned aspects and embodiments. In some embodiments, the cell is a mammalian VSC. In some embodiments, the mammalian VSC is a human VSC. In some embodiments, the polynucleotide has at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to any one of SEQ ID NOs: 1-6.

[0020] In another aspect, the invention provides a method of expressing a transgene in a mammalian VSC by contacting the mammalian VSC with a nucleic acid vector or composition of any one of the foregoing aspects and embodiments. In some embodiments, the transgene is specifically expressed in the VSC. In some embodiments, the mammalian VSC is a human VSC.

[0021] On the other hand, the present invention provides a method for treating a subject by administering an effective amount of a nucleic acid vector of the present invention or a composition to a subject suffering from vestibular dysfunction or a risk of suffering from vestibular dysfunction. In some embodiments, vestibular dysfunction is vertigo, dizziness, imbalance, bilateral vestibular disease, bilateral vestibular hypofunction, oscillopsia or balance disorder. In some embodiments, vestibular dysfunction is age-related vestibular dysfunction, head trauma-related vestibular dysfunction, disease or infection-related vestibular dysfunction or ototoxic drug-induced vestibular dysfunction. In some embodiments, vestibular dysfunction is associated with a genetic mutation.

[0022] In another aspect, the present invention provides a method for inducing or increasing vestibular hair cell regeneration in a subject by administering an effective amount of a nucleic acid vector or composition of the present invention to a subject in need thereof.

[0023] In another aspect, the present invention provides a method for inducing or increasing VSC proliferation in a subject by administering an effective amount of a nucleic acid vector or composition of the present invention to a subject in need thereof.

[0024] In another aspect, the present invention provides a method for inducing or increasing vestibular hair cell proliferation in a subject by administering an effective amount of a nucleic acid vector or composition of the present invention to a subject in need thereof.

[0025] In another aspect, the present invention provides a method of inducing or increasing vestibular hair cell maturation in a subject by administering an effective amount of a nucleic acid vector or composition of the present invention to a subject in need thereof. In some embodiments, the vestibular hair cells are regenerating vestibular hair cells.

[0026] In another aspect, the present invention provides a method for increasing VSC survival in a subject by administering an effective amount of a nucleic acid vector or composition of the present invention to a subject in need thereof.

[0027] In another aspect, the present invention provides a method for increasing vestibular hair cell survival in a subject by administering to a subject in need thereof an effective amount of a nucleic acid vector or composition of the present invention.

[0028] In another aspect, the present invention provides a method for inducing or increasing vestibular hair cell innervation in a subject by administering to a subject in need thereof an effective amount of a nucleic acid vector or composition of the present invention.

[0029] In some embodiments of any of the aforementioned aspects, the subject has or is at risk of developing a vestibular dysfunction (eg, dizziness, vertigo, imbalance, bilateral vestibulopathy, bilateral vestibular hypofunction, oscillopsia, or balance disorder).

[0030] In another aspect, the invention provides a method of treating a subject by administering an effective amount of a nucleic acid vector or composition of the invention to a subject suffering from or at risk of suffering from bilateral vestibular hypofunction. In some embodiments, bilateral vestibular hypofunction is ototoxic drug-induced bilateral vestibular hypofunction.

[0031] In some embodiments of any of the preceding aspects, the ototoxic drug is selected from the group consisting of an aminoglycoside, an antineoplastic drug, ethacrynic acid, furosemide, a salicylate, and quinine.

[0032] In another aspect, the invention provides a method of treating a subject by administering to the subject having or at risk of having oscillopsia an effective amount of a nucleic acid vector or composition of the invention.

[0033] In another aspect, the invention provides a method of treating a subject by administering an effective amount of a nucleic acid vector or composition of the invention to a subject having or at risk of developing bilateral vestibulopathy.

[0034] In another aspect, the invention provides methods of treating a subject by administering to the subject having or at risk of having a balance disorder (eg, imbalance) an effective amount of a nucleic acid vector or composition of the invention.

[0035] In some embodiments of any of the foregoing aspects, the method further comprises assessing the vestibular function of the subject prior to administering the nucleic acid vector or composition. In some embodiments, the method further comprises assessing the vestibular function of the subject after administering the nucleic acid vector or composition.

[0036] In some embodiments of any one of the aforementioned aspects, nucleic acid vector or composition is topically applied. In some embodiments, nucleic acid vector or composition is applied to the semicircular canals. In some embodiments, nucleic acid vector or composition is applied through tympanic cavity or intratympanic cavity (for example, via injection through tympanic cavity or intratympanic cavity). In some embodiments, nucleic acid vector or composition is applied to perilymph or endolymph, for example, via oval window, round window or semicircular canals (for example, lateral semicircular canals), for example, applied to vestibular supporting cells. In some embodiments, nucleic acid vector or composition of the present invention is applied to perilymph. In some embodiments, nucleic acid vector or composition of the present invention is applied to endolymph. In some embodiments, nucleic acid vector or composition of the present invention is applied to oval window or applied via oval window. In some embodiments, nucleic acid vector or composition of the present invention is applied to round window or applied via round window.

[0037] In some embodiments of any of the foregoing aspects, the nucleic acid vector or composition is administered in an amount sufficient to prevent or alleviate vestibular dysfunction, delay the onset of vestibular dysfunction, slow the progression of vestibular dysfunction, improve vestibular function, increase vestibular hair cell number, increase vestibular hair cell maturation, increase vestibular hair cell proliferation, increase vestibular hair cell regeneration, increase vestibular hair cell innervation, increase VSC proliferation, or increase VSC number.

[0038] In some embodiments, the subject is a human.

[0039] In another aspect, the present invention provides a kit comprising a nucleic acid vector of the present invention or a composition of the present invention.

[0040] definition

[0041] As used herein, "administering" refers to providing or administering a therapeutic agent (eg, a nucleic acid vector containing a solute carrier family 6 member 14 (SLC6A14) promoter operably linked to a transgene) to a subject by any effective route. Exemplary routes of administration are described below.

[0042] As used herein, the term "cell type" refers to a cell population that shares a phenotype that is statistically separable based on gene expression data. For example, cells of common cell types may share similar structural and / or functional characteristics, such as similar gene activation patterns and antigen presentation profiles. Cells of common cell types may include those cells isolated from common tissues (e.g., epithelial tissue, neural tissue, connective tissue, or muscle tissue) and / or those cells isolated from other structures and / or regions in common organs, tissue systems, blood vessels, or organisms.

[0043] As used herein, the terms "conservative mutation", "conservative substitution" and "conservative amino acid substitution" refer to the substitution of one or more amino acids with one or more amino acids for one or more different amino acids that exhibit similar physicochemical properties (e.g., polarity, electrostatic charge and steric bulk). These properties for each of the twenty naturally occurring amino acids are summarized in Table 1 below.

[0044] Table 1. Representative physicochemical properties of naturally occurring amino acids

[0045]

[0046] It will be appreciated from this table that the conservative amino acid family includes (i) G, A, V, L and I; (ii) D and E; (iii) C, S and T; (iv) H, K and R; (v) N and Q; and (vi) F, Y and W. Thus, a conservative mutation or substitution is a substitution of one amino acid for a member of the same amino acid family (e.g., substitution of Ser for Thr or substitution of Lys for Arg).

[0047] As used herein, the terms "effective amount", "therapeutically effective amount" and "sufficient amount" of the compositions, vector constructs or viral vectors described herein refer to an amount sufficient to achieve a beneficial or desired result (including a clinical result) when administered to a subject (including a mammal, such as a human), and thus "effective amount" or its synonyms depend on the context in which it is applied. For example, in the case of treating vestibular dysfunction, it is an amount of the composition, vector construct or viral vector sufficient to achieve a therapeutic response compared to the response obtained when the composition, vector construct or viral vector is not administered. The amount of a given composition described herein that will correspond to this amount will vary according to a variety of factors, such as a given dose, pharmaceutical formulation, route of administration, type of disease or condition, identity of the subject (e.g., age, sex, weight) or the host being treated, but can still be determined in a conventional manner by one skilled in the art. In addition, as used herein, a "therapeutically effective amount" of a composition, vector construct or viral vector disclosed herein is an amount that produces a beneficial or desired result in a subject compared to a control. As defined herein, a therapeutically effective amount of a composition, vector construct or viral vector of the present disclosure can be readily determined by one of ordinary skill in the art by routine methods known in the art. Dosage regimens may be adjusted to provide the optimal therapeutic response.

[0048] As used herein, the term "endogenous" describes a molecule (e.g., a polypeptide, nucleic acid, or cofactor) that is naturally present in a particular organism (e.g., a human) or a particular location within an organism (e.g., an organ, tissue, or cell, e.g., a human cell, e.g., a human vestibular supporting cell).

[0049] As used herein, the term "expression" refers to one or more of the following events: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of the RNA transcript (e.g., by splicing, editing, 5' cap formation, and / or 3' end processing); (3) translation of the RNA into a polypeptide or protein; and (4) post-translational modification of the polypeptide or protein.

[0050] As used herein, the term "exogenous" describes molecules (e.g., polypeptides, nucleic acids, or cofactors) that do not naturally occur in a particular organism (e.g., a human) or a particular location (e.g., an organ, tissue, or cell, e.g., a human cell, e.g., a human vestibular supporting cell) within an organism. Exogenous materials include those materials provided from a source external to an organism or a culture extracted therefrom.

[0051] As used herein, the term "exon" refers to a region within a gene coding region whose nucleotide sequence determines the amino acid sequence of the corresponding protein. The term exon also refers to the corresponding region of RNA transcribed from a gene. Exons are transcribed into pre-mRNA and may be included in mature mRNA, depending on alternative splicing of the gene. Exons included in mature mRNA are translated into proteins after processing, wherein the sequence of the exons determines the amino acid composition of the protein.

[0052] As used herein, the term "heterologous" refers to a combination of non-natural elements. For example, a heterologous transgene refers to a transgene that is not naturally expressed by the promoter to which it is operably linked.

[0053] As used herein, the terms "increase" and "decrease" refer to the regulation of the function, expression or activity of the measurement, respectively, relative to the reference greater or less amount. For example, after the composition is applied in the method described herein, the amount of the marker measured as described herein (e.g., transgenic expression) in the subject can be increased or decreased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% or more relative to the amount of the marker before application. Typically, the measurement is measured after application when the application has the listed effect (e.g., at least one week, one month, 3 months or 6 months after the start of the treatment regimen).

[0054] As used herein, "topically" or "topical administration" means administration at a specific site of the body intended for a local effect rather than a systemic effect. Examples of topical administration are epidermal, inhalation, intra-articular, intrathecal, intravaginal, intravitreal, intrauterine, intralesional administration, lymph node administration, intratumoral administration, administration to the middle or inner ear, and administration to the mucous membranes of a subject, where the administration is intended to have a local effect rather than a systemic effect.

[0055] As used herein, the term "operably connected" refers to a first molecule that is attached to a second molecule, wherein the molecule is arranged so that the first molecule affects the function of the second molecule. Two molecules may or may not be a part of a single adjacent molecule and may or may not be adjacent. For example, if a promoter regulates the transcription of a target transcribable polynucleotide molecule in a cell, the promoter is operably connected to the transcribable polynucleotide molecule. In addition, if the two parts of the transcriptional regulatory element are joined so that the transcriptional activation function of a part is not adversely affected by the presence of another part, the two parts are operably connected to each other. Two transcriptional regulatory elements can be operably connected to each other by means of a joint nucleic acid (e.g., an intervening non-coding nucleic acid) or can be operably connected to each other when there is no intervening nucleotide.

[0056] As used herein, the term "plasmid" refers to an extrachromosomal circular double-stranded DNA molecule to which an additional DNA segment can be connected. A plasmid is a vector that is a nucleic acid molecule capable of transporting another nucleic acid connected thereto. Some plasmids can replicate autonomously in the host cell into which they are introduced (e.g., bacterial plasmids and episomal mammalian plasmids with bacterial replication origins). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of the host cell after being introduced into the host cell, and thus replicated together with the host genome. Some plasmids can guide the expression of genes operably connected thereto.

[0057] As used herein, the term "polynucleotide" refers to a polymer of nucleosides. Typically, polynucleotides are composed of nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine) naturally present in DNA or RNA joined by phosphodiester bonds. The term encompasses molecules containing nucleosides or nucleoside analogs containing chemically or biologically modified bases, modified backbones, etc., whether or not found in naturally occurring nucleic acids, and such molecules may be preferred for certain applications. It should be understood that when this application relates to polynucleotides, DNA, RNA, and single-stranded and double-stranded forms (and the complement of each single-stranded molecule) are provided. As used herein, "polynucleotide sequence" may refer to sequence information (i.e., a string of letters used as abbreviations of bases) of polynucleotide materials themselves and / or biochemical characterization of specific nucleic acids. Unless otherwise indicated, the polynucleotide sequences presented herein are presented in a 5' to 3' direction.

[0058] As used herein, the term "promoter" refers to a recognition site on DNA to which RNA polymerase binds. The polymerase drives transcription of a transgene.

[0059] "Percentage (%) of sequence identity" relative to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence in the candidate sequence after the alignment sequence and the introduction of spaces (if necessary) to achieve the maximum percentage of sequence identity. For the purpose of determining the percentage of nucleic acid or amino acid sequence identity, the comparison can be achieved in various ways within the capabilities of those skilled in the art, such as using publicly available computer software, such as BLAST, BLAST-2 or Megalign software. Those skilled in the art can determine the parameters applicable to the alignment sequence, including any algorithm required for achieving maximum alignment within the full length of the compared sequence. For example, sequence identity percentage values ​​can be generated using the sequence comparison computer program BLAST. As an illustration, the sequence identity % of a given nucleic acid or amino acid sequence A relative to (to), with (with) or against (against) a given nucleic acid or amino acid sequence B (alternatively, it can be expressed as a given nucleic acid or amino acid sequence A with a specific sequence identity % relative to, with or against a given nucleic acid or amino acid sequence B) is calculated as follows:

[0060] 100×(fraction X / Y)

[0061] wherein X is the number of nucleotides or amino acids scored as identical matches by a sequence alignment program (e.g., BLAST) in the program's alignment of A and B, and wherein Y is the total number of nucleic acids in B. It will be appreciated that when the length of nucleic acid or amino acid sequence A is not equal to the length of nucleic acid or amino acid sequence B, the % sequence identity of A relative to B will not be equal to the % sequence identity of B relative to A.

[0062] As used herein, the term "pharmaceutical composition" refers to a mixture containing a therapeutic agent, optionally in combination with one or more pharmaceutically acceptable excipients, diluents and / or carriers, to be administered to a subject (e.g., a mammal, such as a human) to prevent, treat or control a particular disease or condition that affects or may affect the subject.

[0063] As used herein, the term "pharmaceutically acceptable" refers to those compounds, materials, compositions and / or dosage forms that are suitable for contact with the tissues of subjects (e.g., mammals, such as humans) without excessive toxicity, irritation, allergic response, and other problematic complications, and that are commensurate with a reasonable benefit / risk ratio.

[0064] As used herein, the term "transcriptional regulatory element" refers to a nucleic acid that at least partially controls the transcription of a target gene. A transcriptional regulatory element may include a promoter, an enhancer, and other nucleic acids (e.g., polyadenylation signals) that control or help control gene transcription. Examples of transcriptional regulatory elements are described in, for example, Lorence, Recombinant Gene Expression: Reviews and Protocols (Humana Press, New York, NY, 2012).

[0065] As used herein, the term "transfection" refers to any of a variety of techniques commonly used to introduce exogenous DNA into prokaryotic or eukaryotic host cells, such as electroporation, lipofection, calcium phosphate precipitation, DEAE polydextrose transfection, Nucleofection, extrusion perforation, sonoporation, optical transfection, magnetic transfection, piercing transfection, etc.

[0066] As used herein, the terms "subject" and "patient" refer to an animal (e.g., a mammal, such as a human). A subject to be treated according to the methods described herein may be a subject who has been diagnosed with a vestibular disorder (e.g., dizziness, vertigo, or imbalance) or a subject at risk of developing these disorders. Diagnosis can be performed by any method or technique known in the art. It will be understood by those skilled in the art that a subject to be treated according to the present disclosure may have been subjected to standard testing or may have been identified as a subject at risk without examination due to the presence of one or more risk factors associated with a disease or disorder.

[0067] As used herein, the terms "transduction" and "transduction" refer to a method of introducing a vector construct or a portion thereof into a cell. Where the vector construct is contained in a viral vector (e.g., an AAV vector), transduction refers to infection of the cell with the virus and subsequent transfer and integration of the vector construct or a portion thereof into the cell genome.

[0068] As used herein, "treatment" and "treating" with respect to a disease or disorder refer to methods for obtaining a beneficial or desired result (e.g., a clinical result). Beneficial or desired results may include, but are not limited to, alleviation or improvement of one or more symptoms or disorders; reduction of the extent of a disease or disorder; stabilization (i.e., not worsening) of the state of a disease, disorder, or illness; prevention of the spread of a disease or disorder; delay or slowing the progression of a disease or disorder; improvement or alleviation of a disease or disorder; and relief (whether partial or complete), whether detectable or undetectable. "Improvement" or "mitigation" of a disease or disorder means reducing the extent and / or undesirable clinical manifestations of a disease, disorder, or illness and / or slowing or prolonging the course of progression compared to the extent or course without treatment. "Treatment" may also mean providing survival compared to the expected survival when not receiving treatment. Those in need of treatment include those already suffering from a disease or disorder as well as those susceptible to a disease or disorder or those to be prevented from a disease or disorder.

