Application of SDX in preparation of testis premature senility or oligoasthenospermia diagnostic products and therapeutic drugs

Abstract

The invention provides application of SDX in preparation of diagnostic products and therapeutic drugs for testis premature senility or oligoasthenozoospermia. According to the invention, occurrence of testis premature senility or oligoasthenozoospermia is found to be related to SDX gene abnormality or SDX gene coding protein expression level abnormality. Therefore, testis premature senility or oligoasthenospermia can be clearly diagnosed by detecting the SDX gene sequence or the SDX protein expression level. Meanwhile, it is found that the mutant pathogenic gene related to testis premature senility or oligoasthenozoospermia contains seven mutation sites, a corresponding AAV vector is constructed based on the seven mutation sites for treatment, and the effectiveness of a gene treatment drug aiming at specific genetic mutation is proved.

Description

Technical Field

[0001] The present invention relates to the field of biomedical detection technology, and in particular to the application of SDX in the preparation of diagnostic products and therapeutic drugs for premature testicular failure or oligoasthenozoospermia. Background Art

[0002] In modern society, there is a clear trend of late marriage and late childbearing, and the problem of male reproductive capacity declining with age has received increasing attention. The core of male fertility lies in the healthy spermatogenesis process. Premature aging of the testicles seriously affects the production and function of sperm, which is more common in middle-aged and elderly men, manifested as sperm production disorders, sperm abnormalities and supporting cell dysfunction, which may eventually lead to infertility. Studies have shown that with the increase of age, male testosterone levels and semen quality generally decline, increasing attention to the reproductive health of middle-aged and elderly men.

[0003] Therefore, it is necessary to develop a detection reagent and therapeutic drug related to premature testicular failure or oligoasthenozoospermia. Summary of the invention

[0004] The purpose of the present invention is to provide the application of SDX in the preparation of a testicular premature aging or oligoasthenozoospermia detection kit. The present invention finds that the occurrence of testicular premature aging or oligoasthenozoospermia is related to abnormal SDX gene or abnormal expression level of SDX gene encoded protein. Testicular premature aging or oligoasthenozoospermia can be clearly diagnosed by detecting the SDX gene sequence or SDX protein expression level, which is of great significance in improving male infertility. At the same time, adeno-associated virus vector (AAV) is used to treat male infertility caused by abnormal gene SDX or / and protein SDX, and AAV virus vector, or directly supplement SDX protein, or use mRNA and other drugs to improve SDX protein expression to treat testicular premature aging and oligoasthenozoospermia. It is of great significance in improving testicular premature aging and oligoasthenozoospermia.

[0005] The present invention adopts the following technical solution:

[0006] In a first aspect of the present invention, there is provided an application of SDX in the preparation of a testicular premature aging or oligoasthenozoospermia detection kit, the application comprising: detecting abnormalities in the SDX gene and / or abnormalities in the expression level of the SDX protein.

[0007] Furthermore, the SDX gene abnormality includes at least one of the following abnormalities: a mutation in the promoter or enhancer sequence of the gene, or a single or multiple base sequence deletion, insertion or substitution in the gene coding sequence.

[0008] Furthermore, the abnormal expression level of the SDX protein includes at least one of the following abnormalities: decreased expression of the SDX protein, premature termination or loss of expression of the SDX protein, and deletion, insertion or substitution of amino acids in important functional domains of the SDX protein.

[0009] Furthermore, the testicular premature aging or oligoasthenozoospermia detection kit includes an SDX gene detection kit and / or an SDX protein expression level detection kit.

[0010] Furthermore, the SDX gene detection kit includes whole genome sequencing detection reagents.

[0011] Furthermore, the SDX protein expression level detection kit includes an antibody that specifically binds to the SDX protein.

[0012] In a second aspect of the present invention, a method for preparing a testicular premature aging or oligoasthenozoospermia detection kit is provided.

[0013] In the third aspect of the present invention, a mutant pathogenic gene associated with premature testicular failure or oligoasthenozoospermia is provided. Compared with the nucleotide sequence of the SDX gene as shown in SEQ ID NO: 1, the nucleotide changes in the mutant pathogenic gene are the following 7 mutation sites: S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G).

[0014] In the fourth aspect of the present invention, there is provided the use of a reagent for detecting the mutated pathogenic gene associated with premature testicular failure or oligoasthenozoospermia in the preparation of a diagnostic product for premature testicular failure or oligoasthenozoospermia.

[0015] In a fifth aspect of the present invention, provided is the use of an SDX overexpression vector in the preparation of a drug for treating premature testicular failure or oligoasthenozoospermia.

[0016] Furthermore, the SDX overexpression vector includes an adeno-associated virus vector.

[0017] The use of a substance that promotes the expression of SDX in the preparation of a drug for treating premature testicular failure or oligoasthenozoospermia includes, but is not limited to: designing and synthesizing mRNA containing the correct coding sequence according to the sequence of the SDX gene, and injecting the packaged mRNA into the testicles of mice to promote the expression of SDX.

[0018] In a sixth aspect of the present invention, a method for constructing a mouse model of a point mutation associated with an SDX gene is provided, the method comprising:

[0019] The nucleotide sequences shown in SEQ ID NO.6-SEQ ID NO.7, SEQ ID NO.11-SEQ ID NO.12, SEQ ID NO.13-SEQ ID NO.14, SEQ ID NO.15-SEQ ID NO.16, SEQ ID NO.17-SEQ ID NO.18, SEQ ID NO.19-SEQ ID NO.20, and SEQ ID NO.21-SEQ ID NO.22 are respectively transcribed into mRNA in vitro to obtain transcribed sgRNA;

[0020] Obtain active Cas9 mRNA;

[0021] Obtaining targeting donors with nucleotide sequences as shown in SEQ ID NO.2-SEQ ID NO.5 respectively;

[0022] The transcribed sgRNA, Cas9 mRNA and targeting donor are mixed and then microinjected into mouse fertilized eggs to obtain F0 generation mice;

[0023] The F0 generation positive mice from the genotype identification results of the F0 generation mice are selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes. After screening, a point mutation mouse model is obtained.

