Virus-derived constructor plasmids

Abstract

The present disclosure provides for the production of virus-derived constructive plasmids. In one aspect, the disclosure provides a plasmid encoding at least a portion of an element of a virus-derived construct. In one embodiment, the present disclosure provides plasmids that are operably linked so as to include at least a portion of a nucleic acid sequence necessary to constitute a virus-derived constituent. In one embodiment, a nucleic acid sequence necessary for constituting a virus-derived constituent includes: (A) a nucleic acid sequence containing a terminal repeat; (B) a nucleic acid sequence encoding a packaging factor; (C) a nucleic acid sequence encoding a structural protein; and (D) a nucleic acid sequence encoding a functional cofactor.

Description

Technical Field

[0001] The present disclosure provides plasmids for producing viral-derived constructs. The present disclosure also provides viral-derived constructs produced by plasmids and compositions comprising the same. Background Art

[0002] For the purpose of gene therapy and vaccine therapy, various virus-derived constructs such as adenovirus vectors (Patent Document 1) have been developed.

[0003] In order to prepare a construct derived from a virus, it is usually necessary to introduce a construct plasmid derived from a virus into a production cell. Therefore, it is necessary to synthesize and construct a construct plasmid derived from a virus. The designed construct plasmid derived from a virus is often synthesized and constructed in Escherichia coli and the like, and has not yet been synthesized and constructed in cells of other organisms.

[0004] Prior art literature

[0005] Patent Literature

[0006] Patent Document 1: International Publication No. 2001 / 090392 Summary of the invention

[0007] Means for solving problems

[0008] The inventor of the present application has found that a construct plasmid derived from a virus can be produced in a combination of a first microorganism and a second microorganism. Based on this view, the present disclosure provides a construct plasmid derived from a virus that can be replicated in the first microorganism and the second microorganism. In addition, the inventor of the present application has found a plasmid of a novel structure of a construct derived from a virus, and the present disclosure provides the plasmid. In addition, the present disclosure also provides a microorganism comprising a construct plasmid derived from a virus and a construct derived from a virus produced by a construct plasmid derived from a virus.

[0009] Therefore, the present disclosure provides the following solutions.

[0010] (Item 1)

[0011] A method for producing a viral-derived plasmid comprising:

[0012] i) a step of obtaining a viral-derived constitutive plasmid from a first microbial host cell, wherein the viral-derived constitutive plasmid comprises at least one of the nucleic acid sequences necessary for constituting a viral-derived construct; and

[0013] ii) A step of introducing the virus-derived constituent plasmid into a second microbial host cell and placing the second microbial host cell under conditions for amplifying the virus-derived constituent plasmid.

[0014] (Item 2)

[0015] A method for making a construct derived from a virus, comprising:

[0016] i) a step of obtaining a viral-derived constituent plasmid from a first microbial host cell, wherein the viral-derived constituent plasmid comprises at least one of the nucleic acid sequences necessary for constituting a viral-derived construct;

[0017] ii) the step of introducing the aforementioned viral-derived constituent plasmid into a second microbial host cell, and placing the aforementioned second microbial host cell under conditions for amplifying the aforementioned viral-derived constituent plasmid; and

[0018] iii) A step of introducing an introduction plasmid based on the aforementioned virus-derived construct plasmid into producer cells to form a virus-derived construct.

[0019] (Item 3)

[0020] A method as in any of the above items, wherein, between step ii) and step iii), a step is included for cloning a nucleic acid to prepare the introduction plasmid, wherein the nucleic acid comprises at least one of the nucleic acid sequences necessary for constituting the virus-derived construct in the aforementioned virus-derived construct plasmid.

[0021] (Item 4)

[0022] The method according to any one of the above items, wherein the production cell is an animal cell.

[0023] (Item 5)

[0024] A method as in any of the above items, wherein the aforementioned producer cells are human embryonic kidney cells, and each producer cell is provided with 4×10 3 The above viral vector genome copy number.

[0025] (Item 6)

[0026] A method as described in any of the above items, wherein the nucleic acid sequence necessary for constituting the virus-derived construct comprises

[0027] (A) a nucleic acid sequence containing a terminal repeat sequence;

[0028] (B) a nucleic acid sequence encoding a packaging factor;

[0029] (C) a nucleic acid sequence encoding a structural protein; and

[0030] (D) Nucleic acid sequence encoding a functional auxiliary factor.

[0031] (Item 7)

[0032] The method according to any one of the above items, wherein the introduction plasmid comprises the nucleic acid sequences (A) to (D).

[0033] (Item 8)

[0034] The method according to any one of the above items, wherein the first microbial host cell is Bacillus subtilis.

[0035] (Item 9)

[0036] The method according to any one of the above items, wherein the second microbial host cell is Escherichia coli.