[0069] As used herein, the term "vector" includes nucleic acid vectors, such as DNA vectors, such as plasmids, cosmids or artificial chromosomes, RNA vectors, viruses or any other suitable replicons (e.g., viral vectors). A variety of vectors have been developed for delivering polynucleotides encoding exogenous proteins to prokaryotic or eukaryotic cells. Examples of such expression vectors are described in, for example, Gellissen, Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems (John Wiley & Sons, Marblehead, MA, 2006). Expression vectors suitable for the compositions and methods described herein contain polynucleotide sequences and, for example, additional sequence elements for expressing proteins and / or integrating these polynucleotide sequences into the genome of mammalian cells. Certain vectors that can be used to express transgenics as described herein include vectors containing regulatory sequences (e.g., promoter and enhancer regions) that guide gene transcription. Other vectors that can be used to express transgenics contain polynucleotide sequences that enhance the translation rate of transgenics or improve the stability or nuclear export of mRNA derived from gene transcription. These sequence elements include, for example, 5' and 3' untranslated regions and polyadenylation signal sites that guide the effective transcription of genes carried on the expression vector. Expression vectors suitable for use in the compositions and methods described herein may also contain polynucleotides encoding markers for selecting cells containing such vectors. Examples of suitable markers include genes encoding antibiotic resistance, such as ampicillin, chloramphenicol, kanamycin, or nourseothricin.

[0070] As used herein, the terms "vestibular supporting cells" and "VSCs" refer to a collection of specialized epithelial cells in the vestibular system of the inner ear that are involved in the development, survival, function, death, and phagocytosis of vestibular hair cells. VSCs provide structural support to vestibular hair cells by anchoring them in the sensory epithelium and releasing neurotrophic factors that are critical for hair cell innervation.

[0071] As used herein, the terms "vestibular supporting cell-specific expression" and "VSC-specific expression" refer to the production of RNA transcripts or polypeptides primarily in vestibular supporting cells compared to other cell types of the inner ear (e.g., vestibular hair cells, cochlear hair cells, cochlear supporting cells, glia, or other inner ear cell types). VSC expression of a transgene can be confirmed by comparing transgene expression (e.g., RNA or protein expression) between various cell types of the inner ear (e.g., VSC vs. non-VSC cells) using any standard technique (e.g., quantitative RT PCR, immunohistochemistry, western blot analysis, or measuring fluorescence of a reporter gene (e.g., GFP) operably linked to a promoter). The VSC-specific promoter induces at least 50% greater (e.g., 50%, 75%, 100%, 125%, 150%, 175%, 200% or greater) expression (e.g., RNA or protein expression) of an operably linked transgene in VSCs as compared to at least three (e.g., 3, 4, 5, 6, 7, 8, 9, 10 or more) of the following inner ear cell types: vestibular ganglion cells, non-sensory epithelial cells of the vestibular organ, dark cells of the vestibular organ, mesenchymal cells of the vestibular organ, spiral ganglion cells, marginal cells, inner digital cells, inner pillar cells, outer pillar cells, first row Deiter cells, second row Deiter cells, third row Deiter cells, Hensen's cells cells), Claudius cells, inner sulcus cells, outer sulcus cells, spiral process cells, root cells, interdental cells, basal cells of the stria vascularis, intermediate cells of the stria vascularis, marginal cells of the stria vascularis, inner hair cells, outer hair cells, vestibular hair cells, and Schwann cells.

[0072] As used herein, the term "wild type" refers to the genotype with the highest frequency of a particular gene in a given organism. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] Figure 1A-1B is a series of violin plots showing solute carrier family 6 member 14 (SLC6A14) expression in mouse inner ear tissue as measured by single-cell RNA sequencing. Background expression of SLC6A14 was observed only in cochlear cell types ( Figure 1A Robust SLC6A14 expression was seen in supporting cell utricular sacs and cristae ( Figure 1B ).

[0074] Figure 2 The expression of SLC6A14 in a large number of cell lines from various tissues was analyzed using the ARCHS4 database. The HepG2 cell line (human liver cancer) was one of the three cell lines with the highest midpoint expression of endogenous SLC6A14.

[0075] Figure 3 is a bar graph showing the transduction efficiency of different adeno-associated virus (AAV) serotypes in HepG2 cells. The cytomegalovirus (CMV)-human histone H2B-green fluorescent protein (GFP) reporter gene was packaged into adeno-associated virus (AAV) 1, AAV8, and AAV9 capsids and cultured at 1×10 6 The cells were transduced into HepG2 cells at a multiplicity of infection (MOI) of 1 vector genome (vg) / cell. If the GFP signal produced by the cells analyzed by flow cytometry was greater than the background measured in non-transduced (NT) cells, the cells analyzed by flow cytometry were counted as GFP positive.

[0076] Figures 4A-4B is a series of bar graphs showing GFP expression in HepG2 cells transfected with SLC6A14 promoter plasmids. HepG2 cells were transduced with plasmids encoding CMV or one of the three variants of the SLC6A14 promoter. Detectable GFP signals were observed from all tested plasmids, including plasmids containing the SLC6A14 promoter (i.e., P335 SLC6A14 hum v1 containing the promoter sequence of SEQ ID NO: 3; P372 Slc6a14 mus containing the promoter sequence of SEQ ID NO: 5; and P530 SLC6A14 hum v2 containing the promoter sequence of SEQ ID NO: 4), as detected by flow cytometry ( Figure 4A ). GFP-positive cells filtered out produced a stronger GFP signal than the CMV control ( Figure 4B ).

[0077] Figures 5A-5E is a series of fluorescent images showing HepG2 cells transfected with nuclear GFP under the control of multiple promoters. No GFP signal was seen in untransfected control cells ( Figure 5A GFP-positive nuclei were observed for four different plasmids, including P329 CMV ( Figure 5B )、P335 SLC6A14 v1 (containing the promoter sequence of SEQ ID NO: 3; Figure 5C), P372SLC6A14v1 (containing the promoter sequence of SEQ ID NO: 5; Figure 5D ) and P530SLC6A14 v2 (containing the promoter sequence of SEQ ID NO: 4; Figure 5E ).

[0078] Figure 6 HepG2 cells were transduced with AAV8 vectors encoding GFP under the control of multiple promoters, including CMV, SLC6A14 (murine promoter #1; SEQ ID NO:5), SLC6A14 (murine promoter #2; SEQ ID NO:6), SLC6A14 (human promoter #3; SEQ ID NO:3), and SLC6A14 (human promoter #4; SEQ ID NO:4). Cells were expressed at 1×10 6 All promoters produced GFP positive cells, indicating that the promoters were functional promoters when delivered via viruses.

[0079] Figures 7A-7D is a series of fluorescent images showing viral transduction of GFP under the control of SLC6A14 murine promoter #1 (SEQ ID NO: 5). GFP expression is visible in the sensory epithelium, which contains hair cells (POU class 4 homeobox 3 (Pou4f3)) and supporting cells (Sal-like transcription factor 2 (Sall2); Fig. 7A ). A lateral view of the utricle shows GFP labeling consistent with Sall2-positive supporting cell nuclei but not with Pou4f3-positive hair cell nuclei ( Figure 7B GFP expression was also observed in the explanted ridges ( Figure 7C ). Transverse view of the cristae shows GFP expression colocalized primarily with supporting cells ( Fig.7D ).

[0080] Figures 8A-8D is a series of fluorescent images showing viral transduction of GFP under the control of the SLC6A14 murine promoter #2 (SEQ ID NO:6). GFP expression is only visible in a small portion of the utricle sensory epithelium that contains hair cells (Pou4f3) and supporting cells (Sall2; Fig. 8A ). A lateral view of the utricle shows GFP labeling consistent with Sall2-positive supporting cell nuclei as well as a portion of Pou4f3-positive hair cell nuclei ( Figure 8B ). Low levels of GFP expression were also observed in explanted ridges ( Figure 8C ). Transverse views of the ridges show GFP expression that is primarily colocalized with supporting cells but also occurs in nonspecific regions ( Fig.8D ).

[0081] Figures 9A-9C is a series of fluorescent images showing GFP expression in the vestibular organ of mice after delivery of the viral vector of AAV8-SLC6A14 murine promoter #1 (SEQ ID NO: 5)-H2B-GFP into the posterior semicircular canal of adult mice via local injection. Fig. 9A ), small capsule ( Fig. 9B ) and crest ( Fig. 9C ) GFP expression can be seen in the

[0082] Fig.10 is a series of images showing the specificity of GFP expression in inner ear tissues. Inner ear hematoxylin and eosin (H&E) staining of the mouse inner ear was counterstained for GFP protein to identify the nuclei of cells expressing GFP in the sac, utricle, ridge and fossa of the cochlea. The upper image of the image shows hematoxylin and GFP staining. The image was then color filtered to extract only the red channel (GFP) from the original RGB image to highlight the GFP staining, as shown in the lower image of the image. Staining shows specific expression in the supporting cell nuclei of the vestibular organ, with almost no GFP detected in the hair cells. GFP was not detected in cochlear tissues (including the organ of Corti or the stria vascularis).

[0083] Figures 11A-11B is a series of images showing that the SLC6A14 promoter restricts GFP expression to supporting cells. Inner ear H&E sections of the mouse inner ear were counterstained for GFP protein to identify the nuclei of cells expressing GFP ( Fig.11A In adjacent sections, the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) of the AAV vector genome was labeled with an RNAScope probe ( Fig. 11B For each slice shown, the image was then color filtered to extract the red channel from the original RGB image to highlight the GFP staining ( Fig.11A ) or RNAScope staining ( Fig. 11B ),like Figures 11A-11B . A large number of vector genomes can be detected in hair cells, supporting cells, and mesenchymal cells beneath the sensory epithelium, indicating that the GFP-expressing vector transduces multiple cell types. However, GFP expression was only detected in supporting cells.

[0084] Figures 12A-12Dis a series of figures showing that silencing Atoh1 transgenic expression in new hair cells via a supporting cell-specific promoter can drive further maturation. Utricles were dissected from male C57Bl / 6J mice (6-8 weeks old) and cultured in 100 μl of basal medium. Gentamycin (0.5 mg / mL) was added to the culture medium for 24 hours to kill the hair cells, then gentamicin was washed off and replaced with 250 μL of fresh culture medium containing one of the following AAVs at a dose of 1E12 gc: AAV8-CMV-Atoh1-2A-H2BGFP (CMV promoter group), AAV8-GFAP-Atoh1-2A-H2BGFP (supporting cell (SC) specific promoter group) or AAV8-RLBP1-Atoh1-2A-H2BGFP (SC specific promoter group). After one day of incubation, the virus was washed off and the utricles were cultured in 2 mL of fresh culture medium for another 3 days, 8 days or 16 days. At the end of the culture period, the utricles were dissociated and single cells were captured and prepared for single cell RNA-Seq. Prediction scores were generated in Seurat by comparison with a database of single cell RNA-Seq signatures of utricle hair cells generated from embryonic day 18 (E18), postnatal day 12 (P12), and adult mice. Violin plots were generated to show Atoh1 transgene expression and maturation prediction scores in regenerating hair cells in adult utricle explants. The Atoh1 transgene was expressed at low or undetectable levels in regenerating hair cells in the SC-specific promoter group, while it was expressed at high levels in almost all hair cells from the CMV group ( Fig. 12A These results confirm that the Atoh1 transgene is naturally downregulated in regenerating hair cells when it is driven by a SC-specific promoter. Fig. 12C ) and adult hair cells ( Fig.12D ) than those from the CMV group. In contrast, the single-cell RNA-Seq features from the CMV group that were strongly correlated with E18 hair cells ( Fig. 12B ) than the single-cell RNA-Seq signatures from the SC-specific promoter group. Therefore, natural silencing of the Atoh1 transgene with an SC-specific promoter induces the maturation of regenerating hair cells.

[0085] Figures 13A-13B is a series of images showing that the human SLC6A14 promoter also restricts GFP expression to mouse vestibular supporting cells. Fig.13AMaximum intensity confocal z-stack projections of flat-mounted utricles (top 3 panels) and posterior crests (bottom 3 panels) of adult mice injected with AAV8 vectors containing the human SLC6A14 promoter (SEQ ID NO: 4) driving H2B-GFP expression (resulting in nuclear expression of GFP). All nuclei were labeled with DAPI (first image in each panel), and supporting cell nuclei were immunolabeled with antibodies against Sall2 (second image in each panel). DAPI labeling of non-sensory cells extended beyond the area of ​​sensory epithelium demarcated by Sall2. Nuclear GFP expression (third image in each panel) was limited to the sensory epithelium and did not extend to the area labeled by Sall2. Fig. 13B Display via Fig.13A Orthogonal cross-sections of confocal z-stacks of the utricle shown in . From top to bottom of the figure, DAPI labeling shows pseudostratification of hair cell nuclei, a monolayer of supporting cell nuclei beneath the hair cell nuclei, and mesenchymal nuclei beneath the supporting cells. Sall2 labeling is confined to supporting cell nuclei and a small subset of hair cell nuclei. Pou4f3 labels all hair cell nuclei. GFP expression is tightly confined to supporting cell nuclei only, confirming the specificity of the promoter sequence.

[0086] Figures 14A-14B is a series of images showing the activity of the human SLC6A14 promoter in non-human primates. Fig.14A Shown is a maximum intensity confocal z-stack projection of a flat-mounted utricle of an adult non-human primate injected with an AAV8 vector containing the human SLC6A14 promoter (SEQ ID NO: 4) driving H2B-GFP expression (resulting in nuclear expression of GFP). All nuclei were labeled with DAPI. Nuclear GFP expression was confined to the sensory epithelium and did not extend into the non-sensory epithelium (in the right panel, the edge between the sensory and non-sensory epithelium is demarcated by a dotted line). Fig. 14B FFPE sections stained with H&E (upper image) and then color filtered to remove the red channel from the original RGB image to highlight GFP-stained utricles are shown. Nuclear GFP expression was detected in most supporting cells (dark nuclei).

[0087] Figures 15A-15B We show that an AAV8 vector containing the human SLC6A14 promoter drives ATOH1 expression in regenerating hair cells in an in vivo mouse model of IDPN injury. Fig.15AShown are maximum intensity confocal z-stack projections of flat-mounted utricles of the right and left ears of adult mice to which 3,3'-iminodiapropionitrile (IDPN) was systemically administered to kill vestibular hair cells and then locally injected with an AAV8 vector containing the human SLC6A14 promoter driving co-expression of ATOH1 and H2B-GFP fusion protein (nuclear GFP) in the left ear. Hair cells were immunolabeled with an antibody against Pou4f3. The untreated right ear (left panel) shows a significant reduction in hair cell density compared to the treated left ear (right panel). Fig. 15B The results showed that the treated ear had a significantly lower level of Pou4f3 than the untreated ear. + Bar graph of quantification of cells. Treated ears showed a statistically significant increase in hair cells compared to untreated ears (n=6, Student's t-test, p<0.01).

[0088] Fig.16 is a graph showing hair cell regeneration in response to AAV8 vectors containing the human SLC6A14 promoter driving co-expression of ATOH1 and H2B-GFP fusion protein (nuclear GFP) at four different vector doses in an in vivo IDPN injury mouse model. Hair cells were immunolabeled with an antibody against Pou4f3 and the number of regenerated hair cells was determined by subtracting the counts in the untreated right ear from the counts in the treated left ear of each mouse. Error bars show SEM.

[0089] Figures 17A-17B Demonstrated the ability of an AAV8 vector containing the human SLC6A14 promoter driving ATOH1 expression to regenerate hair cells in vivo in an adult mouse gentamicin injury model. Fig.17A Shown are a series of maximum intensity confocal z-stack projections of flat-mounted utricles of adult mice to which gentamicin was topically applied to the left ear to kill vestibular hair cells and then injected with an AAV8 vector containing the human SLC6A14 promoter driving co-expression of ATOH1 and H2B-GFP fusion protein (nuclear GFP) ("AAV.ATOH1") in the same ear. Hair cells were immunolabeled with an antibody against Pou4f3. Utricles with gentamicin injury ("Gent (Saline)") treated with vehicle showed a significant decrease in hair cell density compared to gentamicin injury ("AAV8 vector treated with AAV.ATOH1") . Hair cell density appears to be increased in ATOH1 treated ucicles compared to vehicle control ucicles. Fig. 17Bis a scatter plot showing quantification of Pou4f3+ nuclei for various treatments. AAV8 gentamicin-injured vector-treated ears showed a significant increase in hair cell number compared to gentamicin-injured vehicle-treated ears (n=12-14, ANOVA and Tukey test, p<0.05).