[0024] Furthermore, in the technical solution, the transcribed sgRNA corresponds to the targeting donor one by one. Specifically, it includes:

[0025] Scenario 1:

[0026] The gRNAs with nucleotide sequences as shown in SEQ ID NO.6-SEQ ID NO.7 are transcribed into mRNA in vitro to obtain transcribed sgRNAs;

[0027] Obtain active Cas9 mRNA;

[0028] Obtaining the targeting donors whose nucleotide sequences are shown in SEQ ID NO.2 respectively;

[0029] The transcribed sgRNA, Cas9 mRNA and targeting donor are mixed and then microinjected into mouse fertilized eggs to obtain F0 generation mice;

[0030] The F0 generation positive mice from the genotype identification results of the F0 generation mice were selected and mated with wild-type mice to obtain F1 generation mice with a stable genotype. After screening, the S219P (T655C) point mutation mouse model was obtained.

[0031] Scenario 2:

[0032] The gRNAs with nucleotide sequences as shown in SEQ ID NO.11-SEQ ID NO.12 are transcribed into mRNA in vitro to obtain transcribed sgRNAs;

[0033] Obtain active Cas9 mRNA;

[0034] Obtaining targeting donors with nucleotide sequences as shown in SEQ ID NO.3 respectively;

[0035] The transcribed sgRNA, Cas9 mRNA and targeting donor are mixed and then microinjected into mouse fertilized eggs to obtain F0 generation mice;

[0036] F0 generation positive mice from the genotype identification results of F0 generation mice were selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes. After screening, the E257K (G769A) point mutation mouse model was obtained.

[0037] Solution 3:

[0038] Respectively transcribe the gRNAs with nucleotide sequences as shown in SEQ ID NO.13-SEQ ID NO.14 into mRNA in vitro to obtain transcribed sgRNAs;

[0039] Obtain active Cas9 mRNA;

[0040] Obtaining targeting donors with nucleotide sequences as shown in SEQ ID NO.4 respectively;

[0041] The transcribed sgRNA, Cas9 mRNA and targeting donor are mixed and then microinjected into mouse fertilized eggs to obtain F0 generation mice;

[0042] F0 generation positive mice from the genotype identification results of F0 generation mice were selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes. After screening, the R549W (C1645T) point mutation mouse model was obtained.

[0043] Solution 4:

[0044] Respectively transcribe the gRNAs with nucleotide sequences as shown in SEQ ID NO.15-SEQ ID NO.16 into mRNA in vitro to obtain transcribed sgRNAs;

[0045] Obtain active Cas9 mRNA;

[0046] Obtaining targeting donors with nucleotide sequences as shown in SEQ ID NO.5 respectively;

[0047] The transcribed sgRNA, Cas9 mRNA and targeting donor are mixed and then microinjected into mouse fertilized eggs to obtain F0 generation mice;

[0048] F0 generation positive mice from the genotype identification results of F0 generation mice were selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes. After screening, the R549Q (G1646A) point mutation mouse model was obtained.

[0049] Solution 5:

[0050] The gRNAs with nucleotide sequences as shown in SEQ ID NO.17-SEQ ID NO.18 are transcribed into mRNA in vitro to obtain transcribed sgRNAs;

[0051] Obtain active Cas9 mRNA;

[0052] Obtaining targeting donors with nucleotide sequences as shown in SEQ ID NO.6 respectively;

[0053] The transcribed sgRNA, Cas9 mRNA and targeting donor are mixed and then microinjected into mouse fertilized eggs to obtain F0 generation mice;

[0054] F0 generation positive mice from the genotype identification results of F0 generation mice were selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes. After screening, a P594H (C1781A) point mutation mouse model was obtained.

[0055] Solution 6:

[0056] The gRNAs with nucleotide sequences as shown in SEQ ID NO.19-SEQ ID NO.20 are transcribed into mRNA in vitro to obtain transcribed sgRNAs;

[0057] Obtain active Cas9 mRNA;

[0058] Obtaining targeting donors with nucleotide sequences as shown in SEQ ID NO.7 respectively;

[0059] The transcribed sgRNA, Cas9 mRNA and targeting donor are mixed and then microinjected into mouse fertilized eggs to obtain F0 generation mice;

[0060] The F0 generation positive mice from the genotype identification results of the F0 generation mice were selected and mated with wild-type mice to obtain F1 generation mice with a stable genotype. After screening, the C647F (G1940T) point mutation mouse model was obtained.

[0061] Solution 7:

[0062] Respectively transcribe the gRNAs with nucleotide sequences as shown in SEQ ID NO.21-SEQ ID NO.22 into mRNA in vitro to obtain transcribed sgRNAs;

[0063] Obtain active Cas9 mRNA;

[0064] Obtaining targeting donors with nucleotide sequences as shown in SEQ ID NO.5 respectively;

[0065] The transcribed sgRNA, Cas9 mRNA and targeting donor are mixed and then microinjected into mouse fertilized eggs to obtain F0 generation mice;

[0066] F0 generation positive mice from the genotype identification results of F0 generation mice were selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes. After screening, the Q622E (C1864G) point mutation mouse model was obtained.

[0067] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0068] The application of SDX provided by the present invention in the preparation of a testicular premature aging or oligoasthenozoospermia detection kit, the present invention finds that the occurrence of testicular premature aging or oligoasthenozoospermia is related to abnormal SDX gene or abnormal expression level of SDX gene encoded protein. Therefore, premature testicular aging or oligoasthenozoospermia can be clearly diagnosed by detecting the SDX gene sequence or the SDX protein expression level, which is of great significance in improving male infertility. At the same time, compared with the prior art, the present invention can more accurately diagnose and effectively treat testicular premature aging and oligoasthenozoospermia through unique molecular markers and gene therapy strategies. In particular, the animal model study of the present invention shows that gene therapy mediated by AAV vector can significantly restore the damaged seminiferous tubule function and improve fertility. In addition, the present invention also provides theoretical and technical solutions for clinical application, and provides a new treatment method for the preservation and restoration of fertility in middle-aged and elderly men. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0070] Figure 1 Analyze the SDX point mutation sites of patients for whole genome sequencing and construct an SDX point mutation mouse model; Figure 1 A. Through screening of the patient database, seven non-synonymous point mutation sites were obtained through whole genome sequencing analysis, and no other non-synonymous mutations were found in other genomes of these patients; Figure 1 As shown in B, seven point mutations, including S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G), will all lead to smaller testicles, abnormal seminiferous tubules, incomplete spermatogenesis, and oligoasthenozoospermia in mice.