[0037] (Item 10)

[0038] The method according to any one of the above items, wherein step i) comprises forming the aforementioned virus-derived constituent plasmid from the nucleic acid fragment.

[0039] (Item 11)

[0040] The method according to any one of the above items, wherein the nucleic acid fragment is a non-circular nucleic acid fragment having a tandemly repeated nucleic acid sequence.

[0041] (Item 12)

[0042] The method as in any of the above items, wherein step i) comprises contacting the competent first microbial host cell with a nucleic acid comprising at least one of the nucleic acid sequences necessary for constituting a construct derived from a virus.

[0043] (Item 13)

[0044] a plasmid which is operably linked to contain at least a portion of a nucleic acid sequence necessary for constituting a construct derived from a virus,

[0045] The nucleic acid sequences necessary for the aforementioned viral-derived constructs include:

[0046] (A) a nucleic acid sequence containing a terminal repeat sequence;

[0047] (B) a nucleic acid sequence encoding a packaging factor;

[0048] (C) a nucleic acid sequence encoding a structural protein; and

[0049] (D) a nucleic acid sequence encoding a functional auxiliary factor,

[0050] The plasmid contains at least two of the nucleic acid sequences (A) to (D).

[0051] (Item 14)

[0052] A plasmid according to any one of the above items, which is operably linked to contain the nucleic acid sequences of (A) to (D).

[0053] (Item 15)

[0054] The plasmid according to any one of the above items, wherein the nucleic acid sequence containing the terminal repeat sequence of (A) contains a desired gene.

[0055] (Item 16)

[0056] A plasmid according to any one of the above items, wherein the virus-derived construct is a virus-derived construct originating from an adeno-associated virus or a retrovirus.

[0057] (Item 17)

[0058] A plasmid according to any one of the above items, wherein the viral-derived construct is a viral vector derived from an adeno-associated virus.

[0059] (Item 18)

[0060] A plasmid according to any one of the above items, wherein the nucleic acid sequence containing a terminal repeat sequence of (A) comprises two inverted terminal repeat sequences (ITRs),

[0061] (B) The nucleic acid sequence encoding the packaging factor comprises rep,

[0062] (C) The nucleic acid sequence encoding the structural protein comprises cap,

[0063] The nucleic acid sequence encoding the functional auxiliary factor of (D) comprises at least one of E1A, E1B, E2A, E2B, E3, E4 and VA.

[0064] (Item 19)

[0065] The plasmid according to any one of the above items, wherein at least one of the two ITRs is derived from any one of serotypes 1 to 12 of adeno-associated virus and modified forms thereof.

[0066] (Item 20)

[0067] The plasmid according to any one of the above items, wherein the nucleic acid sequence of (B) comprises a rep derived from any one of serotypes 1 to 12 of adeno-associated virus and modified forms thereof.

[0068] (Item 21)

[0069] The plasmid according to any of the above items, wherein the nucleic acid sequence of (B) comprises a promoter different from the promoter of adeno-associated virus and at least one of rep78, rep76, rep52 and rep40 downstream thereof.

[0070] (Item 22)

[0071] The plasmid according to any one of the above items, wherein the promoter is a drug-responsive promoter.

[0072] (Item 23)

[0073] The plasmid according to any one of the above items, wherein the terminal repeat sequence of (A) and the nucleic acid sequence of (B) comprise nucleic acid sequences derived from different serotypes of adeno-associated viruses.

[0074] (Item 24)

[0075] The plasmid according to any one of the above items, wherein the nucleic acid sequence of (C) comprises a cap derived from any one of serotypes 1 to 12 of adeno-associated virus and modified forms thereof.

[0076] (Item 25)

[0077] The plasmid according to any of the above items, wherein the nucleic acid sequence of (C) comprises a promoter different from the promoter of adeno-associated virus and at least one of VP1, VP2 and VP3 downstream thereof.

[0078] (Item 26)

[0079] A plasmid according to any of the above items, wherein the nucleic acid sequence of (D) comprises a nucleic acid sequence encoding a functional auxiliary factor derived from any one of adenovirus, herpes virus, bocavirus, and modified forms thereof.

[0080] (Item 27)

[0081] The plasmid according to any one of the above items, wherein the nucleic acid sequence of (D) comprises a nucleic acid sequence derived from any one of adenovirus serotypes 1 to 52 and modified forms thereof.

[0082] (Item 28)

[0083] The plasmid according to any of the above items, wherein the nucleic acid sequence of (D) comprises a promoter different from the promoter of adeno-associated virus and at least one of E1A, E1B, E2A, E2B, E3 and E4 downstream thereof.

[0084] (Item 29)

[0085] The plasmid according to any one of the above items, wherein the promoter is a drug-responsive promoter.

[0086] (Item 30)

[0087] The plasmid according to any one of the above items, wherein the nucleic acid sequence containing the terminal repeat sequence of (A) comprises, from upstream, a 5' ITR, a promoter, a desired gene, a terminator, and a 3' ITR.