[0090] Fig.18 is a map of the transgenic plasmid of SEQ ID NO:7 (plasmid P760).

[0091] Fig.19 is a map of the transgenic plasmid of SEQ ID NO:9 (plasmid P530).

[0092] Fig. 20 is a map of the transgenic plasmid of SEQ ID NO:8 (plasmid P625).

[0093] Fig.21 is a map of transgenic plasmid P335 containing the human SLC6A14 promoter of SEQ ID NO:3.

[0094] Fig. 22 is a map of the transgenic plasmid P372 containing the mouse SLC6A14 promoter of SEQ ID NO:5.

[0095] Fig.23 is a map of the transgenic plasmid P373 containing the mouse SLC6A14 promoter of SEQ ID NO:6. DETAILED DESCRIPTION

[0096] Described herein are compositions and methods for specifically inducing expression of transgenes in vestibular supporting cells (VSCs) of the inner ear. The invention features polynucleotides containing a region of a solute carrier family 6 member 14 (SLC6A14) promoter capable of specifically expressing transgenes in VSCs. The invention also features a nucleic acid vector containing the promoter operably linked to a polynucleotide encoding a polypeptide. The compositions and methods described herein can be used to express polynucleotides encoding proteins (e.g., therapeutic proteins, reporter proteins, or other target proteins) in VSCs that provide structural and nutritional support to vestibular hair cells, and thus the compositions described herein can be administered to a subject (e.g., a mammalian subject, such as a human) to treat disorders caused by dysfunction of vestibular hair cells, such as balance disorders derived from vestibular dysfunction.

[0097] Support cells

[0098] The supporting cells of the vestibular system are specialized epithelial cells resident in the inner ear. VSC constitutes a class of anatomical and morphologically uniform cells that mediate the key structures, development and nutritional activity required for normal vestibular function. VSC is located in the utricle, sac and semicircular canals of the inner ear and is used as the structural anchor of vestibular hair cells, which are the main sensory cells of the peripheral vestibular system and participate in the motor sensation that contributes to balance and spatial orientation. Synaptic formation to the hair cells of the vestibulocochlear nerve is mediated by neurotrophic factors secreted by VSC, which helps to establish and maintain suitable vestibular function. In addition, VSC controls extracellular and intracellular calcium signaling and forms a phagocytic multicellular structure (called phagosome) as an important mediator of vestibular hair cell survival, death and phagocytic clearance, which maintains the integrity of the sensory epithelium by removing dead or dying hair cells. Vestibular hair cell damage and genetic mutations that destroy vestibular hair cell function are related to vestibular dysfunction (such as loss of balance and vertigo (such as dizziness)). Gene therapy has recently become an attractive approach for treating vestibular dysfunction; however, the art lacks methods for targeting nucleic acid vectors for use in gene therapy to supporting cells of the vestibular system.

[0099] The present invention is based in part on the discovery that SLC6A14 is specifically expressed in the inner ear VSCs. SLC6A14 is a gene encoding a sodium and chloride-dependent neurotransmitter transporter that can transport neutral and positively charged amino acids in a sodium and chloride-dependent manner that has not been previously identified as expressed in the inner ear. The SLC6A14 promoter sequence disclosed herein induces gene expression in the inner ear in a VSC-specific manner. Therefore, the compositions and methods described herein can be used to express target genes in VSCs (e.g., genes involved in vestibular hair cell development, vestibular hair cell fate specialization, vestibular hair cell regeneration, vestibular hair cell and / or VSC proliferation, vestibular hair cell innervation or vestibular hair cell maturation or genes known to be disrupted, such as mutated) to treat subjects with vestibular dysfunction (e.g., vertigo, dizziness, or loss of balance) or at risk of developing the disease.

[0100] The compositions and methods described herein include the SLC6A14 promoter shown in Table 2 (e.g., any one of SEQ ID NOs: 1-6), which is capable of specifically expressing a transgene in a VSC or a variant thereof (e.g., a nucleic acid sequence having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) with any one of the polynucleotide sequences listed in Table 2 (e.g., any one of SEQ ID NOs: 1-6). The polynucleotides described herein may include regions located upstream and downstream of the translation start site (TSS) of the SLC6A14 gene or may include only the upstream region of the SLC6A14 gene.

[0101] The aforementioned nucleic acid sequences are summarized in Table 2 below.

[0102] Table 2: SLC6A14 promoter sequence

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109] Expression of foreign nucleic acids in mammalian cells

[0110] The compositions and methods described herein can be used to induce or increase expression of a protein encoded by a target gene (e.g., a wild-type form of a gene involved in vestibular dysfunction, or a gene involved in vestibular hair cell development, vestibular hair cell fate specification, vestibular hair cell regeneration, vestibular hair cell and / or VSC proliferation, vestibular hair cell innervation, or vestibular hair cell maturation) in VSCs by administering a nucleic acid vector containing an SLC6A14 promoter (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to a sequence of the SLC6A14 promoter (e.g., any one of SEQ ID NOs: 1-6) operably linked to a nucleic acid sequence encoding the target protein. A wide variety of methods have been established for delivering proteins to mammalian cells and for stably expressing genes encoding proteins in mammalian cells. Can be expressed in conjunction with the compositions described herein (e.g., when a transgene encoding a protein is operably linked to the SLC6A14 promoter (e.g., with any of the sequences listed in Table 2 (e.g., SEQ ID NO: 1-6) having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) of the polynucleotide) is a protein expressed in healthy VSCs (e.g., a protein that plays a role in vestibular hair cell development, vestibular hair cell fate specification, vestibular hair cell regeneration, vestibular hair cell and / or VSC proliferation, vestibular hair cell innervation or vestibular hair cell maturation, or a protein that is missing in a subject with vestibular dysfunction) or other target proteins. Proteins that can be expressed in VSCs using the compositions and methods described herein include Sal-like transcription factor 2 (Sall2), calmodulin binding transcription activator 1 (Camta1), , Hes-related family BHLH transcription factor with YRPW motif 2 (Hey2), Gata binding protein 2 (Gata2), Hes-related family BHLH transcription factor with YRPW motif 1 (Hey1), ceramide synthase 2 (Lass2), SRY box 10 (Sox10), GATA binding protein 3 (Gata3), Cut-like homeobox 1 (Cux1), nuclear receptor subfamily 2 group F member (Nr2f1), Hes-related family BHLH transcription factor (Hes1), RAR-related orphan receptor B (Rorb), Jun proto-oncogene AP-1 transcription factor subunit (Jun), zinc finger protein 667 (Zfp667), LIM homeobox 3 (Lhx3), nonsense helix-loop-helix 1 (Nhlh1), MAX dimerization protein 4 (Mxd4),MIZ-1 type zinc finger (Zmiz1), myelin transcription factor 1 (Myt1), signal transducer and activator of transcription 3 (Stat3), BarH-like homeobox 1 (Barhl1), thymocyte selection-related high-mobility group box (Tox), Prospero homeobox 1 (Prox1), nuclear factor IA (Nfia), thyroid hormone receptor β (Thrb), MYCL proto-oncogene BHLH transcription factor (Mycl1), lysine demethylase 5A (Kdm5a), CAMP response element binding protein 3-like 4 (Creb3I4), ET S variant 1 (Etv1), paternally expressed 3 (Peg3), BTB domain and CNC homolog 2 (Bach2), ISLLIM homeobox 1 (Isl1), zinc finger and BTB domain-containing 38 (Zbtb38), limb bud and heart development (Lbh), Tubby bipartite transcription factor (Tub), ubiquitin C (Hmg20), RE1 silencing transcription factor (Rest), zinc finger protein 827 (Zfp827), AF4 / FMR2 family member 3 (Aff3), PBX / knotted 1 homeobox 2 (Pknox2), AT-rich interactors domain 3B (Arid3b), MLX interacting protein (Mlxip), zinc finger protein (Zfp532), IKAROS family zinc finger 2 (Ikzf2), Sal-like transcription factor 1 (Sall1), SIX homeobox 2 (Six2), Sal-like transcription factor 3 (Sall3), Lin-28 homolog B (Lin28b), regulatory factor X7 (Rfx7), brain-derived neurotrophic factor (Bdnf), growth factor-independent 1 transcriptional repressor (Gfi1), POU4-like homeobox 3 (Pou4f3), MYC proto-oncogene BHLH transcription factor (Myc), β-catenin (Ctnnb1), SRY box 2 (Sox2), SRY box 4 (Sox4), SRY box 11 (Sox11), TEA domain transcription factor 2 (Tead2), aregulated BHLH transcription factor 1 (Atoh1), and Atoh1 variants containing substitutions at amino acids 328, 331 and / or 334 (e.g., S328A, S331A, S334A, S328A / S331A, S328A / S334A, S331A / S334A, and S328A / S331A / S334). The polynucleotides described herein (e.g., SLC6A14 promoter) can also be used to express short interfering RNA (siRNA), antisense oligonucleotides (ASO), nucleases (e.g., CRISPR-associated protein 9 (Cas9), transcription activator-like effector nucleases (TALENs), zinc finger nucleases (ZFNs), or guide RNAs (gRNAs)) or microRNAs in VSCs.

[0111] In some embodiments, the protein expressed in VSCs using the compositions and methods described herein is Atoh1. The SLC6A14 promoter (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) with any of the sequences listed in Table 2 (e.g., a polynucleotide of any of SEQ ID NOs: 1-6)) is operably linked to a polynucleotide sequence encoding a wild-type Atoh1 or a variant thereof, such as a polynucleotide sequence encoding a protein having at least 85% sequence identity (e.g., 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) with the amino acid sequence of wild-type mammalian (e.g., human or mouse) Atoh1 (e.g., SEQ ID NO: 10 or SEQ ID NO: 12). Exemplary Atohl amino acid and polynucleotide sequences are listed in Table 3 below.

[0112] In some embodiments, the polynucleotide sequence encoding the Atoh1 protein encodes an amino acid sequence containing one or more conservative amino acid substitutions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more conservative amino acid substitutions) relative to SEQ ID NO: 10, provided that the encoded Atoh1 analog retains the therapeutic function of wild-type Atoh1 (e.g., the ability to promote hair cell development). No more than 10% of the amino acids in the Atoh1 protein may be replaced by conservative amino acid substitutions. In some embodiments, the polynucleotide sequence encoding Atoh1 is any polynucleotide sequence encoding SEQ ID NO: 10 due to the redundancy of the genetic code. The polynucleotide sequence encoding Atoh1 may be partially or completely codon-optimized for expression (e.g., in human VSCs). Atoh1 may be encoded by a polynucleotide having a sequence of SEQ ID NO: 11. The Atoh1 protein may be a human Atoh1 protein or may be a homolog of a human Atoh1 protein from another mammalian species, such as mouse, rat, cow, horse, goat, sheep, donkey, cat, dog, rabbit, guinea pig or other mammal.

[0113] Table 3: Atoh1 sequences

[0114]

[0115]

[0116]

[0117] Polynucleotide encoding target protein

[0118] A platform that can be used to achieve therapeutically effective intracellular concentrations of target proteins in mammalian cells is via stable expression of genes encoding target proteins (e.g., by integration into the nuclear or mitochondrial genome of mammalian cells, or by forming free concatemers in the nucleus of mammalian cells). The gene is a polynucleotide encoding the primary amino acid sequence of the corresponding protein. To introduce exogenous genes into mammalian cells, the gene can be incorporated into a vector. The vector can be introduced into cells by a variety of methods, including transformation, transfection, transduction, direct uptake, projectile bombardment, and by encapsulating the vector in liposomes. Examples of suitable methods for transfecting or transforming cells include calcium phosphate precipitation, electroporation, microinjection, infection, lipofection, and direct uptake. Such methods are described in more detail in, for example, Green et al., Molecular Cloning: A Laboratory Manual, Fourth Edition (Cold Spring Harbor University Press, New York 2014); and Ausubel et al., Current Protocols in Molecular Biology (John Wiley & Sons, New York 2015), the disclosures of each of the documents are incorporated herein by reference.

[0119] The target protein can also be introduced into mammalian cells by targeting a vector containing a gene encoding the target protein to cell membrane phospholipids. For example, the vector can be targeted to phospholipids on the extracellular surface of the cell membrane by linking the vector molecule to the VSV-G protein, a viral protein with affinity for all cell membrane phospholipids. Such constructs can be generated using methods well known to those skilled in the art.

[0120] Recognition and binding of a polynucleotide encoding a target protein by a mammalian RNA polymerase is essential for gene expression. Therefore, sequence elements that exhibit high affinity for transcription factors that recruit RNA polymerase and promote the assembly of transcription complexes at transcription start sites can be included in the polynucleotide. Such sequence elements include, for example, mammalian promoters, whose sequences can be recognized and bound by specific transcription initiation factors and final RNA polymerases. Examples of mammalian promoters have been described in Smith et al., Mol. Sys. Biol., 3: 73, published online, the disclosure of which is incorporated herein by reference. The promoter used in the methods and compositions described herein is the SLC6A14 promoter (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) with any of the polynucleotide sequences listed in Table 2 (e.g., a polynucleotide of any of SEQ ID NOs: 1-6).

[0121] Once the polynucleotide encoding the target protein is incorporated into the nuclear DNA of the mammalian cell, the transcription of this polynucleotide can be induced immediately by methods known in the art. For example, expression can be induced by exposing the mammalian cell to external chemical reagents (such as agents that regulate the combination of transcription factors and / or RNA polymerases with mammalian promoters and thus regulate gene expression). Chemical reagents can be used to promote the combination of RNA polymerases and / or transcription factors with mammalian promoters, such as by removing inhibitory proteins that have been combined with promoters. Alternatively, chemical reagents can be used to enhance the affinity of mammalian promoters to RNA polymerases and / or transcription factors, so that the transcription rate of genes located downstream of the promoter increases in the presence of chemical reagents. Examples of chemical reagents that strengthen the transcription of polynucleotides by the above-mentioned mechanism include tetracycline and doxycycline. These reagents are available (Life Technologies, Carlsbad, CA) and can be applied to mammalian cells according to the established scheme to promote gene expression.

[0122] Other DNA sequence elements that may be included in the polynucleotides used in the compositions and methods described herein include enhancer sequences. Enhancers represent another type of regulatory element that induces conformational changes in the polynucleotides containing the target gene, so that the DNA takes a three-dimensional orientation that is conducive to the binding of transcription factors and RNA polymerases at the transcription start site. Therefore, the polynucleotides used in the compositions and methods described herein include those polynucleotides that encode the target protein and additionally include mammalian enhancer sequences. Many enhancer sequences are now known from mammalian genes, and examples include enhancers from genes encoding mammalian globin, elastase, albumin, α-fetoprotein, and insulin. Enhancers used in the compositions and methods described herein also include those derived from the genetic material of viruses that can infect eukaryotic cells. Examples include SV40 enhancers, cytomegalovirus early promoter enhancers, polyoma enhancers, and adenovirus enhancers on the rear side of the replication origin (bp 100-270). Other enhancer sequences that induce transcriptional activation of eukaryotic genes include CMV enhancers and RSV enhancers. The enhancer can be spliced ​​into the vector containing the polynucleotide encoding the target protein, for example at a position 5' or 3' to the gene. In a preferred orientation, the enhancer is located 5' to the promoter, which in turn is located 5' relative to the polynucleotide encoding the target protein.

[0123] The nucleic acid vectors described herein containing the SLC6A14 promoter may include a woodchuck post-transcriptional regulatory element (WPRE). The WPRE acts at the mRNA level by promoting nuclear export of transcripts and / or by increasing the efficiency of polyadenylation of nascent transcripts, thereby increasing the total amount of mRNA in the cell. Adding the WPRE to the vector can substantially improve the level of transgene expression from several different promoters in vitro and in vivo. In some embodiments of the compositions and methods described herein, the WPRE has the following sequence:

[0124] GATCCAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAATCATCGTCCTTTCCTTGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGA(SEQ ID NO:14).

[0125] In other embodiments, the WPRE has the following sequence:

[0126] AATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTAGTTCTTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGG CTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTTTTGTGAAATTTGGTGATGCTATTGCTTTATTTGTAACCATCTAGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGATGTGGGAGGTTTTTTAAA(SEQ ID NO:15)

[0127] In some embodiments, the nucleic acid vector containing the SLC6A14 promoter described herein includes a reporter gene sequence that can be used to verify the expression of a gene operably linked to the SLC6A14 promoter in the VSC. The reporter gene sequence that can be provided in the transgene includes DNA sequences encoding β-lactamase, β-galactosidase (LacZ), alkaline phosphatase, thymidine kinase, green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), luciferase, and other proteins known in the art. When associated with a regulatory element that drives its expression (e.g., the SLC6A14 promoter), the reporter gene sequence provides a signal that can be detected by conventional methods, including enzymatic, radiographic, colorimetric, fluorescent or other spectroscopic assays, fluorescence-activated cell sorting assays, and immunoassays, including enzyme-linked immunosorbent assays (ELISA), radioimmunoassays (RIA), and immunohistochemistry. For example, when the marker sequence is the LacZ gene, the presence of the vector carrying the signal is detected by measuring β-galactosidase activity. When the transgene is green fluorescent protein or luciferase, the vector carrying the signal can be measured visually by color or light production in a luminometer.