[0071] Figure 2 Targeting the seven point mutations S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G), we constructed a full-length SDX adeno-associated virus for viral therapy. The AAV viral vector was injected into the seminiferous tubules of mice with the above seven point mutations respectively. After several months of treatment, it was found that the seminiferous tubules were restored to a certain extent and the sperm count increased.

[0072] Figure 3 To construct an SDX gene-deficient mouse model; Figure 3 A shows that the testicles of SDX gene-deficient mice are smaller. Figure 3 B is a testicular tissue section showing abnormalities in the seminiferous tubules. Figure 3 C: The proportion of abnormal seminiferous tubules is 50%.

[0073] Figure 4 The results showed that the number of β-galactosidase-positive cells associated with aging in SDX gene-deficient mice increased, and genes related to the aging secretory phenotype (Ccl24, Vegfc, Tnfrsf1b, Cxcl1, Ptges, Spon1, Mmp2, Tnfrsf1a, Il15, Timp2, Bmp6, Mmp14, Cd9, Axl, Ppara, Prkab1, Prkag1, Est2) were upregulated; Figure 4A shows that the number of β-galactosidase-positive cells in SDX gene knockout mice increases. Figure 4 B shows that some supporting cells of gene-deficient mice are positive for β-galactosidase ( Figure 4 B), Figure 4 C shows the transcriptome sequencing results of RNA extracted from mouse testis.

[0074] Figure 5 The results are shown in Figure 2. Adeno-associated virus (AAV) vectors were used to treat mice with testicular premature aging. Figure 5 A is the difference in testicular morphology. Figure 5 B is the testicular and epididymal tissue section results. Figure 5 C is to detect whether SDX is expressed in the testis of mice infected with AAV. Figure 5 D shows the litter size of mice after AAV virus treatment.

[0075] Figure 6 To increase SDX protein expression in the testis through mRNA drugs to treat premature testicular failure. Figure 6 A. Difference in SDX expression between the experimental group (SDX-deficient mice injected with lipid nanoparticles containing SDX mRNA) and the control group (SDX-deficient mice injected with lipid nanoparticles without SDX mRNA); Figure 6 B. Comparison of testicle size between the experimental group and the control group. DETAILED DESCRIPTION

[0076] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0077] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0078] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained by existing methods.

[0079] The technical solution of the embodiment of the present application is to solve the above technical problems, and the overall idea is as follows:

[0080] The inventors of the present application have been exploring the role of genetic factors (gene mutations) in causing male sexual development disorders (DSD). Through proteomic studies on the sex differentiation-related model animal C57 / 6J male mice, we found that mouse SDX abnormalities can cause premature testicular failure or oligoasthenozoospermia in male mice.

[0081] By comparing the protein sequences of the SDX gene in humans and mice, we found that the SDX protein sequence is highly conserved in mice and humans, and the protein localization pattern is exactly the same. Therefore, the function of SDX in humans should be consistent with that in mice.

[0082] Subsequently, through experiments, it was discovered for the first time that the occurrence of premature testicular failure or oligoasthenozoospermia is related to abnormalities in the SDX gene or abnormal expression levels of the protein encoded by the SDX gene.

[0083] Therefore, by detecting the SDX gene sequence or SDX protein expression level, premature testicular failure or oligoasthenozoospermia can be clearly determined, which is of great significance in improving male infertility.

[0084] The SDX gene abnormality can be detected by whole genome sequencing, and the expression level of the protein encoded by the SDX gene can be detected by antibodies that specifically bind to the SDX protein. Therefore, a testicular premature aging or oligoasthenozoospermia detection kit can be prepared.

[0085] According to the sequencing results, the SDX point mutation patients included the following point mutation sites for the diagnosis of testicular premature failure and oligoasthenozoospermia: S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G).

[0086] The patient has at least one of the seven mutations, such as all seven mutations or one or more of the seven mutations, and then an overexpression vector is prepared for the mutation for treatment.

[0087] It should be noted that the human gene SDX (MUM1L1; PWWP3B) in the present invention is located on chromosome Xq22.3, NC_000023.11 (106168278..106208961), contains 6 exons, and has been confirmed to have two transcripts (NM_001171020.2; NM_152423.5), but they both encode the same protein, showing a high expression profile in the reproductive system. At present, the structure and function of the SDX gene and the SDX-encoded protein still need further study. The sequence of the human gene SDX, the human SDX effective coding sequence (Coding sequence) and the protein sequence encoded by the human SDX gene can be found in patent CN113604554B;

[0088] The application of SDX of the present application in the preparation of a testicular premature aging or oligoasthenozoospermia detection kit will be described in detail below in combination with examples and experimental data.

[0089] Example 1: Discovery of a mutated pathogenic gene associated with premature testicular failure or oligoasthenozoospermia

[0090] 1. Obtain biological samples

[0091] Male patients: no family history of transgender diseases. Clinical phenotypes include: spermatogenesis abnormalities that become more severe with age, low sperm count in semen tests, etc., and ultimately diagnosed with premature testicular failure or oligoasthenozoospermia.

[0092] 2. DNA Extraction

[0093] Peripheral blood mononuclear cells were extracted and DNA was extracted using a DNA isolation kit (Blood DNA0Kit V2, #CW2553).

[0094] 3. Library construction and sequencing

[0095] The genomic DNA was randomly broken and sheared into fragments of 180-280 bp in length using a Covaris crusher. Libraries were prepared using the Bioruptor UCD-200 (Diagenode), KAPA library preparation kit (Kapa Biosystems, #KR0453) and SureSelect XT2 target enrichment system (Agilent). DNA libraries were sequenced using the Illumina NovaSeq platform and downstream analysis was performed using the Illumina sequence control software (SCS). Variants were retained only when the read depth was greater than or equal to 10. High-quality reads were aligned to the USCS human genome (build 37.1 version hg19) using the Burrows-Wheeler alignment tool.

[0096] Genome Analysis Toolkit (GATK) and ANNOVAR (version: 2016-05-1110:54:48-0700) were used for variant calling and annotation. All subjects were screened for C9ORF72 repeat expansion using standard repeat-primed PCR. Variant frequencies were initially determined in gnomeAD and Exome Aggregation Consotium (ExAC) to remove common single nucleotide polymorphisms (SNPs). Only nonsynonymous, splice, and frameshift variants with a minor allele frequency (MAF) < 0.5% or not present in population databases were selected for further evaluation.