[0088] (Item 31)

[0089] A plasmid according to any one of the above items, wherein the viral-derived construct is a viral vector originating from a retrovirus.

[0090] (Item 32)

[0091] A plasmid according to any one of the above items, wherein the nucleic acid sequence containing a terminal repeat sequence of (A) comprises two long terminal repeat sequences (LTR),

[0092] (B) The nucleic acid sequence encoding the packaging factor comprises ψ,

[0093] (C) the nucleic acid sequence encoding the structural protein comprises at least one of gag, pol, VSV-G and env,

[0094] (D) The nucleic acid sequence encoding the functional auxiliary factor comprises Rev.

[0095] (Item 33)

[0096] The plasmid according to any one of the above items, comprising a drug-responsive promoter upstream of at least one of the nucleic acid sequences of (C) to (D).

[0097] (Item 34)

[0098] The plasmid according to any one of the above items, wherein the nucleic acid sequence containing the terminal repeat sequence of (A) comprises, from upstream, a 5'LTR, a promoter, a desired gene, a terminator, and a 3'LTR.

[0099] (Item 35)

[0100] A plasmid according to any one of the above items, wherein the nucleic acid sequence of (B) is present within the nucleic acid sequence of (A), and the nucleic acid sequences of (C) and (D) are present outside the nucleic acid sequence of (A).

[0101] (Item 36)

[0102] A plasmid according to any one of the above items, which is operably linked to contain 8 or more genes encoded by the nucleic acid sequences of (A) to (D).

[0103] (Item 37)

[0104] The plasmid according to any one of the above items, wherein a drug selection marker nucleic acid sequence is contained between any two genes encoded by the nucleic acid sequences of (A) to (D).

[0105] (Item 38)

[0106] The plasmid according to any one of the above items, wherein the nucleic acid sequence necessary for constituting the virus-derived construct is about 10 kb or more.

[0107] (Item 39)

[0108] A plasmid as described in any one of the above items, wherein the desired genes are 2 to 100 genes.

[0109] (Item 40)

[0110] A plasmid as in any of the above items, operably linked to comprise:

[0111] A nucleic acid sequence that promotes replication of the plasmid in a first microbial host cell; and

[0112] A nucleic acid sequence that promotes replication of the plasmid in a second microbial host cell.

[0113] (Item 41)

[0114] The plasmid according to any one of the above items, wherein the first microbial host cell is Bacillus subtilis.

[0115] (Item 42)

[0116] The plasmid according to any one of the above items, wherein the second microbial host cell is Escherichia coli.

[0117] (Item 43)

[0118] The plasmid of any of the above items, when introduced into human embryonic kidney cells as producer cells, provides 4×10 3 The above viral vector genome copy number.

[0119] (Item 44)

[0120] The plasmid according to any one of the above items, when introduced into human embryonic kidney cells as producer cells, provides 1×10 4 The above viral vector genome copy number.

[0121] (Item 45)

[0122] The plasmid according to any of the above items, which, when introduced into human embryonic kidney cells as producer cells, provides a viral vector having a viral vector particle number (VP / VG) of 15 or less relative to the viral vector genome copy number.

[0123] (Item 46)

[0124] The plasmid according to any of the above items, when introduced into human embryonic kidney cells as producer cells, provides a viral vector having a viral vector particle number (VP / VG) of 10 or less relative to the viral vector genome copy number.

[0125] (Item 47)

[0126] The plasmid according to any one of the above items, wherein the plasmid and the producer cell together contain the nucleic acid sequence necessary for constituting the virus-derived construct.

[0127] (Item 48)

[0128] A plasmid as in any of the above items, wherein the CCC (covalently closed circular) purity is greater than 80%.

[0129] (Item 49)

[0130] A microbial host cell comprising the plasmid of any one of the above items.

[0131] (Item 50)

[0132] A composition for preparing a virus-derived construct, comprising the plasmid according to any one of the above items.

[0133] (Item 51)

[0134] A method for producing a viral vector, comprising the step of introducing any of the plasmids described above into a production cell to form a virus-derived construct.

[0135] (Item 52)

[0136] The method according to any one of the above items, wherein at least a part of the nucleic acid contained in the aforementioned plasmid is integrated into the chromosome of the aforementioned producer cell.

[0137] (Item 53)

[0138] A construct derived from a virus, produced by any of the methods described above.

[0139] (Item 54)

[0140] A composition containing a virus-derived construct produced by any of the methods described above.

[0141] (Item 55)

[0142] A composition comprising a virus-derived construct according to any one of the above items, wherein the number of viral vector particles relative to the number of viral vector genome copies (VP / VG) is 15 or less.