[0128] Transfer plasmids that can be used to produce nucleic acid vectors (e.g., AAV vectors) for use in the compositions and methods described herein are provided in Table 4. Transfer plasmids (e.g., plasmids containing DNA sequences to be delivered by nucleic acid vectors, e.g., to be delivered by AAV) can be co-delivered to production cells with helper plasmids (e.g., plasmids that provide proteins required for AAV production) and rep / cap plasmids (e.g., plasmids that provide AAV capsid proteins and proteins that insert transfer plasmid DNA sequences into the capsid shell) to produce nucleic acid vectors (e.g., AAV vectors) for administration. Transfer plasmids provided in Table 4 can be used to produce nucleic acid vectors (e.g., AAV vectors) containing a SLC6A14 promoter operably linked to a transgene (e.g., a polynucleotide encoding Atoh1 or a polynucleotide encoding GFP).

[0129] Table 4: Transfer plasmids

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145]

[0146] Methods for delivering exogenous nucleic acids to target cells

[0147] Techniques that can be used to introduce a transgene (e.g., a transgene operably linked to the SLC6A14 promoter described herein) into a target cell (e.g., a mammalian cell) are well known in the art. For example, electroporation can be used to permeabilize mammalian cells by applying an electrostatic potential to the target cell (e.g., a human target cell). Mammalian cells (e.g., human cells) subjected to an external electric field in this manner are subsequently susceptible to uptake of exogenous nucleic acids. Electroporation of mammalian cells is described in detail, for example, in Chu et al., Nucleic Acids Research 15:1311 (1987), the disclosure of which is incorporated herein by reference. Similar techniques Nucleofection TM The use of an applied electric field to stimulate the uptake of exogenous polynucleotides into the nucleus of eukaryotic cells. TM and protocols that can be used to perform this technique are described in detail in, for example, Distler et al., Experimental Dermatology 14:315 (2005) and US 2010 / 0317114, the disclosures of each of which are incorporated herein by reference.

[0148] Other techniques that can be used to transfect target cells include extrusion-perforation methods. This technique induces rapid mechanical deformation of cells to stimulate the uptake of exogenous DNA through membrane pores formed in response to applied stress. The advantage of this technique is that a vector is not necessary to deliver nucleic acids to cells (e.g., human target cells). Extrusion-perforation is described in detail in, for example, Sharei et al., Journal of Visualized Experiments 81: e50980 (2013), the disclosure of which is incorporated herein by reference.

[0149] Lipofection represents another technique that can be used to transfect target cells. This method involves loading nucleic acids into liposomes, which generally present cationic functional groups, such as quaternary amines or protonated amines, toward the outside of the liposomes. This promotes electrostatic interactions between liposomes and cells due to the anionic nature of the cell membrane, and ultimately, for example, by guiding the liposomes to fuse with the cell membrane or by endocytosis of the complex to take up exogenous nucleic acids. Lipofection is described in detail in, for example, U.S. Patent No. 7,442,386, the disclosure of which is incorporated herein by reference. Similar techniques that utilize ionic interactions with cell membranes to cause exogenous nucleic acid uptake include contacting cells with cationic polymer-nucleic acid complexes. Exemplary cationic molecules that associate with polynucleotides to impart a positive charge that facilitates interaction with cell membranes include activated dendrimers (described, e.g., in Dennig, Topics in Current Chemistry 228:227 (2003), the disclosure of which is incorporated herein by reference), polyethyleneimine, and diethylaminoethyl (DEAE)-polydextrose, the use of which as transfection agents is described in detail, e.g., in Gulick et al., Current Protocols in Molecular Biology 40:1:9.2:9.2.1 (1997), the disclosure of which is incorporated herein by reference. Magnetic beads are another tool that can be used to transfect target cells in a gentle and efficient manner because this method utilizes an applied magnetic field to direct the uptake of nucleic acids. This technology is described in detail, e.g., in US 2010 / 0227406, the disclosure of which is incorporated herein by reference.

[0150] Another tool that can be used to induce uptake of exogenous nucleic acids by target cells is laser transfection, also known as optical transfection, which is a technique that involves exposing cells to electromagnetic radiation of a specific wavelength to gently permeabilize the cells and allow polynucleotides to penetrate the cell membrane. The biological activity of this technique is similar to, and in some cases has been found to be superior to, electroporation.

[0151] Piercing transfection is another technique that can be used to deliver genetic material to target cells. It relies on the use of nanomaterials (e.g., carbon nanofibers, carbon nanotubes, and nanowires). Needle-like nanostructures are synthesized perpendicular to the surface of the substrate. DNA containing genes intended for intracellular delivery is attached to the nanostructure surface. The chip with the array of these needles is then pressed onto cells or tissues. Cells pierced by the nanostructure can express the delivered genes. Examples of this technology are described in Shalek et al., PNAS 107: 1870 (2010), the disclosure of which is incorporated herein by reference.

[0152] Magnetic transfection can also be used to deliver nucleic acids to target cells. The principle of magnetic transfection is to associate nucleic acids with cationic magnetic nanoparticles. Magnetic nanoparticles are made of completely biodegradable iron oxide and coated with specific cationic proprietary molecules that vary according to the application. Its association with gene vectors (DNA, siRNA, viral vectors, etc.) is achieved through salt-induced colloidal aggregation and electrostatic interactions. The magnetic particles are then concentrated on the target cells by affecting the external magnetic field generated by the magnet. This technology is described in detail in Scherer et al., Gene Therapy 9:102 (2002), the disclosure of which is incorporated herein by reference.

[0153] Another tool that can be used to induce uptake of exogenous nucleic acids by target cells is sonoporation, which is a technique involving the use of sound (usually ultrasonic frequencies) to change the permeability of the cytoplasmic membrane to permeabilize the cell and allow polynucleotides to penetrate the cell membrane. This technique is described in detail in, for example, Rhodes et al., Methods in Cell Biology 82:309 (2007), the disclosure of which is incorporated herein by reference.

[0154] Microvesicles represent another potential medium that can be used to modify the genome of target cells according to the methods described herein. For example, microvesicles induced by co-overexpression of glycoprotein VSV-G and, for example, genome modification proteins (such as nucleases) can be used to effectively deliver proteins to cells, and then catalyze the site-specific cleavage of endogenous polynucleotide sequences to prepare the genome of cells for covalent incorporation into target polynucleotides (such as genes or regulatory sequences). Such vesicles (also referred to as nanovesicles (Gesicles)) are used for the genetic modification of eukaryotic cells. For example, Quinn et al., Genetic Modification of Target Cells by Direct Delivery of Active Protein [Abstract]. Methylation changes in early embryonic genes in cancer [Abstract], Proceedings of the 18th Annual Meeting of the American Society of Gene and Cell Therapy; May 13, 2015, Abstract No. 122.

[0155] Vectors for delivering exogenous nucleic acids to target cells

[0156] In addition to achieving high transcription and translation rates, stable expression of exogenous genes in mammalian cells can be achieved by integrating the polynucleotide containing the gene into the nuclear genome of the mammalian cell. A variety of vectors have been developed to deliver and integrate polynucleotides encoding exogenous proteins into the nuclear DNA of mammalian cells. Examples of expression vectors are described in, for example, Gellissen, Production of Recombinant Proteins: Novel Microbial and Eukaryotic Expression Systems (John Wiley & Sons, Marblehead, MA, 2006). The expression vectors used in the compositions and methods described herein contain an SLC6A14 promoter operably linked to a polynucleotide sequence encoding a target protein (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to any of the polynucleotide sequences shown in Table 2), and other sequence elements, such as for expressing these agents and / or integrating these polynucleotide sequences into the genome of mammalian cells. Vectors that may contain an SLC6A14 promoter operably linked to a transgene encoding a target protein include plasmids (e.g., circular DNA molecules that can replicate autonomously in cells), cosmids (e.g., pWE or sCos vectors), artificial chromosomes (e.g., human artificial chromosomes (HACs), yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs)), and viral vectors. Some vectors that can be used to express the target protein include plasmids containing regulatory sequences (e.g., enhancer regions) that guide gene transcription. Other vectors that can be used to express the target protein contain polynucleotide sequences that enhance the translation rate of these genes or improve the stability or nuclear export of mRNA derived from gene transcription. These sequence elements include, for example, 5' and 3' untranslated regions, internal ribosome entry sites (IRES), and polyadenylation signal sites that guide the effective transcription of genes carried on the expression vector. Expression vectors suitable for compositions and methods described herein may also contain polynucleotides encoding markers for selecting cells containing such vectors. Examples of suitable markers include genes encoding antibiotic resistance (e.g., ampicillin, chloramphenicol, kanamycin, or nourseothricin).

[0157] Viral vectors for nucleic acid delivery

[0158] Viral genomes provide a rich source of vectors that can be used to efficiently deliver target genes to the genome of target cells (e.g., mammalian cells, such as human cells). Viral genomes are particularly useful vectors for gene delivery because the polynucleotides contained within such genomes are typically incorporated into the nuclear genome of mammalian cells by general or specialized transduction. These processes occur as part of the natural viral replication cycle and do not require the addition of proteins or reagents to induce gene integration. Examples of viral vectors include retroviruses (e.g., Retroviridae virus vectors), adenoviruses (e.g., Ad5, Ad26, Ad34, Ad35, and Ad48), parvoviruses (e.g., adeno-associated viruses), coronaviruses, negative-strand RNA viruses such as orthomyxoviruses (e.g., influenza virus), rhabdoviruses (e.g., rabies and vesicular stomatitis virus), paramyxoviruses (e.g., measles and Sendai virus), positive-strand RNA viruses such as picornaviruses and alphaviruses, and double-stranded DNA viruses, including adenoviruses, herpesviruses (e.g., herpes simplex virus type 1 and type 2, Epstein-Barr virus, cytomegalovirus), and poxviruses (e.g., vaccinia, modified vaccinia Ankara (MVA), fowlpox, and canarypox). Other viruses include, for example, Norwalk virus, togavirus, flavivirus, reovirus, papovavirus, hepadnavirus, human papillomavirus, human foamy virus, and hepatitis virus. Examples of retroviruses include: avian leukemia-sarcoma, avian C virus, mammalian C, B virus, D virus, oncorretrovirus, HTLV-BLV family, lentivirus, alpharetrovirus, gammaretrovirus, foamy virus (Coffin, JM, Retroviridae: The viruses and their replication, Virology, 3rd edition (Lippincott-Raven, Philadelphia, 1996)). Other examples include murine leukemia virus, murine sarcoma virus, mouse mammary tumor virus, bovine leukemia virus, feline leukemia virus, feline sarcoma virus, avian leukemia virus, human T-cell leukemia virus, baboon endogenous virus, gibbon ape leukemia virus, Mason Pfizer monkey virus, simian immunodeficiency virus, simian sarcoma virus, Rous sarcoma virus, and lentivirus. Other examples of vectors are described, for example, in U.S. Pat. No. 5,801,030, which is incorporated herein by reference for its disclosure of viral vectors for use in gene therapy.

[0159] AAV vectors for nucleic acid delivery

[0160] In some embodiments, the polynucleotides of the compositions and methods described herein are incorporated into rAAV vectors and / or viral particles to facilitate their introduction into cells (e.g., VSCs). The rAAV vectors that can be used in the compositions and methods described herein are recombinant nucleic acid constructs that include (1) the SLC6A14 promoter described herein (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) with any of the polynucleotide sequences listed in Table 2 (e.g., a polynucleotide of any of SEQ ID NOs: 1-6), (2) a heterologous sequence to be expressed, and (3) a viral sequence that promotes stability and expression of the heterologous gene. The viral sequence may include those AAV sequences required for DNA cis-replication and packaging (e.g., functional ITRs) into viral particles. In typical applications, the transgene encodes a protein that promotes or increases vestibular hair cell development, vestibular hair cell fate specification, vestibular hair cell regeneration, vestibular hair cell and / or VSC proliferation, vestibular hair cell innervation or vestibular hair cell maturation, or a wild-type form of a vestibular hair cell protein that is mutated in subjects with various forms of hereditary vestibular dysfunction, which can be used to improve vestibular function in subjects carrying mutations associated with vestibular dysfunction (e.g., dizziness, vertigo, imbalance, bilateral vestibulopathy, bilateral vestibular hypofunction, oscillopsia or balance disorders). Such rAAV vectors may also contain markers or reporter genes. Useful rAAV vectors have one or more AAV WT genes that are deleted in whole or in part, but retain functional flanking ITR sequences. AAV ITRs may have any serotype suitable for a particular application. For use in the methods and compositions described herein, the ITRs may be AAV2 ITRs. Methods for using rAAV vectors are described in, for example, Tal et al., J. Biomed. Sci. 7:279 (2000) and Monahan and Samulski, Gene Delivery 7:24 (2000), each of which is incorporated herein by reference for its disclosure of AAV vectors for gene delivery.

[0161] The polynucleotides and vectors described herein (e.g., an SLC6A14 promoter operably linked to a transgene encoding a protein of interest) can be incorporated into rAAV virions to facilitate the introduction of the polynucleotide or vector into cells (e.g., VSCs). The capsid protein of AAV constitutes the outer, non-nucleic acid portion of the virion and is encoded by the AAV cap gene. The cap gene encodes three viral coat proteins, VP1, VP2, and VP3, which are essential for the assembly of virions. The construction of rAAV virions has been described, for example, in US 5,173,414; US 5,139,941; US ​​5,863,541; US ​​5,869,305; US 6,057,152; and US 6,376,237; and in Rabinowitz et al., J. Virol. 76:791 (2002) and Bowles et al., J. Virol. 77:423 (2003), each of which is incorporated herein by reference for its disclosure of AAV vectors for gene delivery.

[0162] The rAAV virions that can be used in combination with the compositions and methods described herein include those derived from a variety of AAV serotypes, including AAV 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eB and PHP.S. For targeting VSC, AAV1, AAV2, AAV2quad (YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, Anc80, Anc80L65, 7m8, PHP.B, PHP.eB or PHP.S serotypes may be particularly useful. Serotypes that have evolved for transducing the retina can also be used in the methods and compositions described herein. The construction and use of AAV vectors of different serotypes and AAV proteins are described, for example, in Chao et al., Mol. Ther. 2:619 (2000); Davidson et al., Proc. Natl. Acad. Sci. USA 97:3428 (2000); Xiao et al., J. Virol. 72:2224 (1998); Halbert et al., J. Virol. 74:1524 (2000); Halbert et al., J. Virol. 75:6615 (2001); and Auricchio et al., Hum. Molec. Genet. 10:3075 (2001), each of which is incorporated herein by reference for its disclosure of AAV vectors for gene delivery.

[0163] Pseudotyped rAAV vectors can also be used in combination with the compositions and methods described herein. Pseudotyped vectors include AAV vectors of a given serotype (e.g., AAV9) pseudotyped with a capsid gene derived from a serotype other than a given serotype (e.g., AAV1, AAV2, AAV2quad (YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, etc.). The construction and use of pseudotyped rAAV virions are known in the art and described in, for example, Duan et al., J. Virol. 75: 7662 (2001); Halbert et al., J. Virol. 74: 1524 (2000); Zolotukhin et al., Methods, 28: 158 (2002); and Auricchio et al., Hum. Molec. Genet. 10: 3075 (2001).

[0164] AAV virions with mutations in the virion capsid can be used to infect specific cell types more efficiently than non-mutated capsid virions. For example, suitable AAV mutants may have ligand insertion mutations that help AAV target specific cell types. The construction and characterization of AAV capsid mutants (including insertion mutants, alanine screening mutants, and epitope tag mutants) are described in Wu et al., J. Virol. 74: 8635 (2000). Other rAAV virions that can be used in the methods described herein include those capsid hybrids produced by molecular breeding of viruses and by exon shuffling. See, for example, Soong et al., Nat. Genet., 25: 436 (2000) and Kolman and Stemmer, Nat. Biotechnol. 19: 423 (2001).