[0097] 4. Patient screening and confirmation of gene mutations: In the infertile patient population, we successfully identified 7 point mutations associated with the SDX gene ( Figure 1 A), we obtained the mutation sites of oligoasthenozoospermia patients through whole genome sequencing and found that there were non-synonymous mutations in the SDX protein encoding region, and no non-synonymous mutations in other locations of the genome; these mutation sites were located at S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G).

[0098] Example 2: Construction of point mutation knock-in mouse model

[0099] In Example 1, in the infertile patient group, we successfully identified 7 point mutations associated with the SDX gene, which were located at S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G).

[0100] Through conservation analysis, these mutations were used to construct point mutation knock-in mouse models, and their corresponding positions were confirmed in the mouse models, providing precise targets for subsequent gene therapy.

[0101] 1. Design gRNA as shown in Table 1.

[0102] Table 1

[0103]

[0104] 2. Preparation of gRNA for microinjection

[0105] First, the gRNA sequence was connected to the PT7-4G plasmid vector with a T7 promoter. After the plasmid was sequenced and verified to be correct, the T7 promoter and gRNA nucleotide sequences were amplified using universal amplification primers. Finally, the PCR product was used as a template for in vitro transcription to obtain microinjection RNAs of gRNA1 and gRNA2.

[0106] The reaction conditions during its preparation were 65° C. for 5 min, and the RNA electrophoresis diagram indicated that the gRNA was successfully transcribed at the required concentration.

[0107] 3. Preparation of Donor RNA for microinjection;

[0108] The synthetic nucleotide sequences are as shown in SEQ ID NO.2~8 as the targeting donor (Donor), wherein SEQ ID NO.2~8 represent the Donor sequences of S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G), respectively].

[0109] 4. Sample in vitro transcription: Cas9 expression plasmid (Addgene No. 44758) was linearized by AgeⅠ digestion, purified by phenol chloroform extraction, and dissolved in nuclease-free water as a template for in vitro transcription; Cas 9 mRNA was synthesized in vitro using T7 RNA polymerase according to the T7 Ultra Kit (Ambion, AM1345).

[0110] 5. Preparation of F0 generation mice;

[0111] Microinjection of Cas9 / sgRNA and donor: The transcribed Cas9 mRNA, sgRNA and purified donor fragment were mixed and the concentration was adjusted to 20 ng / μl Cas9 mRNA, 10 ng / μl sgRNA (gRNA1: gRNA2 = 1:1) and 50 ng / μl donor fragment. The mixture was microinjected into the pronucleus and cytoplasm of C57BL / 6 mouse fertilized eggs using a TE2000U microinjector. The fertilized eggs were then transplanted into the uterus of pseudopregnant C57BL / 6 female mice and the F0 generation of mice were waited for birth.

[0112] 6. Genotype detection of F0 generation mice:

[0113] The present invention adopts the method of injecting Cas9 / gRNA into fertilized eggs to construct gene knock-in mice; since the cleavage rate of the early embryo is very fast, the F0 generation mice obtained are chimeras; therefore, the F0 genotype obtained by identifying the tail of the F0 generation mouse is for reference only and cannot represent that it is definitely a heritable gene mutation type. The heritable genotype needs to be determined after the tail of the F1 generation mouse is detected.

[0114] After fertilized egg microinjection and embryo transplantation, F0 mice were obtained. Through PCR and sequencing confirmation, the following homologous recombination positive F0 generation mice were obtained.

[0115] 7. Preparation of F1 mice;

[0116] The positive mice in the tail genotype identification results of F0 generation mice were selected and mated with C57BL / 6J wild-type mice to obtain F1 generation mice with stable genotypes.

[0117] The tail DNA of the F1 generation mice identified as positive by the above PCR was extracted for sequencing, and the sequencing results indicated that the model was successfully constructed.

[0118] 8. Phenotype of point mutation mouse model

[0119] The results are as follows Figure 1 As shown, the testicles of SDX point mutation mice became smaller, and testicular tissue sections revealed abnormal seminiferous tubules; SDX point mutation mice showed obvious symptoms of premature testicular aging and oligoasthenozoospermia.

[0120] Example 3: Targeted therapy strategies for specific gene mutations

[0121] 1. Construction and application of viral vector: The corresponding AAV vector was constructed and the titer was measured. The specific construction method is as follows;

[0122] pAAV-CMV SDX: The gene fragment with the sequence shown in SEQ ID NO.1 is inserted into the EcoRI / BamHI site of the pAAV-CMV vector.

[0123] 2. Co-transfection

[0124] 12-16 h before transfection, HEK293T cells were split at a ratio of 1:3 into 15 cm plates containing 25 mL of DMEM complete medium;

[0125] When the cell confluency reaches 70-80%, transfect the plasmid in each 15cm dish. Add 40μg DNA mixture; (pAAV-CMV SDX: pAAV2 / 8-RC: pHelper is 1:1:1 molar ratio) Add 1.5mL pre-warmed serum-free DMEM to each dish. Then add 120μL PEI (PEI: DNA mass ratio is 3:1) and vortex for 1 minute. Incubate at room temperature for 15 minutes and drop the mixture into each dish; 12h after transfection, wash the cells once with PBS and incubate with 25mL DMEM complete medium;

[0126] 3. Virus collection

[0127] 72 hours after transfection, harvest the cells; use a serological pipette to remove about 20 mL of culture medium from the culture dish and place it in a 50 mL centrifuge tube. 3-5 mL of culture medium should be retained in the culture dish with the cells. Use a cell scraper to scrape the transfected HEK293T cells on each 15 cm plate, collect the cell suspension, and transfer it to a 50 mL centrifuge tube. Spin the culture medium and cell suspension at 3900 rpm for 15 minutes at 4°C to spheroid the cells.

[0128] The supernatant was processed as follows: filtered through a 0.22 μm PES membrane; the virus in the supernatant was concentrated using Centricon Plus-70 (100 kDa) at 3900 rpm at 4° C. The concentrated virus was transferred to a new centrifuge tube.