[0143] (Item 56)

[0144] A producer cell, a producer cell into which the plasmid according to any one of the above items has been introduced, wherein at least a part of the nucleic acid contained in the plasmid is integrated into a chromosome of the producer cell.

[0145] (Project A1)

[0146] A method for producing a viral-derived plasmid comprising:

[0147] i) a step of obtaining a viral-derived constitutive plasmid from a first microbial host cell, wherein the viral-derived constitutive plasmid comprises at least one of the nucleic acid sequences necessary for constituting a viral-derived construct; and

[0148] ii) A step of introducing the virus-derived constituent plasmid into a second microbial host cell and placing the second microbial host cell under conditions for amplifying the virus-derived constituent plasmid.

[0149] (Project A2)

[0150] A method for making a construct derived from a virus, comprising:

[0151] i) a step of obtaining a viral-derived constituent plasmid from a first microbial host cell, wherein the viral-derived constituent plasmid comprises at least one of the nucleic acid sequences necessary for constituting a viral-derived construct;

[0152] ii) the step of introducing the aforementioned viral-derived constituent plasmid into a second microbial host cell, and placing the aforementioned second microbial host cell under conditions for amplifying the aforementioned viral-derived constituent plasmid; and

[0153] iii) A step of introducing an introduction plasmid based on the aforementioned virus-derived construct plasmid into producer cells to form a virus-derived construct.

[0154] (Item A3)

[0155] A method as in any of the above items, wherein, between step ii) and step iii), a step is included for cloning a nucleic acid to prepare the aforementioned introduction plasmid, wherein the nucleic acid comprises at least one of the nucleic acid sequences necessary for constituting the virus-derived construct in the aforementioned virus-derived construct plasmid.

[0156] (Item A4)

[0157] The method according to any one of the above items, wherein the production cell is an animal cell.

[0158] (Item A5)

[0159] A method as in any of the above items, wherein the aforementioned producer cells are human embryonic kidney cells, and each producer cell is provided with 4×10 3 The above viral vector genome copy number.

[0160] (Item A6)

[0161] A method as described in any of the above items, wherein step i) comprises obtaining the aforementioned virus-derived construct plasmid from a plurality of nucleic acid fragments comprising at least two nucleic acid fragments, wherein the at least two nucleic acid fragments comprise a vector partial nucleic acid sequence other than the nucleic acid sequence necessary to constitute the virus-derived construct.

[0162] (Item A7)

[0163] A method as described in any of the above items, wherein the aforementioned vector partial nucleic acid sequence comprises a nucleic acid sequence or a multiple cloning site having at least one function of nucleic acid replication, drug resistance, copy number adjustment, and stability improvement.

[0164] (Item A8)

[0165] The method as in any of the above items, wherein, before step i), comprises a step of preparing at least two of the plurality of nucleic acid fragments by chemical synthesis or enzymatic reaction.

[0166] (Item A9)

[0167] The method as in any of the above items, wherein, before step i), comprises a step of preparing all of the plurality of nucleic acid fragments by chemical synthesis or enzymatic reaction.

[0168] (Item A10)

[0169] A method as described in any of the above items, wherein the nucleic acid sequence necessary for constituting the virus-derived construct comprises:

[0170] (A) a nucleic acid sequence containing a terminal repeat sequence;

[0171] (B) a nucleic acid sequence encoding a packaging factor;

[0172] (C) a nucleic acid sequence encoding a structural protein; and

[0173] (D) Nucleic acid sequences encoding functional accessory factors.

[0174] (Item A11)

[0175] The method according to any one of the above items, wherein the introduction plasmid comprises the nucleic acid sequences (A) to (D).

[0176] (Item A12)

[0177] The method according to any one of the above items, wherein the first microbial host cell is Bacillus subtilis.

[0178] (Item A13)

[0179] The method according to any one of the above items, wherein the second microbial host cell is Escherichia coli.

[0180] (Item A14)

[0181] The method according to any one of the above items, wherein step i) comprises forming the aforementioned virus-derived constituent plasmid from the nucleic acid fragment.

[0182] (Item A15)

[0183] The method according to any one of the above items, wherein the nucleic acid fragment is a non-circular nucleic acid fragment having a tandemly repeated nucleic acid sequence.

[0184] (Item A16)

[0185] The method as in any of the above items, wherein step i) comprises contacting the competent first microbial host cell with a nucleic acid comprising at least one of the nucleic acid sequences necessary for constituting a construct derived from a virus.

[0186] (Item A17)

[0187] A viral-derived plasmid prepared by any of the methods described above.

[0188] (Item A18)

[0189] A virus-derived construct prepared by any of the methods described above.

[0190] (Item A19)

[0191] A composition containing a virus-derived structure, prepared by any of the methods described above.