[0165] In some embodiments, the nucleic acid vector (e.g., an AAV vector) includes the SLC6A14 promoter described herein (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to any of the polynucleotide sequences listed in Table 2 (e.g., a polynucleotide of any of SEQ ID NOs: 1-6)), which is operably linked to a polynucleotide sequence encoding human Atoh1 (human ATOH1 protein = RefSeq Accession No. NP_005163 (SEQ ID NO: 10); mRNA sequence = RefSeq Accession No. NM_005172). In some embodiments, the SLC6A14 promoter is the SLC6A14 promoter of SEQ ID NO:4 (also represented by nucleotides 233-1066 of SEQ ID NO:7) and is operably linked to a polynucleotide sequence encoding human Atoh1. In some embodiments, the polynucleotide sequence encoding human Atoh1 is SEQ ID NO:11. In some embodiments, the polynucleotide sequence encoding human Atoh1 is nucleotides 1083-2144 of SEQ ID NO:7. In some embodiments, the polynucleotide sequence encoding human Atoh1 is any polynucleotide sequence encoding SEQ ID NO:10 due to the redundancy of the genetic code. The polynucleotide sequence encoding human Atoh1 may be partially or completely codon optimized for expression. In some embodiments, the vector includes, in 5' to 3' order, a first inverted terminal repeat; a SLC6A14 promoter of SEQ ID NO:4; a polynucleotide sequence encoding human Atoh1 operably linked to a SLC6A14 promoter; a polyadenylation sequence; and a second inverted terminal repeat. In some embodiments, the nucleic acid vector comprises, in 5' to 3' order, a first inverted terminal repeat; a SLC6A14 promoter of SEQ ID NO:4; a polynucleotide sequence encoding human Atoh1 operably linked to the SLC6A14 promoter; a woodchuck post-transcriptional regulatory element (WPRE); a polyadenylation sequence; and a second inverted terminal repeat. In some embodiments, the WPRE has a sequence of SEQ ID NO:14 or SEQ ID NO:15. In some embodiments, the WPRE has a sequence of SEQ ID NO:14. In some embodiments, the WPRE has a sequence of nucleotides 2155-2702 of SEQ ID NO:7. In some embodiments, the polyadenylation sequence has a sequence of nucleotides 2715-2922 of SEQ ID NO:7. In certain embodiments, the nucleic acid vector comprises nucleotides 233-2922 of SEQ ID NO:7 flanked by inverted terminal repeats.In some embodiments, the flanking inverted terminal repeats are AAV2 inverted terminal repeats. In some embodiments, the flanking inverted terminal repeats are any variants of the AAV2 inverted terminal repeats that can be encapsidated by a plasmid carrying the AAV2 Rep gene. In a specific embodiment, the nucleic acid vector includes nucleotides 233-2922 of SEQ ID NO:7 flanked by inverted terminal repeats, wherein the 5' inverted terminal repeat has at least 80% sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity) with nucleotides 1-130 of SEQ ID NO:7; and wherein the 3' inverted terminal repeat is identical to SEQ ID NO:7. IDNO: 7 nucleotides 3010-3139 have at least 80% sequence identity (e.g., at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity). In some embodiments, the nucleic acid vector is a viral vector. In some embodiments, the viral vector is an AAV vector. In some embodiments, the AAV vector has an AAV8 capsid.

[0166] It will be understood by one of ordinary skill in the art that production of the viral vectors of the invention generally requires the use of the plasmids of the invention and additional plasmids that provide the elements required for suitable viral packaging and viability (e.g., for AAV, plasmids that provide the appropriate AAV rep gene, cap gene, and other genes (e.g., E2A and E4)). The combination of those plasmids in the production cell line produces the viral vector. However, it will be understood by one of ordinary skill in the art that for any given pair of inverted terminal repeat sequences (e.g., SEQ ID NO: 7, 8, or 9) in a transfer plasmid of the invention used to produce a viral vector, the corresponding sequence in the viral vector may be altered due to the ITRs adopting a "flipped" or "inverted" orientation during recombination. Thus, the sequence of the ITRs in the transfer plasmid is not necessarily the same sequence found in the viral vector prepared therefrom. However, in some very specific embodiments, the viral vectors of the invention include nucleotides 1-3139 of SEQ ID NO: 7.

[0167] Pharmaceutical composition

[0168] The polynucleotides described herein (e.g., a SLC6A14 promoter having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to any of the polynucleotide sequences listed in Table 2 (e.g., a polynucleotide of any of SEQ ID NOs: 1-6)) can be operably linked to a transgene (e.g., a transgene encoding a target protein, siRNA, ASO, or nuclease (e.g., Cas9, TALEN, ZFN, or gRNA), or a transgene that is a microRNA) and incorporated into a vehicle for administration to a patient, e.g., a human patient with vestibular dysfunction. Pharmaceutical compositions containing a vector (e.g., a viral vector) containing a polynucleotide described herein operably linked to a transgene can be prepared using methods known in the art. For example, such compositions can be prepared using, for example, physiologically acceptable carriers, excipients or stabilizers (Remington: The Science and Practice of Pharmacology, 22nd ed., Allen, L. ed., (2013); incorporated herein by reference) and in a desired form, such as in the form of a lyophilized formulation or an aqueous solution.

[0169] Mixtures of nucleic acid vectors (e.g., viral vectors) containing a SLC6A14 promoter described herein (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to any of the nucleic acid sequences listed in Table 2 (e.g., a polynucleotide of any of SEQ ID NOs: 1-6) operably linked to a transgene can be prepared in water suitably mixed with one or more excipients, carriers, or diluents. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils. Under ordinary conditions of storage and use, these preparations may contain a preservative to prevent the growth of microorganisms. The pharmaceutical form suitable for injectable use includes sterile aqueous solutions or dispersions and sterile powders for the temporary preparation of sterile injectable solutions or dispersions (described in US 5,466,468, the disclosure of which is incorporated herein by reference). In any case, the preparation can be sterile and can be a fluid that is easy to inject. The preparation can be stable under manufacturing and storage conditions and can prevent the contamination of microorganisms (such as bacteria and fungi). The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (such as glycerol, propylene glycol and liquid polyethylene glycol, etc.), suitable mixtures thereof and / or vegetable oils. Suitable fluidity can be maintained, for example, by using a coating (such as lecithin), by maintaining the desired particle size in the case of a dispersion, and by using a surfactant. The action of microorganisms can be prevented by a variety of antibacterial and antifungal agents (such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc.). In many cases, isotonic agents, such as sugars or sodium chloride, should preferably be included. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0170] For example, if necessary, a solution containing a pharmaceutical composition described herein can be appropriately buffered, and the liquid diluent can be first made isotonic with sufficient saline or glucose. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this regard, according to the present disclosure, the sterile aqueous medium that can be adopted will be known to those skilled in the art. For example, a dose can be dissolved in 1ml NaCl isotonic solution and added to 1000ml subcutaneous perfusion solution or injected at the proposed infusion site. Depending on the disease of the subject being treated, the dose will inevitably change. For local application to the middle ear or inner ear, the composition can be formulated to contain a synthetic perilymph solution. Exemplary synthetic perilymph solutions include 20-200mM NaCl, 1-5mM KCl, 0.1-10mM CaCl2, 1-10mM glucose and 2-50mM HEPE, wherein the pH is between about 6 and 9 and the molar osmotic pressure concentration is about 300mOsm / kg. The person responsible for administration will determine the appropriate dose for the individual subject in any case. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biologics standards.

[0171] Treatment

[0172] The compositions described herein can be administered to subjects suffering from or at risk of suffering from vestibular dysfunction by a variety of routes, such as topical administration to the middle ear or inner ear (e.g., administration to the perilymph or endolymph, such as via the oval window, round window, or semicircular canal (e.g., the external semicircular canal), or by transtympanic or intratympanic injection, such as administration to vestibular supporting cells or hair cells), intravenous, parenteral, intradermal, transdermal, intramuscular, intranasal, subcutaneous, transdermal, intratracheal, intraperitoneal, intraarterial, intravascular, inhalation, perfusion, lavage, and oral administration. The route of administration most suitable in any given case will depend on the specific composition being administered, the patient, the method of drug formulation, the method of administration (e.g., time of administration and route of administration), the patient's age, weight, sex, severity of the disease being treated, the patient's diet, and the patient's excretion rate. The composition can be administered once or more than once (e.g., once a year, twice a year, three times a year, every two months, every month, or every two weeks).

[0173] Subjects that can be treated as described herein are subjects suffering from vestibular dysfunction or at risk of developing vestibular dysfunction. The compositions and methods described herein can be used to treat subjects suffering from vestibular hair cell damage (e.g., damage associated with disease or infection, head trauma, ototoxic drugs (e.g., aminoglycosides), or aging) or at risk of developing the disease, subjects suffering from vestibular dysfunction (e.g., dizziness, vertigo, imbalance, bilateral vestibulopathy, bilateral vestibular hypofunction, oscillopsia, or balance disorders) or at risk of developing the disease, subjects carrying genetic mutations associated with vestibular dysfunction, or subjects with a family history of hereditary vestibular dysfunction. In some embodiments, the disease associated with hair cell (e.g., vestibular hair cell) damage or loss is an autoimmune disease or disorder in which an autoimmune response leads to hair cell damage or death. Autoimmune diseases associated with vestibular dysfunction include autoimmune inner ear disease (AIED), polyarteritis nodosa (PAN), Cogan's syndrome, relapsing polychondritis, systemic lupus erythematosus (SLE), Wegener's granulomatosis, Sjögren's syndrome, and syndrome) and Behcet's disease disease). Some infectious diseases (e.g., Lyme disease and syphilis) can also cause vestibular dysfunction (e.g., by triggering the production of autoantibodies). Viral infections (e.g., rubella, cytomegalovirus (CMV), lymphocytic choriomeningitis virus (LCMV), HSV type 1 and type 2, West Nile virus (WNV), human immunodeficiency virus (HIV), varicella zoster virus (VZV), measles and mumps) can also cause vestibular dysfunction. In some embodiments, the subject suffers from vestibular dysfunction associated with or derived from the loss of hair cells (e.g., vestibular hair cells). In some embodiments, the compositions and methods described herein can be used to treat subjects suffering from oscillopsia or at risk of suffering from oscillopsia. In some embodiments, the compositions and methods described herein can be used to treat subjects suffering from bilateral vestibular disease or at risk of suffering from bilateral vestibular disease. In some embodiments, the compositions and methods described herein can be used to treat subjects suffering from balance disorders (e.g., imbalance) or at risk of suffering from balance disorders (e.g., imbalance). The methods described herein may include the step of screening one or more mutations of genes known to be associated with vestibular dysfunction in a subject before treating with a composition as described herein or applying a composition as described herein. The genetic mutations of the subject can be screened using standard methods known to those skilled in the art (e.g., genetic testing). The methods described herein may also include the step of evaluating the vestibular function of the subject before treating with a composition as described herein or before applying a composition as described herein. Vestibular function can be evaluated using, for example, the following standard tests: eye movement tests (e.g., nystagmus graph (ENG) or video nystagmus graph (VNG)), vestibular-ocular reflex (VOR) tests (e.g., head impact tests (Halmagyi-Curthoys test) that can be implemented at the bedside or using video head impact tests (VHIT) or heat reflex tests), somatotypes, swivel chair tests, ECOG, vestibular-induced myogenic potentials (VEMPs) and specialized clinical balance tests, such as those described in Mancini and Horak, Eur J Phys Rehabil Med, 46:239 (2010). These tests can also be used to evaluate the vestibular function of a subject after treatment with or administration of a composition described herein. The compositions and methods described herein can also be administered as a preventive treatment to patients at risk of developing vestibular dysfunction, such as patients with a family history of vestibular dysfunction (e.g., hereditary vestibular dysfunction), patients who carry a genetic mutation associated with vestibular dysfunction who have not yet shown symptoms of vestibular dysfunction, or patients exposed to risk factors for acquired vestibular dysfunction (e.g., disease or infection, head trauma, ototoxic drugs, or aging).

[0174] The compositions and methods described herein can be used to induce or increase hair cell regeneration (e.g., vestibular hair cell regeneration) in a subject and / or induce or increase the proliferation of vestibular hair cells and / or VSCs. Subjects that can benefit from compositions that promote or induce vestibular hair cell regeneration, vestibular hair cell innervation, and / or vestibular hair cell and / or VSC proliferation include subjects who suffer from vestibular dysfunction or have a risk of developing vestibular dysfunction due to hair cell loss (e.g., vestibular hair cell loss associated with trauma (e.g., head trauma), disease or infection, ototoxic drugs, or aging), and subjects with abnormal vestibular hair cells (e.g., vestibular hair cells that cannot function properly compared to normal vestibular hair cells), damaged vestibular hair cells (e.g., vestibular hair cell damage associated with trauma (e.g., head trauma), disease or infection, ototoxic drugs, or aging), or vestibular hair cell number reduction due to genetic mutations or congenital abnormalities. The compositions and methods described herein can also be used to promote or increase vestibular hair cell maturation, which can improve vestibular function. In some embodiments, the compositions and methods described herein promote or increase the maturation of regenerated vestibular hair cells (e.g., promote or increase the maturation of vestibular hair cells formed in response to expression of a composition described herein (e.g., a composition containing a SLC6A14 promoter operably linked to a transgene) in VSCs). The compositions and methods described herein may also promote or increase VSC and / or vestibular hair cell survival and / or improve VSC function.

[0175] The compositions and methods described herein can also be used to prevent or alleviate vestibular dysfunction caused by hair cell damage or death (e.g., vestibular hair cell damage or death) induced by ototoxic drugs in subjects who have been treated with ototoxic drugs or are currently being treated with ototoxic drugs or are about to begin treatment with ototoxic drugs. Ototoxic drugs are toxic to inner ear cells and can cause vestibular dysfunction (e.g., vertigo, dizziness, imbalance, bilateral vestibulopathy, bilateral vestibular hypofunction, or oscillopsia). Drugs that have been found to be ototoxic include aminoglycoside antibiotics (e.g., gentamicin, neomycin, streptomycin, tobramycin, kanamycin, vancomycin, and amikacin), viomycins, antineoplastic drugs (e.g., platinum-containing chemotherapeutics, such as cisplatin, carboplatin, and oxaliplatin), loop diuretics (e.g., ethacrynic acid and furosemide), salicylates (e.g., aspirin, particularly at high doses), and quinine. In some embodiments, the methods and compositions described herein can be used to treat bilateral vestibular hypofunction. Bilateral vestibular hypofunction can be induced by aminoglycosides (e.g., in subjects with aminoglycoside-induced bilateral vestibular hypofunction, the methods and compositions described herein can be used to reduce aminoglycoside-induced vestibular hair cell damage or death, or to promote or increase hair cell regeneration and / or hair cell or VSC proliferation).

[0176] A transgene operably linked to a SLC6A14 promoter (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to treat a subject as described herein can be a transgene encoding a protein expressed in healthy VSCs (e.g., a protein that plays a role in vestibular hair cell development, vestibular hair cell fate specification, vestibular hair cell regeneration, vestibular hair cell and / or VSC proliferation, vestibular hair cell maturation, or vestibular hair cell innervation, or a protein that is absent in a subject with vestibular dysfunction), another protein of interest (e.g., a therapeutic protein or a reporter protein, such as a fluorescent protein, lacZ, or luciferase), an siRNA, an ASO, a nuclease, or a microRNA. The transgene can be selected based on the cause of the subject's vestibular dysfunction (e.g., if the subject's vestibular dysfunction is associated with a particular genetic mutation, the transgene can be the wild-type form of the gene that is mutated in the subject, or if the subject has vestibular dysfunction associated with hair cell loss, the transgene can encode a protein that promotes vestibular hair cell regeneration, vestibular hair cell innervation, or vestibular hair cell and / or VSC proliferation), the severity of the subject's vestibular dysfunction, the health of the subject's hair cells, the subject's age, the subject's family history of vestibular dysfunction, or other factors.Proteins that can be expressed by a transgene operably linked to the SLC6A14 promoter to treat a subject as described herein include Sox9, Sall2, Camtal, Hey2, Gata2, Hey1, Lass2, Sox10, Gata3, Cux1, Nr2f1, Hes1, Rorb, Jun, Zfp667, Lhx3, Nhlh1, Mxd4, Zmiz1, Myt1, Stat3, Barhl1, Tox, Prox1, Nfia, Thrb, Mycl1, Kdm5a, Creb314, Etv1, Peg3, Bach2, Isl1, Zbtb38, Lbh, Tub, Hm g20, Rest, Zfp827, Aff3, Pknox2, Arid3b, Mlxip, Zfp532, Ikzf2, Sall1, Six2, Sall3, Lin28b, Rfx7, Bdnf, Gfi1, Pou4f3, Myc, Ctnnb1, Sox2, Sox4, Sox11, Tead2, Atoh1, and Atoh1 variants containing substitutions at amino acids 328, 331, and / or 334 (e.g., S328A, S331A, S334A, S328A / S331A, S328A / S334A, S331A / S334A, and 328A / S331A / S334).