[0129] Cell pellets were processed as follows: Each cell pellet was resuspended in AAV lysis buffer (500 μL AAV lysis buffer was added to each plate) and combined into a 50 mL centrifuge tube. Cells were lysed by 4 freeze-thaw cycles (-80°C / 37°C), and then the cells were returned to 37°C. Benzonase (250 U / μL) was added, 1 μL per 5 mL of cell suspension. Mix well, incubate at 37°C for 1 hour, mix every 15 minutes, and centrifuge at 3900 rpm at 4°C for 15 minutes. The viral supernatant was filtered sequentially using 0.45 μm and 0.22 μm filters. Viruses in the supernatant were concentrated using Centricon Plus-70 (100 KDa) at 3900 rpm at 4°C. The concentrated viruses were mixed. The mixture can be stored overnight at 4°C for a short period of time or at -80°C for a long period of time.

[0130] 4. Take 20 μL of virus sample for DNA extraction, perform Q-PCR reaction, and measure the virus titer.

[0131] Design Q-PCR primers, the primer sequences are as follows:

[0132] Q-PCR primer1: ATGGCATCCCAAGCCAAGAGAGTA;

[0133] Q-PCR primer2:AAAATGCCCAAGAGGTGGTCCTCT;

[0134] Preparation of 1 × 10 10 molecules / μL of plasmid stock solution to generate a standard curve, and the standard curve plasmid was serially diluted 6 times in duplicate;

[0135] Treat purified AAV samples with benzonase / DNase I to eliminate any contaminating plasmid DNA carried over from the production process (DNase cannot penetrate viral particles);

[0136] The DNA was diluted 10-fold, 100-fold, and 1000-fold, and loaded into the qPCR plate according to the 2X Universal SYBR Green Fast qPCR Mix (Abclonal, RM21203) system to calculate the virus titer.

[0137] Run the following program using SYBR detection on a Q-PCR instrument (QuantStudio6 Real-time PCR System):

[0138] Table 2

[0139]

[0140] 5. Subsequently, through minimally invasive surgery, these full-length SDX viral vectors were injected into the seminiferous tubules of mice with seven point mutations, namely S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G), for treatment.

[0141] Careful evaluation of the therapeutic effect: After several months of treatment, detailed histological analysis showed that the testicular HE of these point mutation mice showed that the seminiferous tubules were restored and sperm production was observed ( Figure 2 ).

[0142] 6. Extended application of treatment strategies: After the SDX point mutation site is determined through targeted sequencing, the full-length SDX can be packaged in an AAV viral vector and injected into the patient's seminiferous tubules to treat all testicular premature failure and oligoasthenozoospermia caused by SDX gene point mutations. This strategy demonstrates the great potential of gene therapy in the field of precision medicine and genetic disease treatment.

[0143] This example not only confirms the feasibility of a gene therapy strategy targeting a specific genetic mutation, but also demonstrates the great potential of this strategy in treating genetic infertility. In the future, this technology is expected to be further optimized and may be expanded to a wider range of genetic disease treatments.

[0144] Example 4 Construction of SDX gene-deficient mouse model

[0145] 1. Methods: Using CRISPR / Cas9 technology and the principle of homologous recombination, the target gene was knocked out. The specific process is as follows: Design and transcribe guide RNA (gRNA) in vitro.

[0146] gRNA1:ACCCCCACATATGATCCTCA;

[0147] gRNA2: CCATTTGATGACCTATTCAA;

[0148] Cas9 and gRNA are injected into the fertilized eggs of mice at the same time. Under the guidance of gRNA, Cas9 protein binds to the target site and causes DNA double-strand breaks (DSB), forcing cells to perform emergency repairs. Under normal conditions, cells tend to use nonhomologous DNA end joining (NHEJ) to repair the broken double strands, which causes deletion mutations in the target site gene, thereby achieving knockout of the target gene.

[0149] 2. Isolate and observe SDX gene-deficient mice, dissect the model animal C57BL / 6J mice, and observe the mouse testicles

[0150] The results are as follows Figure 3 As shown in A, the testicles of SDX gene-deficient mice became smaller, and testicular tissue sections revealed abnormal seminiferous tubules ( Figure 3 B), the proportion of abnormal seminiferous tubules is about 50% ( Figure 3 C); The number of sperm in mice decreases, and the decrease becomes more obvious with age. Male mice are infertile after more than nine months. Combined with the conservation of the SDX gene in humans and mice, it is speculated that the function of SDX in humans should be consistent with that in mice. SDX knockout mice show obvious symptoms of premature testicular aging and oligoasthenozoospermia, and lose fertility 9 months after birth.

[0151] 3. The number of aging-related β-galactosidase-positive cells in SDX gene-deficient mice increased, and genes related to the aging secretory phenotype were upregulated

[0152] The β-galactosidase kit (Beyotime C0602) detected an increase in the number of β-galactosidase-positive cells in SDX knockout mice. Figure 4 A), β-galactosidase antibody (Cell Signaling Technology, 14B7) detection found that some supporting cells of gene-deficient mice were β-galactosidase positive ( Figure 4 B), RNA from mouse testes was extracted for transcriptome sequencing and it was found that genes related to the secretory phenotype of aging (Ccl24, Vegfc, Tnfrsf1b, Cxcl1, Ptges, Spon1, Mmp2, Tnfrsf1a, Il15, Timp2, Bmp6, Mmp14, Cd9, Axl, Ppara, Prkab1, Prkag1, Est2) were upregulated in knockout mice ( Figure 4 C).

[0153] Example 5 Treatment of premature testicular aging mice by adeno-associated virus vector (AAV)

[0154] 1. After the overexpression vector is constructed, co-transfect and then collect the virus. Take 20 μL of virus sample for DNA extraction, perform Q-PCR reaction, and measure the virus titer.

[0155] 2. Testicular injection of virus in SDX knockout mice, the specific operation is as follows:

[0156] High pressure related surgical instruments were placed in advance; 50-100uL 2% sodium pentobarbital solution was injected intraperitoneally to anesthetize the mice (the volume of anesthetic can be adjusted according to the size of the mice); the anesthetized mice were placed on the operating table and the abdomen was disinfected with alcohol; the fur layer was cut about 1cm above the genitals, and then the muscle layer was cut, and then the fat tissue was clamped with clean tweezers to expose the testicles; about 15uL of virus was drawn into the injection needle that was pulled in advance, and after the injection needle was installed, the needle was inserted into the seminiferous tubule at the junction of the testicle and the head of the epididymis, and the injection button of the injection pump was pressed to inject the virus, and the total amount of virus injected reached 1×10 11 molecules; inject SDX virus into one testis and EGFP virus into the other testis as a control; remove the injection needle, adjust the position of the mouse testis and epididymis, put it into the abdominal cavity, and then push it into the scrotum to reset it; suture the mouse wound with a suture needle, first suture the muscle layer and then suture the skin layer; take out the mouse, put it on a warm blanket, wait for the mouse to wake up, and then put it back into the cage.