[0192] (Item A20)

[0193] a plasmid which is operably linked to contain at least a portion of a nucleic acid sequence necessary for constituting a construct derived from a virus,

[0194] The nucleic acid sequences necessary for the aforementioned viral-derived constructs include:

[0195] (A) a nucleic acid sequence containing a terminal repeat sequence;

[0196] (B) a nucleic acid sequence encoding a packaging factor;

[0197] (C) a nucleic acid sequence encoding a structural protein; and

[0198] (D) a nucleic acid sequence encoding a functional auxiliary factor,

[0199] The plasmid contains at least two of the nucleic acid sequences (A) to (D).

[0200] (Item A21)

[0201] A plasmid according to any one of the above items, which is operably linked to contain the nucleic acid sequences of (A) to (D).

[0202] (Item A22)

[0203] The plasmid according to any one of the above items, wherein the nucleic acid sequence containing the terminal repeat sequence of (A) contains a desired gene.

[0204] (Item A23)

[0205] A plasmid according to any one of the above items, wherein the virus-derived construct is a virus-derived construct originating from an adeno-associated virus or a retrovirus.

[0206] (Item A24)

[0207] A plasmid according to any one of the above items, wherein the viral-derived construct is a viral vector derived from an adeno-associated virus.

[0208] (Item A25)

[0209] A plasmid according to any one of the above items, wherein the nucleic acid sequence containing a terminal repeat sequence of (A) comprises two inverted terminal repeat sequences (ITRs),

[0210] (B) The nucleic acid sequence encoding the packaging factor comprises rep,

[0211] (C) The nucleic acid sequence encoding the structural protein comprises cap,

[0212] The nucleic acid sequence encoding the functional auxiliary factor of (D) comprises at least one of E1A, E1B, E2A, E2B, E3, E4 and VA.

[0213] (Item A26)

[0214] The plasmid according to any one of the above items, wherein at least one of the two ITRs is derived from any one of serotypes 1 to 12 of adeno-associated virus and modified forms thereof.

[0215] (Item A27)

[0216] The plasmid according to any one of the above items, wherein the nucleic acid sequence of (B) comprises a rep derived from any one of serotypes 1 to 12 of adeno-associated virus and modified forms thereof.

[0217] (Item A28)

[0218] The plasmid according to any of the above items, wherein the nucleic acid sequence of (B) comprises a promoter different from the promoter of adeno-associated virus and at least one of rep78, rep76, rep52 and rep40 downstream thereof.

[0219] (Item A29)

[0220] The plasmid according to any one of the above items, wherein the promoter is a drug-responsive promoter.

[0221] (Project A30)

[0222] The plasmid according to any one of the above items, wherein the terminal repeat sequence of (A) and the nucleic acid sequence of (B) comprise nucleic acid sequences derived from different serotypes of adeno-associated viruses.

[0223] (Item A31)

[0224] The plasmid according to any one of the above items, wherein the nucleic acid sequence of (C) comprises a cap derived from any one of serotypes 1 to 12 of adeno-associated virus and modified forms thereof.

[0225] (Item A32)

[0226] The plasmid according to any of the above items, wherein the nucleic acid sequence of (C) comprises a promoter different from the promoter of adeno-associated virus and at least one of VP1, VP2 and VP3 downstream thereof.

[0227] (Item A33)

[0228] A plasmid according to any of the above items, wherein the nucleic acid sequence of (D) comprises a nucleic acid sequence encoding a functional auxiliary factor derived from any one of adenovirus, herpes virus, bocavirus, and modified forms thereof.

[0229] (Item A34)

[0230] The plasmid according to any one of the above items, wherein the nucleic acid sequence of (D) comprises a nucleic acid sequence derived from any one of adenovirus serotypes 1 to 52 and modified forms thereof.

[0231] (Item A35)

[0232] The plasmid according to any of the above items, wherein the nucleic acid sequence of (D) comprises a promoter different from the promoter of adeno-associated virus and at least one of E1A, E1B, E2A, E2B, E3 and E4 downstream thereof.

[0233] (Item A36)

[0234] The plasmid according to any one of the above items, wherein the promoter is a drug-responsive promoter.

[0235] (Item A37)

[0236] The plasmid according to any one of the above items, wherein the nucleic acid sequence containing the terminal repeat sequence of (A) comprises, from upstream, a 5' ITR, a promoter, a desired gene, a terminator, and a 3' ITR.

[0237] (Item A38)

[0238] A plasmid according to any one of the above items, wherein the viral-derived construct is a viral vector originating from a retrovirus.

[0239] (Item A39)

[0240] A plasmid according to any one of the above items, wherein the nucleic acid sequence containing a terminal repeat sequence of (A) comprises two long terminal repeat sequences (LTR),

[0241] (B) The nucleic acid sequence encoding the packaging factor comprises ψ,

[0242] (C) the nucleic acid sequence encoding the structural protein comprises at least one of gag, pol, VSV-G and env,

[0243] (D) The nucleic acid sequence encoding the functional auxiliary factor comprises Rev.