[0177] Treatment may include administering a composition containing a nucleic acid vector (e.g., an AAV viral vector) containing a SLC6A14 promoter described herein (e.g., any one of SEQ ID NOs: 1-6) in different unit doses. Each unit dose will typically contain a predetermined amount of the therapeutic composition. The amount to be administered and the specific route of administration and formulation are within the skill of technicians in the clinical field. The unit dose does not need to be administered as a single injection, but may include continuous infusion over a set time period. Administration can be performed using a syringe pump to control the infusion rate to minimize damage to the inner ear (e.g., vestibular labyrinth). In the case where the nucleic acid vector is an AAV vector (e.g., AAV1, AAV2, AAV2quad (YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eB, or PHP.S vector), the viral vector can be administered to a patient, for example, at the following doses: about 1×10 9 vector genomes (VG) / mL to about 1×10 16 VG / mL (e.g. 1x 10 9 VG / mL, 2x 10 9 VG / mL, 3x 109 VG / mL、4x10 9 VG / mL、5x 10 9 VG / mL、6x 10 9 VG / mL、7x 10 9 VG / mL、8x 10 9 VG / mL、9x 10 9 VG / mL、1x 10 10 VG / mL、2x 10 10 VG / mL、3x10 10 VG / mL、4x 10 10 VG / mL、5x 10 10 VG / mL、6x 10 10 VG / mL、7x 10 10 VG / mL、8x 10 10 VG / mL、9x10 10 VG / mL、1x 10 11 VG / mL、2x 10 11 VG / mL、3x 10 11 VG / mL、4x 10 11 VG / mL、5x 10 11 VG / mL、6x10 11 VG / mL、7x 10 11 VG / mL、8x 10 11 VG / mL、9x 10 11 VG / mL、1x 10 12 VG / mL、2x 10 12 VG / mL、3x10 12 VG / mL、4x 10 12 VG / mL、5x 10 12 VG / mL、6x 10 12 VG / mL、7x 10 12 VG / mL、8x 10 12 VG / mL、9x10 12 VG / mL、1x 10 13 VG / mL、2x 10 13 VG / mL、3x 10 13 VG / mL、4x 10 13 VG / mL、5x 10 13 VG / mL、6x10 13 VG / mL、7x 10 13 VG / mL、8x 10 13 VG / mL、9x 1013 VG / mL, 1x 10 14 VG / mL, 2x 10 14 VG / mL, 3x10 14 VG / mL, 4x 10 14 VG / mL, 5x 10 14 VG / mL, 6x 10 14 VG / mL, 7x 10 14 VG / mL, 8x 10 14 VG / mL, 9x10 14 VG / mL, 1x 10 15 VG / mL, 2x 10 15 VG / mL, 3x 10 15 VG / mL, 4x 10 15 VG / mL, 5x 10 15 VG / mL, 6x10 15 VG / mL, 7x 10 15 VG / mL, 8x 10 15 VG / mL, 9x 10 15 VG / mL or 1x 10 16 VG / mL) in a volume of 1 μL to 200 μL (e.g., 1 μL, 2 μL, 3 μL, 5 μL, 6 μL, 7 μL, 8 μL, 9 μL, 10 μL, 15 μL, 20 μL, 25 μL, 30 μL, 35 μL, 40 μL, 45 μL, 50 μL, 55 μL, 60 μL, 65 μL, 70 μL, 75 μL, 80 μL, 85 μL, 90 μL, 95 μL, 100 μL, 110 μL, 120 μL, 130 μL, 140 μL, 150 μL, 160 μL, 170 μL, 180 μL, 190 μL, or 200 μL). The AAV vector can be administered to a subject at a dose of about 1 x 10 7 VG / ear to about 2x 10 15 VG / ear (e.g., 1x 10 7 VG / ear, 2x 10 7 VG / ear, 3x 10 7 VG / ear, 4x10 7 VG / ear, 5x 10 7 VG / ear, 6x 10 7 VG / ear, 7x 10 7 VG / ear, 8x 10 7 VG / ear, 9x 10 7 VG / ear, 1x10 8 VG / ear, 2x 10 8 VG / ear, 3x 108 VG / ear, 4x 10 8 VG / ear, 5x 10 8 VG / ear, 6x 10 8 VG / ear, 7x 10 8 VG / ear, 8x10 8 VG / ear, 9x 10 8 VG / ear, 1x10 9 VG / ear, 2x 10 9 VG / ear, 3x 10 9 VG / ear, 4x 10 9 VG / ear, 5x 10 9 VG / ear, 6x 10 9 VG / ear, 7x 10 9 VG / ear, 8x 10 9 VG / ear, 9x 10 9 VG / ear, 1x10 10 VG / ear, 2x 10 10 VG / ear, 3x10 10 VG / ear, 4x 10 10 VG / ear, 5x 10 10 VG / ear, 6x 10 10 VG / ear, 7x 10 10 VG / ear, 8x 10 10 VG / ear, 9x10 10 VG / ear, 1x 10 11 VG / ear, 2x 10 11 VG / ear, 3x 10 11 VG / ear, 4x 10 11 VG / ear, 5x 10 11 VG / ear, 6x10 11 VG / ear, 7x 10 11 VG / ear, 8x 10 11 VG / ear, 9x 10 11 VG / ear, 1x 10 12 VG / ear, 2x 10 12 VG / ear, 3x10 12 VG / ear, 4x 10 12 VG / ear, 5x 10 12 VG / ear, 6x 10 12 VG / ear, 7x 10 12 VG / ear, 8x 10 12 VG / ear, 9x10 12 VG / ear, 1x 10 13VG / ear, 2x 10 13 VG / ear, 3x 10 13 VG / ear, 4x 10 13 VG / ear, 5x 10 13 VG / ear, 6x10 13 VG / ear, 7x 10 13 VG / ear, 8x 10 13 VG / ear, 9x 10 13 VG / ear, 1x 10 14 VG / ear, 2x 10 14 VG / ear, 3x10 14 VG / ear, 4x 10 14 VG / ear, 5x 10 14 VG / ear, 6x 10 14 VG / ear, 7x 10 14 VG / ear, 8x 10 14 VG / ear, 9x10 14 VG / ear, 1x 10 15 VG / ear or 2x 10 15 VG / ear).

[0178] The compositions described herein are administered in an amount sufficient to improve vestibular function (e.g., improve balance or reduce dizziness or vertigo), treat bilateral vestibular disease, treat bilateral vestibular hypofunction, treat oscillopsia, treat balance disorders, increase expression of a protein encoded by a transgene operably linked to the SLC6A14 promoter, increase function of a protein encoded by a transgene operably linked to the SLC6A14 promoter, promote or increase hair cell development, increase hair cell number (e.g., promote or induce hair cell regeneration or proliferation), increase or induce hair cell maturation (e.g., maturation of regenerated hair cells), improve hair cell function, improve VSC function, promote or increase VSC and / or vestibular hair cell survival, and / or promote or increase VSC proliferation. Vestibular function can be assessed using standard balance and vertigo tests (e.g., eye movement tests (e.g., ENG or VNG), VOR tests (e.g., head impact test (Ha-Ke test, e.g., VHIT) or caloric reflex test), postural mapping, rotational chair testing, ECOG, VEMP, and specialized clinical balance tests) and can be improved by 5% or greater (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200% or greater) compared to measurements obtained before treatment. The compositions described herein may also be administered in an amount sufficient to slow or prevent the onset or progression of vestibular dysfunction (e.g., in subjects who carry a genetic mutation associated with vestibular dysfunction, have a family history of vestibular dysfunction (e.g., hereditary vestibular dysfunction), or have been exposed to risk factors associated with vestibular dysfunction (e.g., ototoxic medications, head trauma, or disease or infection) but do not exhibit vestibular dysfunction (e.g., vertigo, dizziness, or imbalance), or in subjects who exhibit mild to moderate vestibular dysfunction). Expression of a protein encoded by a transgene operably linked to the SLC6A14 promoter in a nucleic acid vector administered to a subject can be assessed using immunohistochemistry, Western blot analysis, quantitative real-time PCR, or other methods known in the art for detecting protein or mRNA, and can be increased by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200% or more) compared to expression prior to administration of a composition described herein.The number of hair cells, hair cell function, hair cell maturation, hair cell regeneration, or the function of a protein encoded by a nucleic acid vector administered to a subject can be assessed indirectly based on a test of vestibular function and can be increased by 5% or more (e.g., 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 125%, 150%, 200% or more) compared to the number of hair cells, hair cell function, hair cell maturation, hair cell regeneration, or protein function before administration of a composition described herein or compared to an untreated subject. These effects can occur, for example, within 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 9 weeks, 10 weeks, 15 weeks, 20 weeks, 25 weeks, or more after administration of a composition described herein. Patients can be assessed 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or more after administration of the composition, depending on the dose and route of administration used for treatment. Depending on the results of the evaluation, the patient may receive additional treatment.

[0179] Reagent test kit

[0180] The compositions described herein may be provided in a kit for treating vestibular dysfunction. The compositions may include a SLC6A14 promoter described herein (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) with any of the polynucleotide sequences listed in Table 2 (e.g., a polynucleotide of any of SEQ ID NOs: 1-6), a nucleic acid vector containing such a polynucleotide, and a nucleic acid vector containing a polynucleotide described herein operably linked to a transgene encoding a protein of interest (e.g., a protein that can be expressed in VSCs to treat vestibular dysfunction). The nucleic acid vector can be packaged in an AAV viral capsid (e.g., AAV1, AAV2, AAV2quad (YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, Anc80, 7m8, PHP.B, PHP.eB, or PHP.S). The kit may also include a package insert that instructs the user of the kit (e.g., a physician) to perform the methods described herein. The kit may optionally include a syringe or other device for administering the composition.

[0181] Example

[0182] The following examples are put forth to provide one of ordinary skill in the art with a description of how the compositions and methods described herein may be used, made, and evaluated, and are intended to be purely illustrative of the invention and are not intended to limit the scope of what the inventors regard as their invention.

[0183] Example 1. Identification of solute carrier family 6 member 14 (SLC6A14) as a vestibular supporting cell-specific gene using single-cell RNA-Seq

[0184] Single-cell RNA sequencing was performed on vestibular and cochlear tissues of adult mice and the transcriptome was analyzed to identify genes expressed in different cell types of the inner ear. This analysis focused on identifying genes expressed in vestibular supporting cells but not in cochlear supporting cells. SLC6A14 was identified as a transcript that was robustly detected in vestibular supporting cells (VSCs) but not in other vestibular cell types or cochlear cell types ( Figure 1A-1B ).

[0185] Example 2. Identification of cell lines endogenously expressing SLC6A14

[0186] To identify cell lines that endogenously express the SLC6A14 gene, we queried the ARCHS database, which contains publicly available RNA sequencing data for murine and human cells (amp.pharm.mssm.edu / archs4). Based on this query, multiple cell lines were identified as endogenously expressing SLC6A14 ( Figure 2 ). HepG2 (human hepatoma cell line) was one of the three cell lines with the highest midpoint expression of SLC6A14.

[0187] Example 3. Determination of transduction efficiency of various adeno-associated virus (AAV) serotypes in HepG2 cells

[0188] To experimentally verify that HepG2 cells can be transduced by a variety of recombinant AAV serotypes, HepG2 cells were transduced using a variety of AAV serotypes via plasmid constructs. Specifically, HepG2 cells were first inoculated into plates. Plasmids were transfected by Lipofectamine 3000. AAV was packaged in HEK293T cells using a conventional triple transfection method. AAV virus was harvested from producing cells, purified by iodixanol gradient centrifugation, and then buffer exchanged to produce the final pure AAV stock. Plasmid constructs encoding the human histone H2B gene (CMV-H2B-GFP) fused to the green fluorescent protein gene (GFP) under the control of the cytomegalovirus (CMV) promoter were packaged into AAV1, AAV8, and AAV9 capsids and were expressed at 1×10 6 vg / cell were transduced into HepG2 cells. GFP was visualized by fluorescence microscopy and quantified by flow cytometry. It was found that all serotypes transduced HepG2 cells, but AAV9 transduced cells at a much lower efficiency ( Figure 3 ).

[0189] Example 4. Determination of SLC6A14 promoter activity in HepG2 cells

[0190] The murine (SEQ ID NO: 5) and human (SEQ ID NO: 3-4) SLC6A14 promoters were designed to promote exogenous transgene expression. To verify that these SLC6A14 promoters were active when delivered as exogenous DNA and were independent of viral packaging efficacy, plasmids encoding three variants of the SLC6A14 promoter, P530, P335, and P372 (respectively) were transfected with lipofectamine. Fig.19 , Fig.21 and Fig. 22 ) were transfected into HepG2 cells. The SLC6A14 promoter activity was also compared with the activity of the CMV promoter. Untransduced cells were used as controls. The lipofection efficiency of the tested constructs is shown in Figure 4A Cells transfected with the SLC6A14 promoter variants expressed GFP at levels comparable to or greater than the ubiquitous strong CMV promoter, indicating that the cell line can be used as a model for SLC6A14 promoter activity ( Figure 4B ). These results were confirmed using fluorescence microscopy ( Figures 5A-5E ).

[0191] Example 5. Determination of the transduction efficiency of AAV8 viral vector encoding SLC6A14 promoter in HepG2 cells

[0192] A transgene containing nuclear H2B-GFP was packaged into an AAV8 viral vector under the control of the CMV promoter or one of four SLC6A14 promoter variants. Transgenic plasmids P530 (human SLC6A14 promoter of SEQ ID NO: 4), P335 (human SLC6A14 promoter of SEQ ID NO: 3), P372 (mouse SLC6A14 promoter of SEQ ID NO: 5), or P373 (mouse SLC6A14 promoter of SEQ ID NO: 6) were used; Fig.23 ) to synthesize the SLC6A14 promoter driving H2B-GFP expression. Each viral vector was expressed at 1×10 6 All viruses resulted in the presence of GFP-positive HepG2 cells, confirming that the SLC6A14 promoter packaged into AAV8 was able to drive gene expression ( Figure 6 ).

[0193] Example 6. Determination of SLC6A14 promoter activity in mouse vestibular organs in vitro

[0194] To determine SLC6A14 promoter activity in murine vestibular organs in vitro, adult male mouse utricles and cristae were dissected from the inner ears of post-mortem adult C57Bl / 6 mice and maintained in cell culture. Gentamycin was added to kill hair cells. AAV8 vector carrying GFP was expressed at 1×10 11 The dose of individual viral genome (vg) / culture is delivered to the cell culture medium to transduce tissue. After seven days of cultivation, the tissue is fixed at room temperature for one hour with 4% paraformaldehyde. The organ is washed three times with phosphate buffered saline (PBS), five minutes each time, and then blocked for one hour at room temperature with MOM blocking reagent (Vector Laboratories, Burlingame CA) according to the manufacturer's scheme. The organ is then blocked for 3 hours at room temperature with 10% serum in PBS+0.5%TritonX-100 (PBST), followed by a primary rabbit anti-Sall2 (marker of supporting cells) antibody (1:200 dilution in PBST plus 2% serum at 4°C; Catalog number HPA004162, Millipore Sigma, St.Louis, MO) or a primary mouse monoclonal anti-Brn-3c (marker of Pou4f3-hair cells) antibody (1:200 dilution; Catalog number sc-81980, Santa Cruz Biotechnology, Dallas, TX) incubated overnight. The tissue was allowed to reach room temperature and then washed three times with PBS for five minutes each. The tissue was then incubated with Alexa Fluor 568 donkey anti-rabbit or Alexa Fluor 647 anti-mouse secondary antibodies (1:500 dilution; ThermoFisher Scientific, Waltham MA) in PBST plus 2% serum at room temperature for three hours. The organs were washed three times with PBS for five minutes each, mounted on slides, and confocal images were obtained using a Zeiss LSM 880 with airyscan (Zeiss, Germany). The ears were fixed with formalin and embedded in paraffin (FFPE) and sectioned, stained for GFP with chromogenic IHC, and imaged. Murine promoter #1 (SEQ ID NO:5) is expressed at high levels in supporting cells in the utricle and cristae ( Figures 7A-7D Specifically, GFP expression is seen in the sensory epithelium containing hair cells (Pou4f3) and supporting cells (Sall2) ( Fig. 7A ). A lateral view of the utricle shows GFP labeling consistent with Sall2-positive supporting cell nuclei but not with Pou4f3-positive hair cell nuclei ( Figure 7B GFP expression was also observed in the explanted ridges ( Figure 7C ). Transverse view of the cristae shows GFP expression colocalized primarily with supporting cells ( Fig.7D ). The murine promoter #2 (SEQ ID NO:6), expressing the alternative isoform, produced only weak expression in the utricle ( Figures 8A-8D ) and was detected in both hair cells and supporting cells. GFP expression was only seen in a small part of the utricle sensory epithelium, which contains hair cells (Pou4f3) and supporting cells (Sall2) ( Fig. 8A ). A lateral view of the utricle shows GFP labeling consistent with Sall2-positive supporting cell nuclei as well as a portion of Pou4f3-positive hair cell nuclei ( Figure 8B ). Low levels of GFP expression were also observed in explanted ridges ( Figure 8C ). Transverse views of the ridges show GFP expression that is primarily colocalized with supporting cells but also occurs in nonspecific regions ( Fig.8D ).