[0157] The virus-injected mice were raised for two months, and then the mice were dissected to observe the testicular morphology and epididymal tissue sections, and the expression of SDX protein was observed by immunofluorescence staining.

[0158] 6. Results Analysis

[0159] The mice were killed by cervical dislocation, and their weights were measured and recorded. The mice were dissected, and the testicles and epididymis were taken out and the testicles were weighed. The testicles of the mice treated with AAV-SDX weighed 0.0588 g ( Figure 5 A, right side), the testis weight of mice in the control group AAV-EGFP group was 0.167 g ( Figure 5 A, left side); after treatment, the testicle size was significantly restored;

[0160] After AAV-SDX treatment, the abnormal lumen was found in the testicular sections of mice, only 8.96%, while the lumen of the control group was completely abnormal; epididymal tissue sections showed that the lumen of the epididymis of the mice on the SDX side contained sperm, while the control group had no sperm ( Figure 5 B); By detecting whether SDX is expressed in the testes of mice infected with AAV, we also found by immunofluorescence staining that SDX is expressed in the supporting cells of the seminiferous tubules of knockout mice ( Figure 5 C). The treated male mice were mated with wild-type female mice. After one month of natural mating, the female mice became pregnant and gave birth to 8 mice ( Figure 5 D).

[0161] The above results show that by treating SDX-deficient mice with AAV-SDX, the testicular size can be restored, spermatogenesis returns to normal, spermatogenesis is improved, and the next generation can be produced through natural mating or in vitro fertilization, thereby improving the reproductive capacity of mice.

[0162] Example 6 Increasing SDX protein expression in testis by mRNA drug to treat premature testicular aging

[0163] 1. mRNA synthesis: Use in vitro transcription technology to synthesize modified mRNA with a 5' cap structure (Cap 1) and a 3' poly (A) tail to improve its stability and translation efficiency. Purify mRNA by high performance liquid chromatography (HPLC) or fast liquid chromatography (FPLC).

[0164] 2. Encapsulate the synthesized mRNA in lipid nanoparticles (LNPs) to promote its stability and effective delivery in vivo.

[0165] 3. Mouse testis injection: Experimental group and control group were set up. The experimental group used SDX-deficient mice to be injected with LNP containing SDX mRNA, and the control group used SDX-deficient mice to be injected with blank LNP without mRNA. The drug was administered by local testicular injection or tail vein injection twice a week for 4 weeks.

[0166] 4. Western Blot was used to detect the mRNA and protein expression levels of SDX gene in testicular tissue.

[0167] 5. Take the testicles of mice in the experimental group and the control group for observation.

[0168] By treating SDX-deficient mice with synthetic mRNA drugs, we found that the WB test results of the experimental group mice showed the expression of SDX, while the control group did not express SDX ( Figure 6 A). The testicular size of the experimental group mice recovered to a certain extent, while the testicular size of the control group did not change ( Figure 6 B).

[0169] Example 7 Application of the SDX gene sequence in the genome for the preparation of a kit for detecting premature spermatogenesis or oligoasthenozoospermia

[0170] 1. Materials

[0171] 200 microliters (μl) of peripheral blood were collected from patients with premature testicular failure and oligoasthenozoospermia.

[0172] 2. Extracting blood tissue genome

[0173] A blood gene extraction kit (brand: TIANGEN, item number: DP304) was used. The specific operation was performed according to the instructions. The main operations are as follows:

[0174] (1) Process the blood sample (if the blood sample is 200uL, no processing is required).

[0175] (2) Add 20 μL of Proteinase K solution and mix well. Add 200 μL of Buffer GB and mix thoroughly by inversion. Place at 70°C for 10 minutes. The solution should become clear. Centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0176] (3) Add 200 μL of anhydrous ethanol and vortex to mix thoroughly for 15 seconds. Flocculent precipitation may appear at this time. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.

[0177] (4) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3 (the adsorption column is placed in a collection tube), centrifuge at 12,000 revolutions per minute (rpm) for 30 seconds (s), discard the waste liquid, and place the adsorption column CB3 back into the collection tube.

[0178] (5) Add 500 μL of buffer GD to the adsorption column CB3 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in a collection tube.

[0179] (6) Add 600 μL of rinse solution PW to the adsorption column CB3 (please check whether anhydrous ethanol has been added before use), centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and place the adsorption column CB3 in a collection tube.

[0180] (7) Repeat step (6).

[0181] (8) Place the adsorption column CB3 back into the collection tube, centrifuge at 12,000 rpm for 2 minutes, and discard the waste liquid. Place the adsorption column CB3 at room temperature for several minutes to completely dry the residual rinse liquid in the adsorption material.

[0182] (9) Transfer the adsorption column CB3 into a clean centrifuge tube, add 50-200 μl of elution buffer TE to the middle part of the adsorption membrane, leave it at room temperature for 2-5 minutes, centrifuge it at 12,000 rpm for 2 minutes, and collect the solution in a centrifuge tube.

[0183] (10) Store the DNA solution at -20°C or -80°C.

[0184] 3. Send the patient's peripheral blood genomic DNA solution to a sequencing company for whole genome sequencing.

[0185] 4. Analyze the SDX gene sequence in the genome

[0186] (1) There is no mutation in the exon sequence of the SDX gene, which indicates that the patient's premature testicular failure is not related to the SDX gene. Other gene mutations need to be analyzed or other causes should be considered.

[0187] (2) Mutation in the promoter or enhancer sequence of the SDX gene: If a base mutation occurs in the promoter or enhancer sequence of the SDX gene, and the expression of the encoded protein does not change, it can be determined that the patient's premature testicular failure is not related to the SDX gene; if a base mutation occurs in the promoter or enhancer sequence of the SDX gene, and the expression level of the SDX protein is significantly reduced, it can be determined that the patient's premature testicular failure is related to the SDX gene.