[0244] (Item A40)

[0245] The plasmid according to any one of the above items, comprising a drug-responsive promoter upstream of at least one of the nucleic acid sequences of (C) to (D).

[0246] (Item A41)

[0247] The plasmid according to any one of the above items, wherein the nucleic acid sequence containing the terminal repeat sequence of (A) comprises, from upstream, a 5'LTR, a promoter, a desired gene, a terminator, and a 3'LTR.

[0248] (Item A42)

[0249] A plasmid according to any one of the above items, wherein the nucleic acid sequence of (B) is present within the nucleic acid sequence of (A), and the nucleic acid sequences of (C) and (D) are present outside the nucleic acid sequence of (A).

[0250] (Item A43)

[0251] A plasmid according to any one of the above items, which is operably linked to contain 8 or more genes encoded by the nucleic acid sequences of (A) to (D).

[0252] (Item A44)

[0253] The plasmid according to any one of the above items, wherein a drug selection marker nucleic acid sequence is contained between any two genes encoded by the nucleic acid sequences of (A) to (D).

[0254] (Item A45)

[0255] The plasmid according to any one of the above items, wherein the nucleic acid sequence necessary for constituting the virus-derived construct is about 10 kb or more.

[0256] (Item A46)

[0257] A plasmid as described in any one of the above items, wherein the desired genes are 2 to 100 genes.

[0258] (Item A47)

[0259] A plasmid as in any of the above items, operably linked to comprise:

[0260] A nucleic acid sequence that promotes replication of the plasmid in a first microbial host cell; and

[0261] A nucleic acid sequence that promotes replication of the plasmid in a second microbial host cell.

[0262] (Item A48)

[0263] The plasmid according to any one of the above items, wherein the first microbial host cell is Bacillus subtilis.

[0264] (Item A49)

[0265] The plasmid according to any one of the above items, wherein the second microbial host cell is Escherichia coli.

[0266] (Item A50)

[0267] The plasmid of any of the above items, when introduced into human embryonic kidney cells as producer cells, provides 4×10 3 The above viral vector genome copy number.

[0268] (Item A51)

[0269] The plasmid according to any one of the above items, when introduced into human embryonic kidney cells as producer cells, provides 1×10 4 The above viral vector genome copy number.

[0270] (Item A52)

[0271] The plasmid according to any of the above items, which, when introduced into human embryonic kidney cells as producer cells, provides a viral vector having a viral vector particle number (VP / VG) of 15 or less relative to the viral vector genome copy number.

[0272] (Item A53)

[0273] The plasmid according to any of the above items, when introduced into human embryonic kidney cells as producer cells, provides a viral vector having a viral vector particle number (VP / VG) of 10 or less relative to the viral vector genome copy number.

[0274] (Item A54)

[0275] The plasmid according to any one of the above items, wherein the plasmid and the producer cell together contain the nucleic acid sequence necessary for constituting the virus-derived construct.

[0276] (Item A55)

[0277] A plasmid as in any of the above items, wherein the CCC (covalently closed circular) purity is 80% or more.

[0278] (Item A56)

[0279] The plasmid according to any one of the above items comprises at least two nucleic acid fragments produced by chemical synthesis or enzymatic reaction and containing a vector partial nucleic acid sequence in the nucleic acid fragment.

[0280] (Item A57)

[0281] The plasmid according to any of the above items is obtained by merely circularizing a plurality of nucleic acid fragments produced by chemical synthesis or enzyme reaction.

[0282] (Item A58)

[0283] The plasmid according to any one of the above items, wherein the nucleic acid fragment comprises three or more nucleic acid fragments.

[0284] (Item A59)

[0285] A plasmid according to any one of the above items, wherein each of the nucleic acid fragments has a length of 2 kb or less.

[0286] (Item A60)

[0287] The plasmid according to any one of the above items, wherein the vector partial nucleic acid sequence accounts for less than 40% of the entire sequence of the viral-derived constituent plasmid.

[0288] (Item A61)

[0289] A plasmid as in any of the above items, wherein the aforementioned vector partial nucleic acid sequence contains a nucleic acid sequence having at least one function of nucleic acid replication, drug resistance, copy number adjustment, and stability improvement, and the aforementioned virus-derived constituent plasmid contains restriction endonuclease recognition sequences upstream and downstream of the aforementioned vector partial nucleic acid sequence, and a sequence identical to the aforementioned restriction endonuclease recognition sequence is not included in the aforementioned nucleic acid sequence necessary for constituting the virus-derived construct.

[0290] (Item A62)

[0291] A microbial host cell comprising the plasmid of any one of the above items.

[0292] (Item A63)

[0293] A composition for preparing a virus-derived construct, comprising the plasmid according to any one of the above items.

[0294] (Item A64)

[0295] A method for producing a viral vector, comprising the step of introducing any of the plasmids described above into a production cell to form a virus-derived construct.