[0195] Example 7. Determination of SLC6A14 promoter activity in murine vestibular organs in vivo

[0196] To determine the activity of the SLC6A14 promoter in vivo, the murine SLC6A14 promoter #1 (SEQ ID NO: 5) driving nuclear GFP (from plasmid P372) packaged into AAV8 was expressed at 9.78 × 10 9 The dose of vg / ear was delivered by injection into the posterior semicircular canal of adult mice. Two weeks later, the animals were euthanized by CO2 and perfused with PBS followed by neutral buffered formalin (NBF). The temporal bones were removed and fixed overnight in NBF at room temperature (RT). The vestibular organs were dissected from the temporal bones and decalcified overnight in 14% EDTA (BM-150A, Boston BioProducts) at room temperature. Fig. 9A ), small capsule ( Fig. 9B ) and crest ( Fig. 9C ) GFP expression can be seen in the

[0197] To determine the specificity of expression, whole ears were fixed, decalcified, paraffin-embedded, and stained with hematoxylin and eosin (H&E) to visualize cross-sections of the entire tissue. Robust GFP expression was seen in the nuclei of the utricle, utricle, and cristae, whereas no GFP signal was seen in the cochlea ( Fig.10 ). There was low off-target GFP signal in the nuclei of hair cells or mesenchymal cells, indicating the specificity of this promoter. The cell type specificity of the promoter activity was confirmed by H&E staining and counterstaining for GFP protein to identify the nuclei of cells expressing GFP ( Fig.11A) and adjacent sections in which the WPRE element of the AAV vector genome was labeled with an RNAScope probe ( Fig. 11B ). Staining showed specific expression in the nuclei of supporting cells of the vestibular organ, with little GFP detected in hair cells. Large amounts of vector genomes were detected in hair cells, supporting cells, and mesenchymal cells beneath the sensory epithelium, indicating that the GFP-expressing vector transduced multiple cell types ( Fig. 11B ). However, GFP expression was only detected in supporting cells ( Fig.11A ).

[0198] Example 8. Silencing of Atoh1 transgenic expression in new hair cells via a supporting cell-specific promoter drives further maturation

[0199] To evaluate the effect of promoter specificity on hair cell maturation, utricles were dissected from male C57Bl / 6J mice (6-8 weeks old) and cultured in 100 μL of basal medium containing DMEM / F12 with 5% FBS and 2.5 μg / ml ciprofloxacin at 37°C and 5% CO2. Gentamycin (0.5 mg / mL) was added to the medium for 24 hours to kill the hair cells, then the gentamicin was washed off and replaced with 250 μL of fresh medium containing one of the following AAVs at a dose of 1E12 gc: AAV8-CMV-Atoh1-2A-H2BGFP (CMV promoter group), AAV8-GFAP-Atoh1-2A-H2BGFP (SC-specific promoter group), AAV8-RLBP1-Atoh1-2A-H2BGFP (SC-specific promoter group). After one day of incubation, the virus was washed off and the utricles were cultured in 2 mL of fresh medium for an additional 3, 8, or 16 days. At the end of the culture period, the utricles were dissociated and single cells were captured and prepared for single-cell RNA-Seq using the 10X Genomics Chromium system. Sequencing was performed on an Illumina NovaSeq, reads were aligned with CellRanger, and downstream analysis was performed with Seurat. Prediction scores were generated in Seurat by comparison with a database of single-cell RNA-Seq signatures of utricle hair cells generated from embryonic day 18 (E18), postnatal day 12 (P12), and adult mice. Figures 12A-12D are violin plots showing Atoh1 transgene expression and maturation prediction scores in regenerating hair cells in adult utricle explants treated with AAV expressing Atoh1 under the control of the ubiquitous CMV promoter or supporting cell (SC)-specific promoters (GFAP or RLBP1). The Atoh1 transgene was expressed at low or undetectable levels in regenerating hair cells in the SC-specific promoter group ( Fig. 12A), while it was expressed at high levels in almost all hair cells from the CMV group. These results confirm that the Atoh1 transgene is naturally downregulated in regenerating hair cells when it is driven by a SC-specific promoter. Fig. 12C ) and adult hair cells ( Fig.12D ) than those from the CMV group. In contrast, the single-cell RNA-Seq features from the CMV group that were strongly correlated with E18 hair cells ( Fig. 12B ) than from the SC-specific promoter set. Thus, natural silencing of the Atoh1 transgene with an SC-specific promoter drives the maturation of regenerating hair cells.

[0200] Example 9. Construction of an AAV vector containing the SLC6A14 promoter operably linked to a polynucleotide encoding Atoh1

[0201] AAV8 vectors were produced as follows: HEK293T cells (obtained from ATCC, Manassas, VA) were seeded into cell culture treated dishes (15 cm) and grown until they reached 70-80% confluence in the vessel. Plasmids were transfected into 293T cells using a conventional triple transfection method: the transfer plasmid of SEQ ID NO:7, encoding the SLC6A14 promoter (nucleotides 233-1066 of SEQ ID NO:7) driving expression of human ATOH1 (encoded by nucleotides 1083-2144 of SEQ ID NO:7), and also containing the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE, nucleotides 2155-2702 of SEQ ID NO:7), and the bovine growth hormone (bGH) polyadenylation signal in the 3'UTR (nucleotides 2715-2922 of SEQ ID NO:7) was combined with the plasmid pXR8 (Addgene #112864) containing the AAV2 rep / AAV8 cap and the adenovirus helper plasmid pXX6-80 (X Xiao et al., J Virol. 72 (3), pp. 2224-32 (1998)) were combined in a 1:1:1 molar ratio, and 52.3 μg of the mixture was combined with PEIMax (Polysciences). A total of 52.3 μg of the plasmid mixture was delivered to each 15 cm plate containing cells. The cell culture medium and cells were then collected to extract and purify the AAV. The AAV of the cells was released from the cells via three freeze-thaw cycles and the cell culture medium was collected to obtain secreted AAV. The AAV of the cell culture medium was concentrated by adding PEG8000 to the solution, incubating at 4°C and centrifuging to collect AAV particles. All AAV was passed through iodixanol density gradient centrifugation to purify AAV particles, and the buffer was replaced with PBS containing 0.01% pluronic F68 by passing the purified AAV and buffer through a centrifugal column with a molecular weight cutoff of 100 kDa. Other AAV viral vectors described herein were synthesized in a similar manner using appropriate transgenic plasmids (which provide promoters, transgenes, and other elements required for transgenic expression).

[0202] Example 10. Determination of human SLC6A14 promoter activity in murine vestibular organs in vivo

[0203] To determine whether the human SLC6A14 promoter is also active in vestibular supporting cells in vivo, a transfer plasmid of SEQ ID NO: 8 containing the human SLC6A14 promoter (nucleotides 233-1066) driving expression of a nuclear-directed H2B-GFP fusion protein (nucleotides 1083-2198 of SEQ ID NO: 8) was packaged into AAV8. The resulting AAV8 vector was expressed at 3×10 10The dose of vg / ear was delivered by injection into the posterior semicircular canal of male 8-week-old C57BL / 6 mice. Two weeks later, the animals were euthanized and perfused with PBS followed by neutral buffered formalin (NBF) by CO2. The temporal bones were removed, the utricles and cristae were microdissected, and fluorescent immunolabeling was performed for the hair cell marker Pou4f3 (1:200, sc-1980, Santa Cruz Biotechnology, Dallas, Texas, USA) and the supporting cell marker Sall2 (1:200, HPA004162, Atlas Antibodies, Bromma, Sweden). The organs were mounted on slides and imaged on a Zeiss LSM 800 confocal microscope. Native GFP expression was detected in most supporting cells ( Figures 13A-13B ). GFP appears to be highly localized to supporting cells and is not detected in hair cells or any other non-sensory cell types.

[0204] Example 11. Determination of human SLC6A14 promoter activity in non-human primate vestibular organs in vivo

[0205] To determine the SLC6A14 promoter activity in the vestibular organs of non-human primates in vivo, the same AAV8 vector used in Example 10 was expressed at 1.5×10 12 The dose of 100 viral genomes (vg) / ear was delivered by injection into the round window membrane, which has a fenestration site produced for the fluid outflow in the lateral semicircular canal of adult cynomolgus macaques. Four weeks later, the animals were then sedated and perfused with PBS containing heparin (100U / mL) with ketamine (10-15mg / kg, IM) or Telazol (5-8mg / kg, IM), followed by perfusion of neutral buffered formalin (10% NBF). The temporal bones were removed and fixed overnight in NBF at room temperature (RT) and then decalcified in Immunocal (StatLab) solution at room temperature.

[0206] GFP expression was examined in two ways: the vestibular organs were microdissected out and imaged, and whole pieces or whole ears were embedded in paraffin and made into sections to visualize expression in all areas of the ear. For whole pieces of organs, nuclei were counterstained with DAPI, mounted on slides, and imaged on a Zeiss LSM 880 confocal microscope. For each section, immunolabeling was performed to detect GFP because the paraffin embedding process quenches the native GFP signal. After dewaxing and antigen retrieval, sections were labeled with a rabbit primary antibody against GFP (Abcam, ab183734) and an anti-rabbit secondary antibody conjugated to alkaline phosphatase to develop the red staining using Fast-Red dye. Sections were counterstained blue using hematoxylin. Example data show GFP expression in the utricle. Similar to the results observed in mice, GFP expression was confined to the sensory epithelium, and no expression was detected in non-sensory cells ( Fig.14A Robust GFP expression was detected in supporting cells ( Fig. 14B ).

[0207] Example 12. Vestibular hair cell regeneration in vivo via SLC6A14 promoter-driven ATOH1 overexpression in a mouse IDPN injury model

[0208] We next evaluated whether expression of the transcription factor ATOH1 driven by the human SLC6A14 promoter could convert vestibular supporting cells into new hair cells in adult mice after killing pre-existing hair cells. To injure hair cells, male 8-week-old C57BL / 6 mice were weighed and injected intraperitoneally with 4 mg / kg of sterile 3,3'-iminodiapropionitrile (TCI America, I0010) in PBS. A plasmid of SEQ ID NO:9 containing an expression cassette encoding the human SLC6A14 promoter of SEQ ID NO:4 (nucleotides 233-1066 of SEQ ID NO:9) driving expression of human ATOH1 (nucleotides 1083-2144 of SEQ ID NO:9) and co-expressing nuclear-targeted green fluorescent protein (GFP fused to the H2B fragment of the histone 2b gene - nucleotides 2217-3332 of SEQ ID NO:9), a woodchuck hepatitis virus posttranscriptional regulatory element (WPRE, nucleotides 3341-3888 of SEQ ID NO:9), and a bovine growth hormone (bGH) polyadenylation signal in the 3'UTR (nucleotides 3901-4108 of SEQ ID NO:9) was added to 7.3×10 12 vg / mL was packaged into AAV8. This AAV8 vector was packaged into AAV8 at a titer of 7.3×10 9vg / ear was administered into the posterior semicircular canal of male 8-week-old C57BL / 6 mice (n=6). Six weeks later, the animals were euthanized by CO2 and perfused with PBS followed by neutral buffered formalin (NBF). The temporal bones were removed, the utricles were microdissected, and fluorescent immunolabeling was performed for the hair cell marker Pou4f3 (1:200, sc-81980, Santa Cruz Biotechnology) and the supporting cell marker Sall2 (1:200, HPA004162, Atlas Antibodies). The organs were mounted on slides and imaged on a Zeiss LSM 800 confocal microscope. Qualitative observation of the confocal images revealed a significant increase in the number of hair cells in the utricles treated with vehicle compared to the untreated utricles of the contralateral ear (as assessed by Pou4f3 labeling) ( Fig.15A Quantitative measurement of hair cell number using the 3D counting automated algorithm in Imaris software confirmed a significant increase ( Fig. 15B ).

[0209] Example 13. Dose response of AAV vectors encoding SLC6A14 promoter-driven ATOH1 expression cassette in vivo in a mouse IDPN injury model

[0210] Using the same method and vector as described in Example 12, we also 9 , 5×10 9 , 1×10 10 and 2×10 10 The dose dependence of the hair cell regeneration effect was evaluated by delivering the vector at a dose of 2×10 vg / ear (n=8 mice / dose). Quantification of the difference in the number of inner hair cells in animals between the treated (left) and untreated (right) ears revealed significant regeneration at all doses tested, with a clear dose dependence at 2×10 10 vg / ear reaches a stable level ( Fig.16 ).

[0211] Example 14. Vestibular hair cell regeneration in vivo via SLC6A14 promoter-driven ATOH1 overexpression in a mouse gentamicin injury model

[0212] To determine whether a similar regenerative response could be observed in a replacement injury model, the same SLC6A14-ATOH-H2BGFP AAV8 vector described in Examples 12 and 13 was delivered to adult mice in which vestibular hair cells were injured by local delivery of the aminoglycoside antibiotic gentamicin. Specifically, 400 mg / mL gentamicin was delivered to the middle ear of 8-week-old male C57BL / 6 mice via three transtympanic injections spaced three days apart. Two weeks later, the AAV8 vector was injected at 2×10 10vg / ear was delivered into the posterior semicircular canal (n=12 mice). For control mice, an equal volume of PBS (1 μL) was injected into the posterior semicircular canal (n=14 mice). Mice were killed 4 weeks after viral delivery, and ears were processed and quantified as described in Example 12. To confirm that gentamicin successfully damaged hair cells, naive mice (n=12) were also sacrificed for comparison. Quantification of Pou4f3+ hair cells revealed that gentamicin significantly reduced hair cell counts in the utricle, and AAV8 vectors expressing ATOH1 significantly increased hair cell number ( Figures 17A-17B ).

[0213] Example 15. Administration of a composition containing a nucleic acid vector containing the SLC6A14 promoter to a subject with vestibular dysfunction

[0214] According to the methods disclosed herein, a physician skilled in the art can treat a patient (eg, a human patient) suffering from vestibular dysfunction to improve or restore vestibular function. To this end, a physician skilled in the art can administer to a human patient a composition containing an AAV vector (e.g., AAV1, AAV2, AAV2quad (YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, Anc80, 7m8, PHP.B, PHP.eB, or PHP.S) containing a SLC6A14 promoter (e.g., a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to any of the polynucleotide sequences listed in Table 2 (e.g., a polynucleotide of any of SEQ ID NOs: 1-6)) operably linked to a transgene encoding a therapeutic protein (e.g., aregulated BHLH transcription factor 1 (Atoh1)). In one embodiment, the vector has an AAV8 capsid and contains nucleotides 233-2922 of SEQ ID NO: 7. A composition containing an AAV vector can be administered to a patient, for example, by topical administration to the inner ear (eg, injection into the semicircular canals), to treat vestibular dysfunction.

[0215] After the composition is administered to the patient, a professional skilled in the art can monitor the expression of the therapeutic protein encoded by the transgene and the improvement of the patient's response to the therapy by a variety of methods. For example, a physician can monitor the patient's vestibular function by implementing standard tests such as electronystagmography, videonystagmography, VOR tests such as head impact tests (Ha-Ke test, such as VHIT) or caloric reflex tests, rotation tests, vestibular-induced myogenic potentials, or computerized dynamic posture meters. Compared to the test results obtained before the administration of the composition, the patient's vestibular function after the administration of the composition in one or more tests shows improved indication that the patient is responding well to the treatment. Subsequent doses can be determined and administered as needed.

[0216] Exemplary embodiments of the invention are described in the following enumerated paragraphs.

[0217] E1. A nucleic acid vector comprising a polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to any one of SEQ ID NOs: 1-6.

[0218] E2. A nucleic acid vector as described in E1, wherein the polynucleotide has at least 85% sequence identity with SEQ ID NO:4 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity).

[0219] E3. A nucleic acid vector as described in E1, wherein the polynucleotide has at least 85% sequence identity with SEQ ID NO:3 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity).

[0220] E4. A nucleic acid vector as described in E1, wherein the polynucleotide has at least 85% sequence identity with SEQ ID NO:5 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity).

[0221] E5. A nucleic acid vector as described in E1, wherein the polynucleotide has at least 85% sequence identity to SEQ ID NO:6 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity).

[0222] E6. A nucleic acid vector as described in E1, wherein the polynucleotide has at least 85% sequence identity with SEQ ID NO:2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity).

[0223] E7. A nucleic acid vector as described in E1, wherein the polynucleotide has at least 85% sequence identity with SEQ ID NO:1 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity).

[0224] E8. The nucleic acid vector of any one of E1-E7, wherein the polynucleotide is operably linked to a transgene.

[0225] E9. The nucleic acid vector of E8, wherein the transgene is a heterologous transgene.

[0226] E10. The nucleic acid vector of E8 or E9, wherein the transgene encodes a protein, short interfering RNA (siRNA), antisense oligonucleotide (ASO), nuclease, or micro RNA.

[0227] E11. The nucleic acid vector of E10, wherein the polynucleotide is capable of directing vestibular supporting cell (VSC)-specific expression of a protein, siRNA, ASO, nuclease or microRNA in mammalian VSC.

[0228] E12. The nucleic acid vector of E11, wherein the VSC is human VSC.