[0188] (3) There are base deletions or insertions in the SDX gene coding sequence:

[0189] If there is a non-integer 3 deletion or insertion of bases in the exon sequence of the SDX gene, the encoded protein will definitely be affected, so the patient's premature testicular failure is related to SDX;

[0190] If a deletion or insertion of three integer multiples occurs, it may lead to the deletion or insertion of additional amino acid residues in the encoded protein, and the change site occurring in an important functional domain may lead to a decrease in SDX activity. The sequence of the encoded protein needs to be further determined, and specific reference should be made to protein expression and functional verification.

[0191] (4) Base substitutions exist in the SDX gene coding sequence:

[0192] If a synonymous mutation occurs in the exon sequence of the SDX gene (the type of amino acid encoded does not change after the base substitution), the final encoded protein does not change, so premature testicular failure and oligoasthenozoospermia are not related to the SDX gene;

[0193] If nonsense mutations occur in the exon sequence of the SDX gene (base substitutions lead to premature termination of protein translation), the activity and function of the SDX protein will eventually be affected. Therefore, premature testicular failure and oligoasthenozoospermia are related to the SDX gene. During the whole genome sequencing analysis, it is also necessary to analyze the genome-related sequences related to other patients with premature testicular failure. If the patient has mutations in other reported related genes, it can be considered that multiple gene mutations lead to the occurrence of the above diseases.

[0194] Example 8: Application of detecting the expression level of SDX encoded protein in preparing a kit for detecting premature spermatogenesis or oligoasthenozoospermia

[0195] 1. Get the tissue

[0196] Reproductive organ tissues of testicular premature failure and oligoasthenozoospermia are obtained through tissue puncture (requires professional medical personnel).

[0197] 2. Preparation of protein samples

[0198] (1) 100 μL RIPA lysis buffer (brand: Beyotime, catalog number: P0013K) was added with a final concentration of 1x protease inhibitor cocktail (brand: Roche, catalog number: 11836145001), the tissue was lysed, ground on ice, sonicated after grinding, lysed on a shaker at 4°C for 60 min, and then centrifuged at 12,000 g for 10 min at 4°C to collect the supernatant.

[0199] (2) Determine the protein concentration by BCA method (brand: Beyotime, product number: P0012).

[0200] (3) Add 5x SDS-PAGE protein loading buffer (Brand: Abclonal, Catalog Number: RM00001), mix, boil in water for 10-15 minutes, and then cool on ice.

[0201] 3. Protein immunoblotting

[0202] (1) Install the gel casting apparatus according to the instruction manual and prepare 5% stacking gel and 10% separation gel respectively.

[0203] (2) Loading: The protein loading amount is 10-100 ng.

[0204] (3) Electrophoresis: After loading, connect the electrophoresis instrument to the power supply, pay attention to the correct connection of the positive and negative electrodes, set appropriate electrophoresis parameters, and the concentration gel electrophoresis parameter is a constant voltage of 60V. When the sample enters the separation gel, the electrophoresis voltage can be adjusted to 120V. When bromophenol blue electrophoresis reaches the bottom of the gel, stop the electrophoresis and turn off the power supply of the electrophoresis instrument.

[0205] (4) Transfer: Take out the gel from the glass plate, and place a porous pad, a filter paper, the gel, a PVDF membrane, three filter papers, and a porous pad (a "sandwich" structure) on the clamp in sequence. Place the transferred membrane in the transfer tank and transfer the membrane at a constant current of 250 mA on ice for 90 minutes.

[0206] (5) Blocking: Remove the membrane from the "sandwich" structure, place it in a suitable antibody incubation tank, add 5% skim milk / TBST Buffer (mass / volume) and block at room temperature for 1 h.

[0207] (6) Primary antibody incubation: rabbit anti-human SDX polyclonal antibody was prepared in the laboratory and diluted with 3% bovine serum albumin (BSA) / TBST Buffer (mass / volume) at a dilution ratio of 1:100-1:200; GAPDH mouse monoclonal antibody (brand: protein tech, catalog number: 60004-1-Ig) was diluted at a ratio of 1:50000. Primary antibody incubation was performed at 4°C overnight.

[0208] (7) Washing: After the primary antibody incubation, add TBST buffer and wash 4 times, 5 min each time.

[0209] (8) Secondary antibody incubation: Secondary antibody HRP Goat Anti-Rabbit IgG (H+L) (Brand: Abclonal, Catalog No.: AS014) was diluted 1:5000 with TBST Buffer. Incubate at room temperature for 1 h.

[0210] (9) Washing: After the secondary antibody incubation, add TBST buffer and wash 4 times, 5 min each time.

[0211] (10) Development: ECL developer (brand: Thermo Fisher Scientific, catalog number: 1863094), mix solution A and solution B in a dark place and then drop them onto the PVDF membrane for digital development.

[0212] 4. Data calculation

[0213] By using the BCA method for protein quantification, GAPDH (the content in different cells does not change much and is not affected by the change of the target protein) can be used as the internal reference protein to perform relative quantification of SDX protein (taking the ratio of SDX protein to internal reference protein as the measurement value), and the control protein (normal testis). The images of different samples were gray-processed and the gray value or gray area was calculated.

[0214] 5. Results Analysis

[0215] (1) There is no difference (location, content) between the test group and the control group: This indicates that the SDX protein expression level in patients with premature testicular failure and oligoasthenozoospermia is no different from that in normal people. At the same time, if the gene sequence is correct, it can further rule out the possibility that SDX abnormalities cause premature testicular failure and oligoasthenozoospermia.

[0216] (2) Changes in the position of the SDX protein band in the test group: Combined with the SDX gene sequence information, this indicates that the SDX protein terminates prematurely, or that a new sequence is added due to the loss of the stop codon caused by the insertion of bases; this can determine the possibility that SDX mutations cause testicular premature failure and oligoasthenozoospermia.

[0217] (3) Increased SDX protein content in the test group: This indicates that the activity of the SDX protein is reduced. Combined with the SDX gene sequence information (functional domain mutation) and protein interaction experiments (reduced protein binding), the possibility of diagnosing SDX-induced testicular premature aging and oligoasthenozoospermia can be increased.

[0218] 6. Tissue fixation and dehydration

[0219] The punctured tissue was fixed with 4% PFA / PBS (mass / volume) at 4°C for 2 hours, and then dehydrated with 30% Sucrose / PBS (mass / volume) at 4°C overnight.