[0296] (Item A65)

[0297] The method according to any one of the above items, wherein at least a part of the nucleic acid contained in the aforementioned plasmid is integrated into the chromosome of the aforementioned producer cell.

[0298] (Item A66)

[0299] A construct derived from a virus, produced by any of the methods described above.

[0300] (Item A67)

[0301] A composition containing a virus-derived construct produced by any of the methods described above.

[0302] (Item A68)

[0303] A composition comprising a virus-derived construct according to any one of the above items, wherein the number of viral vector particles relative to the number of viral vector genome copies (VP / VG) is 15 or less.

[0304] (Item A69)

[0305] A producer cell, a producer cell into which the plasmid according to any one of the above items has been introduced, wherein at least a part of the nucleic acid contained in the plasmid is integrated into the chromosome of the producer cell.

[0306] In the present disclosure, one or more of the above features are intended to be provided in combination in addition to being provided in the combination explicitly shown. Further embodiments and advantages of the present disclosure can be known by those skilled in the art by reading and understanding the following detailed description as needed.

[0307] Effects of the Invention

[0308] According to the present disclosure, based on viral-derived construct plasmids, viral-derived constructs can be produced in an improved manner not previously possible. BRIEF DESCRIPTION OF THE DRAWINGS

[0309] [ Figure 1 ] represents the structure of pGETS103-AAV-Helper-RC2 plasmid (all-in-one structure).

[0310] [ Figure 2 ] represents the outline of constructing pGETS103-AAV-Helper-RC2 plasmid from 22 fragments using the OGAB method. The portion surrounded by the dotted line represents the portion removed by AarI cutting (capital letters represent sequences derived from the linker, and lowercase letters represent sequences derived from the vector). The 1st, 3rd and 16th fragments were obtained by chemical synthesis and MAP method. Other fragments were obtained by PCR.

[0311] [ Figure 3 ] shows the results of electrophoresis of the pGETS103-AAV-Helper-RC2 plasmid constructed by the OGAB method.

[0312] [ Figure 4 ] shows the structure of plasmid pGETS118-AarI and the nucleic acid introduction site. The dotted line encloses the portion removed by AarI cleavage.

[0313] [ Figure 5 ] shows seven additional integrated structures introduced into pGETS118-AarI for the production of AAV vectors. The hollow squares shown below each integrated structure represent the number of unit DNA used in the construction and the approximate corresponding regions.

[0314] [ Figure 6 ] indicates the structure of pAAV-CMV plasmid.

[0315] [ Figure 7 ] indicates the structure of pRC2-mi342 plasmid.

[0316] [ Figure 8 ] indicates the structure of pHelper plasmid.

[0317] [ Fig. 9 ] indicates the structure of pGETS103-AAV plasmid.

[0318] [ Fig.10 ] indicates the structure of pGETS103-Helper plasmid.

[0319] [ Fig.11 ] indicates the structure of pGETS103-RC2 plasmid.

[0320] [ Fig.12 ] shows the results of viral vector production from plasmids rAAV#1 to 5. The vertical axis represents the production amount of viral genome (VG: left) or viral particles (VP: right) from each plasmid.

[0321] [ Fig.13 ] shows the results of viral vector production from plasmids rAAV#6 and #7. The vertical axis represents the production of viral genomes (VG: left) or viral particles (VP: right) from each plasmid.

[0322] [ Fig.14 ] shows the structure of pGETS151-AAV-Helper-RC2 plasmid (integrated structure).

[0323] [ Fig.15 ] shows the results of viral vector production from plasmids rAAV#8 and #9. The vertical axis represents the production amount of viral genome (VG) from each plasmid.

[0324] [ Fig.16] shows the results of viral vector production from plasmids rAAV#10 and #11. The vertical axis shows the production amount of viral genome (VG) from each plasmid.

[0325] [ Fig.17 ] represents an integrated structure for producing adenoviral vectors. The hollow squares shown below represent the number of DNA units used in the construction and the approximate corresponding regions. GOI represents the desired gene.

[0326] [ Fig.18 ] indicates the structure of plasmid pBET131-AarI and the nucleic acid introduction site. The portion surrounded by the dotted line indicates the portion removed by AarI cleavage.

[0327] [ Fig.19 ] shows the structure of an AAV integrated vector plasmid based on pGETS103-ΔAarI, using Rep of AAV1 and Cap of AAV6. The hollow squares shown below the integrated structure indicate the number of unit DNAs used in the construction and the approximate corresponding regions.

[0328] [ Fig. 20 ] shows the structure of an AAV integrated vector plasmid based on pGETS103-ΔAarI, using a CAG promoter, Rep of AAV5 and Cap of AAV1. The hollow squares shown below the integrated structure indicate the number of unit DNAs used in the construction and the approximate corresponding regions.