[0229] E13. A nucleic acid vector as described in any one of E10-E12, wherein the protein is a therapeutic protein, and wherein the therapeutic protein is Sal-like transcription factor 2 (Sall2), calmodulin binding transcription activator 1 (Camta1), Hes-related family BHLH transcription factor with YRPW motif 2 (Hey2), Gata binding protein 2 (Gata2), Hes-related family BHLH transcription factor with YRPW motif 1 (Hey1), ceramide synthase 2 (Lass2), SRY box 10 (Sox10), GATA binding protein 3 (Gata3), Cut-like homeobox 1 (Cux1), nuclear receptor subfamily 2F group member (Nr2f1 ), Hes-related family BHLH transcription factor (Hes1), RAR-related orphan receptor B (Rorb), Jun proto-oncogene AP-1 transcription factor subunit (Jun), zinc finger protein 667 (Zfp667), LIM homeobox 3 (Lhx3), nonsense helix-loop-helix 1 (Nhlh1), MAX dimerization protein 4 (Mxd4), MIZ-1 type zinc finger (Zmiz1), myelin transcription factor 1 (Myt1), signal transducer and activator of transcription 3 (Stat3), BarH-like homeobox 1 (Barhl1), thymocyte selection-related high-mobility group box (Tox), Prospero homeobox 1 (Prox1), nuclear factor IA (Nfia), thyroid hormone receptor beta (Thrb), MYCL proto-oncogene BHLH transcription factor (Mycl1), lysine demethylase 5A (Kdm5a), CAMP response element binding protein 3-like 4 (Creb3I4), ETS variant 1 (Etv1), paternally expressed 3 (Peg3), BTB domain and CNC homolog 2 (Bach2), ISLLIM homeobox 1 (Isl1), zinc finger and BTB domain-containing 38 (Zbtb38), limb bud and heart development (Lbh), Tubby bipartite transcription factor (Tub), ubiquitin C (Hmg20), RE1 silencing transcription factor (Rest), zinc finger protein 827 (Zfp827), AF4 / FMR2 family member 3 (Aff3), PBX / knotted 1 homeobox 2 (Pknox2), AT-rich interaction domain 3B (Arid 3b), MLX-interacting protein (Mlxip), zinc finger protein (Zfp532), IKAROS family zinc finger 2 (Ikzf2), Sal-like transcription factor 1 (Sall1), SIX homeobox 2 (Six2), Sal-like transcription factor 3 (Sall3), Lin-28 homolog B (Lin28b), regulatory factor X7 (Rfx7), brain-derived neurotrophic factor (Bdnf), growth factor-independent 1 transcriptional repressor (Gfi1), POU4-like homeobox 3 (Pou4f3), MYC proto-oncogene BHLH transcription factor (Myc), β-catenin (Ctnnb1), SRY box 2 (Sox2), SRY box 4 (Sox4), SRY box 11 (Sox11), TEA domain transcription factor 2 (Tead2), aregulated BHLH transcription factor 1 (Atoh1), or Atoh1 variants.

[0230] E14. The nucleic acid vector of E13, wherein the therapeutic protein is Atoh1.

[0231] E15. The nucleic acid vector of E13, wherein the Atoh1 variant has one or more amino acid substitutions selected from the group consisting of S328A, S331A, S334A, S328A / S331A, S328A / S334A, S331A / S334A and S328A / S331A / S334.

[0232] E16. The nucleic acid vector of any one of E1-E15, wherein the nucleic acid vector is a viral vector, a plasmid, a cosmid or an artificial chromosome.

[0233] E17. The nucleic acid vector of E16, wherein the nucleic acid vector is a viral vector selected from the group consisting of adeno-associated virus (AAV), adenovirus, and lentivirus.

[0234] E18. The nucleic acid vector of E17, wherein the viral vector is an AAV vector.

[0235] E19. A nucleic acid vector as described in E18, wherein the AAV vector has an AAV1, AAV2, AAV2quad (YF), AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, rh10, rh39, rh43, rh74, Anc80, Anc80L65, DJ / 8, DJ / 9, 7m8, PHP.B, PHP.eB or PHP.S capsid.

[0236] E20. A composition comprising the nucleic acid vector as described in any one of E1-E19.

[0237] E21. The composition of E20, further comprising a pharmaceutically acceptable carrier, diluent or excipient.

[0238] E22. A polynucleotide having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity) to any one of SEQ ID NOs: 1-6 operably linked to a transgene.

[0239] E23. A polynucleotide as described in E22, wherein the polynucleotide has at least 85% sequence identity to SEQ ID NO:4 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity).

[0240] E24. A polynucleotide as described in E22, wherein the polynucleotide has at least 85% sequence identity to SEQ ID NO:3 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity).

[0241] E25. A polynucleotide as described in E22, wherein the polynucleotide has at least 85% sequence identity to SEQ ID NO:5 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity).

[0242] E26. A polynucleotide as described in E22, wherein the polynucleotide has at least 85% sequence identity to SEQ ID NO:6 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity).

[0243] E27. A polynucleotide as described in E22, wherein the polynucleotide has at least 85% sequence identity to SEQ ID NO:2 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity).

[0244] E28. A polynucleotide as described in E22, wherein the polynucleotide has at least 85% sequence identity to SEQ ID NO:1 (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or greater sequence identity).

[0245] E29. The polynucleotide of any one of E22-E28, wherein the transgene is a heterologous transgene.

[0246] E30. The polynucleotide of E29, wherein the transgene encodes a protein, siRNA, ASO, nuclease, or microRNA.

[0247] E31. The polynucleotide of E30, wherein the protein is a therapeutic protein, and wherein the therapeutic protein is Sox9, Sall2, Camtal, Hey2, Gata2, Hey1, Lass2, Sox10, Gata3, Cux1, Nr2f1, Hes1, Rorb, Jun, Zfp667, Lhx3, Nhlh1, Mxd4, Zmiz1, Myt1, Stat3, Barhl1, Tox, Prox1, Nfia, Thrb, Mycl1, Kdm5 a, Creb314, Etv1, Peg3, Bach2, Isl1, Zbtb38, Lbh, Tub, Hmg20, Rest, Zfp827, Aff3, Pknox2, Arid3b, Mlxip, Zfp532, I kzf2, Sall1, Six2, Sall3, Lin28b, Rfx7, Bdnf, Gfi1, Pou4f3, Myc, Ctnnb1, Sox2, Sox4, Sox11, Tead2, Atoh1 or Atoh1 variant.

[0248] E32. The polynucleotide of E31, wherein the therapeutic protein is Atoh1.

[0249] E33. A cell comprising the polynucleotide of any one of E22-E32 or the nucleic acid vector of any one of E1-E19.

[0250] E34. The cell of E33, wherein the cell is a mammalian VSC.

[0251] E35. The cell of E34, wherein the mammalian VSC is a human VSC.

[0252] E36. A method of expressing a transgene in a mammalian VSC, the method comprising contacting the mammalian VSC with a nucleic acid vector as described in any one of E1-E19 or a composition as described in E20 or E21.

[0253] E37. The method of E36, wherein the transgene is specifically expressed in VSCs.

[0254] E38. The method of E36 or E37, wherein the mammalian VSC is a human VSC.

[0255] E39. A method of treating a subject having or at risk of developing vestibular dysfunction, the method comprising administering to the subject an effective amount of a nucleic acid vector as described in any one of E1-E19 or a composition as described in E20 or E21.

[0256] E40. The method of E39, wherein the vestibular dysfunction comprises vertigo, dizziness, imbalance, bilateral vestibulopathy, bilateral vestibular hypofunction, oscillopsia or balance disorder.

[0257] E41. The method of E39 or E40, wherein the vestibular dysfunction is age-related vestibular dysfunction, head trauma-related vestibular dysfunction, disease or infection-related vestibular dysfunction, or ototoxic drug-induced vestibular dysfunction.

[0258] E42. The method of any one of E39-E41, wherein the vestibular dysfunction is associated with a genetic mutation.

[0259] E43. A method of inducing or increasing vestibular hair cell regeneration in a subject in need thereof, the method comprising administering to the subject an effective amount of a nucleic acid vector as described in any one of E1-E19 or a composition as described in E20 or E21.

[0260] E44. A method of inducing or increasing VSC proliferation in a subject in need thereof, the method comprising administering to the subject an effective amount of a nucleic acid vector as described in any one of E1-E19 or a composition as described in E20 or E21.

[0261] E45. A method of inducing or increasing vestibular hair cell proliferation in a subject in need thereof, the method comprising administering to the subject an effective amount of a nucleic acid vector as described in any one of E1-E19 or a composition as described in E20 or E21.

[0262] E46. A method of inducing or increasing maturation of vestibular hair cells (e.g., maturation of regenerated hair cells) in a subject in need thereof, the method comprising administering to the subject an effective amount of a nucleic acid vector as described in any one of E1-E19 or a composition as described in E20 or E21.

[0263] E47. A method of inducing or increasing vestibular hair cell innervation in a subject in need thereof, the method comprising administering to the subject an effective amount of a nucleic acid vector as described in any one of E1-E19 or a composition as described in E20 or E21.

[0264] E48. A method of increasing survival of VSCs and / or vestibular hair cells in a subject in need thereof, the method comprising administering to the subject an effective amount of a nucleic acid vector as described in any one of E1-E19 or a composition as described in E20 or E21.

[0265] E49. A method as described in any of E43-E48, wherein the subject suffers from or is at risk of suffering from a vestibular dysfunction (e.g., vertigo, dizziness, imbalance, bilateral vestibulopathy, bilateral vestibular hypofunction, oscillopsia, or balance disorder).

[0266] E50. A method of treating a subject having or at risk of developing bilateral vestibulopathy, the method comprising administering to the subject an effective amount of the nucleic acid vector of any one of E1-E19 or the composition of E20 or E21.

[0267] E51. A method for treating a subject having or at risk of developing bilateral vestibular hypofunction, the method comprising administering to the subject an effective amount of a nucleic acid vector as described in any one of E1-E19 or a composition as described in E20 or E21.

[0268] E52. The method of E51, wherein the bilateral vestibular hypofunction is ototoxic drug-induced bilateral vestibular hypofunction.

[0269] E53. The method of E41 or E52, wherein the ototoxic drug is selected from the group consisting of aminoglycosides, antineoplastic drugs, ethacrynic acid, furosemide, salicylates and quinine.

[0270] E54. A method for treating a subject having or at risk of having oscillopsia, the method comprising administering to the subject an effective amount of a nucleic acid vector as described in any one of E1-E19 or a composition as described in E20 or E21.

[0271] E55. A method of treating a subject having or at risk of having a balance disorder, the method comprising administering to the subject an effective amount of a nucleic acid vector as described in any one of E1-E19 or a composition as described in E20 or E21.

[0272] E56. The method of any one of E39-E55, wherein the method further comprises assessing the vestibular function of the subject prior to administering the nucleic acid vector or composition.

[0273] E57. The method of any one of E39-E56, wherein the method further comprises assessing the vestibular function of the subject after administering the nucleic acid vector or composition.

[0274] E58. The method of any one of E39-E57, wherein the nucleic acid vector or composition is administered topically.

[0275] E59. The method of E58, wherein the nucleic acid vector or composition is administered to the semicircular canal.

[0276] E60. The method of E58, wherein the nucleic acid vector or composition is administered transtympanically or intratympanically.

[0277] E61. The method of E58, wherein the nucleic acid vector or composition is administered into the perilymph.

[0278] E62. The method of E58, wherein the nucleic acid vector or composition is administered into the endolymph.

[0279] E63. The method of E58, wherein the nucleic acid vector or composition is administered to or via the oval window.

[0280] E64. The method of E58, wherein the nucleic acid vector or composition is administered to or via the round window.

[0281] E65. A method as described in any of E39-E64, wherein the nucleic acid vector or composition is administered in an amount sufficient to prevent or alleviate vestibular dysfunction, delay the onset of vestibular dysfunction, slow the progression of vestibular dysfunction, improve vestibular function, increase the number of vestibular hair cells, increase the maturation of vestibular hair cells (e.g., the maturation of regenerated hair cells), increase vestibular hair cell proliferation, increase vestibular hair cell regeneration, increase vestibular hair cell innervation, increase VSC proliferation, increase VSC number, increase VSC survival, increase vestibular hair cell survival, or improve VSC function.

[0282] E66. The method of any one of E39-E65, wherein the subject is human.

[0283] E67. A kit comprising the nucleic acid vector of any one of E1-E19 or the composition of E20 or E21.

[0284] Other Implementations

[0285] Various modifications and variations of the described invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in conjunction with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to these specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are apparent to those skilled in the art are intended to fall within the scope of the invention. Other embodiments are in the claims.

Claims

1. A nucleic acid vector, comprising: a. a solute carrier family 6 member 14 (SLC6A14) promoter comprising a nucleotide sequence having at least 85% sequence identity to any one of SEQ ID NOs: 1-6, the promoter being operably linked to: b. A heterologous transgene, wherein the transgene encodes a therapeutic protein, short interfering RNA (siRNA), antisense oligonucleotide (ASO), nuclease, or microRNA.

2. The nucleic acid vector of claim 1, wherein the SLC6A14 promoter comprises a nucleotide sequence of SEQ ID NO:4, SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:

6.

3. The nucleic acid vector of claim 2, wherein the SLC6A14 promoter comprises the nucleotide sequence of SEQ ID NO:

4.

4. The nucleic acid vector of any one of claims 1-3, wherein the transgene encodes a therapeutic protein.

5. The nucleic acid vector of claim 4, wherein the therapeutic protein is selected from the group consisting of: aregulated BHLH transcription factor 1 (Atoh1), Sal-like transcription factor 2 (Sall2), calmodulin-binding transcription activator 1 (Camta1), Hes-related family BHLH transcription factor with YRPW motif 2 (Hey2), Gata binding protein 2 (Gata2), Hes-related family BHLH transcription factor with YRPW motif 1 (Hey1), ceramide synthase 2 (Lass2), SRY box 10 (Sox10), GATA binding protein 3 (Gata3), Cut-like homeobox 1 (Cux1), nuclear receptor subfamily 2F group member (Nr2f1), Hes-related family BHLH transcription factor (Hes1), RAR-related orphan receptor B (Rorb), Jun proto-oncogene AP-1 transcription factor subunit (Jun), zinc finger protein 667 (Zfp667), LIM homeobox 3 (Lhx3), nonsense helix-loop-helix 1 (Nhlh1), MAX dimerization protein 4 (Mxd4), MIZ-1 type zinc finger (Zmiz1), myelin transcription factor 1 (Myt1), signal transducer and activator of transcription 3 (Stat3), BarH-like homeobox 1 (Barhl1), thymocyte selection-related high-mobility group box (Tox), Prospero homeobox 1 (Prox 1), nuclear factor IA (Nfia), thyroid hormone receptor beta (Thrb), MYCL proto-oncogene BHLH transcription factor (Mycl1), lysine demethylase 5A (Kdm5a), CAMP response element binding protein 3-like 4 (Creb3I4), ETS variant 1 (Etv1), paternally expressed 3 (Peg3), BTB domain and CNC homolog 2 (Bach2), ISLLIM homeobox 1 (Isl1), zinc finger and BTB domain-containing 38 (Zbtb38), limb bud and heart development (Lbh), Tubby bipartite transcription factor (Tub), ubiquitin C (Hmg20), RE1 silencing transcription factor (Rest), zinc finger protein 82 7 (Zfp827), AF4 / FMR2 family member 3 (Aff3), PBX / noded 1 homeobox 2 (Pknox2), AT-rich interaction domain 3B (Arid3b), MLX interacting protein (Mlxip), zinc finger protein (Zfp532), IKAROS family zinc finger 2 (Ikzf2), Sal-like transcription factor 1 (Sall1), SIX homeobox 2 (Six2), Sal-like transcription factor 3 (Sall3), Lin-28 homolog B (Lin28b), regulatory factor X7 (Rfx7), brain-derived neurotrophic factor (Bdnf), growth factor-independent 1 transcriptional repressor (Gfi1), POUclass 4 homeobox 3 (Pou4f3), MYC proto-oncogene BHLH transcription factor (Myc), β-catenin (Ctnnb1), SRY box 2 (Sox2), SRY box 4 (Sox4), SRY box 11 (Sox11), TEA domain transcription factor 2 (Tead2), and Atoh1 variant. The nucleic acid vector of claim 5 , wherein the therapeutic protein is Atoh1.

7. The nucleic acid vector of any one of claims 1 to 6, wherein the nucleic acid vector further comprises a first inverted terminal repeat 5' to the SLC6A14 promoter; and 3' to the heterologous transgene and in 5' to 3' order, an optional post-transcriptional regulatory element, a polyadenylation signal and a second inverted terminal repeat.

8. The nucleic acid vector of claim 7, comprising nucleotides 233-2922 of SEQ ID NO:7, a first inverted terminal repeat 5' to nucleotides 233-2922 of SEQ ID NO:7, wherein the 5' inverted terminal repeat has at least 80% sequence identity with nucleotides 1-130 of SEQ ID NO:7; and a second inverted terminal repeat 3' to nucleotides 233-2922 of SEQ ID NO:7, wherein the 3' inverted terminal repeat has at least 80% sequence identity with nucleotides 3010-3139 of SEQ ID NO:

7.

9. The nucleic acid vector of any one of claims 1 to 8, wherein the nucleic acid vector is a plasmid.

10. The nucleic acid vector of any one of claims 1-8, wherein the nucleic acid vector is an AAV viral vector.

11. The nucleic acid vector of claim 10, wherein the AAV viral vector has an AAV8 capsid.

12. A pharmaceutical composition comprising the nucleic acid vector according to any one of claims 1 to 11 and a pharmaceutically acceptable carrier, diluent or excipient.

13. A method for expressing a transgene in a mammalian vestibular supporting cell (VSC), the method comprising contacting the mammalian VSC with the nucleic acid vector of any one of claims 1 to 11 or the composition of claim 12.

14. The method of claim 13, wherein the mammalian VSC is a human VSC.

Images