[0220] 7. Tissue embedding and sectioning

[0221] The dehydrated tissue was embedded in NEG-50 (Thermo Fisher Scientific) at -80°C and then frozen and sectioned.

[0222] 8. Immunofluorescence of frozen sections

[0223] Blocking: Use a water blocking pen to draw a circle around the tissue on the slice, cover the sample completely with 10% goat serum / TBS Buffer (volume / volume), place the slice in a humidified box, and incubate at room temperature for 1 hour.

[0224] Primary antibody incubation: remove the blocking solution, and directly add the primary antibody working solution prepared with 10% goat serum / TBS Buffer (volume / volume) (laboratory-made rabbit anti-human SDX polyclonal antibody, dilution ratio: 1:50) on the sample. The sample must be completely covered, and the slices must be placed in a wet box and incubated at room temperature overnight. Wash once with buffer TBST for 5 minutes; wash three times with buffer TBS for 5 minutes each. Secondary antibody incubation: add fluorescent secondary antibody working solution prepared with 10% goat serum / TBS Buffer (volume / volume) - Alexa Fluor 488-conjugated Goat anti-Rabbit IgG (H+L) (brand: Abclonal, item number: AS053) on the sample. The sample must be completely covered, protected from light, and incubated at room temperature for 1 hour. Wash once with buffer TBST for 5 minutes; wash three times with buffer TBS for 5 minutes each;

[0225] Nuclear staining: Add DAPI fluorescence attenuation mounting medium on the sample, then cover with a coverslip, and then observe and collect images under a fluorescence microscope.

[0226] 9. Results Analysis

[0227] The fluorescence signal of SDX protein disappeared in the test group: combined with the SDX gene sequence information and the analysis of protein immunoblotting results, it showed that the expression of SDX protein was missing or terminated prematurely, further proving that premature testicular failure and oligoasthenozoospermia were caused by abnormal SDX. The fluorescence signal of SDX protein in the test group was consistent with that in the control group: there was no mutation in the exon sequence of the SDX gene, and the results of protein immunoblotting showed that the size and content of SDX protein in the test group were no different from those in the control group, further excluding the possibility of abnormal SDX causing premature testicular failure and oligoasthenozoospermia.

[0228] If the exon sequence of the SDX gene is deleted or inserted in 3 integral multiples, and the results of protein immunoblotting show that the position of the SDX protein band in the test group has changed, the abnormally expressed SDX activity may be affected, and premature testicular failure and oligoasthenozoospermia may be related to SDX abnormalities. The coding protein sequence needs to be further determined, and the specific needs need to be combined with protein function verification. The fluorescence signal of the SDX protein in the test group is weakened: combined with the sequence variation information of the SDX genome sequencing and the analysis of the SDX expression results in the protein immunoblotting experiment, it can increase the possibility of judging that SDX causes premature testicular failure and oligoasthenozoospermia.

[0229] Finally, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. The use of SDX in the preparation of a diagnostic product for premature testicular failure or oligoasthenozoospermia, characterized in that: The application includes: detecting abnormalities in the SDX gene and / or abnormalities in the expression level of the SDX protein.

2. The use according to claim 1, characterized in that: The SDX gene abnormality includes at least one of the following abnormalities: a mutation in the promoter or enhancer sequence of the gene, and a single or multiple base sequence deletion, insertion or substitution in the gene coding sequence.

3. The use according to claim 1, characterized in that: The abnormal expression level of the SDX protein includes at least one of the following abnormalities: decreased expression of the SDX protein, premature termination or loss of expression of the SDX protein, and deletion, insertion or substitution of amino acids in important functional domains of the SDX protein.

4. The use according to claim 1, characterized in that: The testicular premature aging or oligoasthenozoospermia diagnostic product comprises an SDX gene detection kit and / or an SDX protein expression level detection kit, wherein the SDX gene detection kit comprises a whole genome sequencing detection reagent, and the SDX protein expression level detection kit comprises an antibody that specifically binds to the SDX protein.

5. Use of an antibody that specifically binds to SDX protein in the preparation of a testicular premature aging or oligoasthenozoospermia detection kit.

6. A mutant pathogenic gene associated with premature testicular failure or oligoasthenozoospermia, characterized in that: Compared with the nucleotide sequence of the SDX gene as shown in SEQ ID NO: 1, the nucleotide change of the mutant pathogenic gene is the presence of at least one of the following seven mutation sites: S219P (T655C), E257K (G769A), R549W (C1645T), R549Q (G1646A), P594H (C1781A), C647F (G1940T), and Q622E (C1864G).

7. Use of a reagent for detecting a mutated pathogenic gene associated with premature testicular failure or oligoasthenozoospermia as claimed in claim 6 in the preparation of a diagnostic product for premature testicular failure or oligoasthenozoospermia.

8. Use of SDX overexpression vector in the preparation of drugs for treating premature testicular failure or oligoasthenozoospermia.

9. The use according to claim 8, characterized in that: The SDX overexpression vector includes an AAV expression vector, and the construction method includes: inserting a gene fragment with a sequence as shown in SEQ ID NO.4 into the EcoRI / BamHI restriction site of the pAAV-CMV vector to obtain it.

10. Use of a substance that promotes SDX expression in the preparation of a drug for treating premature testicular failure or oligoasthenozoospermia.

11. A method for constructing a mouse model of SDX gene-related point mutation, characterized in that: The method comprises: The nucleotide sequences shown in SEQ ID NO.6-SEQ ID NO.7, SEQ ID NO.11-SEQ ID NO.12, SEQ ID NO.13-SEQ ID NO.14, SEQ ID NO.15-SEQ ID NO.16, SEQ ID NO.17-SEQ ID NO.18, SEQ ID NO.19-SEQ ID NO.20, and SEQ ID NO.21-SEQ ID NO.22 are respectively transcribed in vitro into mRNA to obtain transcribed sgRNA; Obtain active Cas9 mRNA; Obtaining targeting donors with nucleotide sequences as shown in SEQ ID NO.2-SEQ ID NO.5 respectively; The transcribed sgRNA, Cas9 mRNA and targeting donor are mixed and then microinjected into mouse fertilized eggs to obtain F0 generation mice; The F0 generation positive mice from the genotype identification results of the F0 generation mice are selected and mated with wild-type mice to obtain F1 generation mice with stable genotypes. After screening, a point mutation mouse model is obtained.

Images