[0329] [ Fig.21 ] shows the structure of an AAV integrated vector plasmid based on pGETS103-ΔAarI, using the EF1α promoter, Rep of AAV8 and Cap of AAV9. The hollow squares shown below the integrated structure indicate the number of unit DNAs used in the construction and the approximate corresponding regions.

[0330] [ Fig. 22 ] represents the structure of an AAV integrated vector plasmid based on pGETS103-ΔAarI, with Rep, Cap and Helper configured in different orders. This is also an example of using the SV40 promoter. The hollow squares shown below the integrated structure represent the number of unit DNA used in the construction and the approximate corresponding regions.

[0331] [ Fig.23 ] represents the structure of an AAV integrated vector plasmid based on pBETS131-AarI, in which Rep, Cap and Helper are arranged in different orders. The hollow squares shown below the integrated structure represent the number of unit DNAs used in the construction and the approximate corresponding regions.

[0332] [ Fig.24] represents the structure of an AAV integrated vector plasmid based on pBETS103-ΔAarI with the Helper gene element changed. The hollow squares shown below the integrated structure represent the number of unit DNAs used in the construction and the approximate corresponding regions.

[0333] [ Fig.25 ] represents the structure of an exemplary lentiviral vector plasmid constructed based on pGETS103ΔAarI.

[0334] [ Fig.26 ] represents the structure of an exemplary retroviral vector plasmid constructed based on pGETS103ΔAarI.

[0335] [ Fig. 27 ] represents the structure of an exemplary adenoviral vector plasmid constructed based on pGETS103ΔAarI.

[0336] [ Fig.28 ] represents the structure of a viral vector plasmid obtained by attempting to construct the overall structure from nucleic acid fragments obtained by complete chemical synthesis or enzymatic synthesis using the OGAB method.

[0337] [ Fig.29 ] shows the structure of pGETS151-AAV-EGFP-WRPE-Helper-RC2 plasmid.

[0338] [ Fig.30 ] shows the structure of pAAV-EGFP-WRPE plasmid.

[0339] [ Fig.31 ] shows the results of producing viral vectors by pGETS151-AAV-EGFP-WRPE-Helper-RC2 plasmid (single-transfection method) and triple-transfection method containing the same viral vector constituting genes. The vertical axis shows the production amount of viral genome (VG) from each plasmid. DETAILED DESCRIPTION

[0340] Below, the best way is shown to illustrate the present disclosure. In the full text of this specification, as long as there is no special explanation, the expression in the singular form should be understood as also including the concept of its plural form. Therefore, as long as there is no special explanation, the article in the singular form (for example, in the case of English, "a", "an", "the", etc.) should be understood as also including the concept of its plural form. In addition, as long as there is no special explanation, the terms used in this specification should be understood as being used with the meaning commonly used in this art. Therefore, as long as there is no special explanation, all the technical terms and scientific and technical terms used in this specification have the same meaning as the technicians in the field to which the present disclosure belongs. When there is a conflict, this specification (including definitions) takes precedence.

[0341] Hereinafter, definitions of terms particularly used in this specification and / or basic technical contents will be described as appropriate.

[0342] As used herein, the term "plasmid" refers to a circular DNA that exists separately from chromosomes in cells or exists separately from chromosomes when introduced into cells.

[0343] In this specification, the so-called "nucleic acid sequence that promotes plasmid replication" is used with the same meaning as "nucleic acid sequence that promotes plasmid amplification", and refers to any nucleic acid sequence that promotes the replication (in this context, the same as amplification) of the plasmid present in the host cell when it is introduced into the host cell (for example, Bacillus subtilis). Preferably, the nucleic acid sequence that promotes plasmid replication is linked to the nucleic acid sequence encoding the plasmid as the object in a workable manner, but is not limited thereto. The details of the nucleic acid sequence that promotes plasmid replication, the plasmid as the object, their relationship, etc. are recorded in other parts of this specification. As the nucleic acid sequence that promotes plasmid replication, the nucleic acid sequence of the replication origin that works in the host cell as the object (for example, Bacillus subtilis) etc. can be cited. For example, the nucleic acid sequence that promotes plasmid replication in Bacillus subtilis has the ability to promote the replication of the plasmid in Bacillus subtilis, but can also have the ability to promote the replication of the plasmid in the microorganism (for example, Escherichia coli) other than Bacillus subtilis. The nucleic acid sequence that promotes plasmid replication in Bacillus subtilis and other organisms (e.g., E. coli) may be a nucleic acid sequence used to promote plasmid replication in the same region in both Bacillus subtilis and other organisms (e.g., E. coli), may be a continuous sequence on a plasmid that is derived from a virus in the present disclosure, or may be a sequence located in a separate location. For example, plasmid pSTK1 (Issay Narumt et al., BIOTECHNOLOGY LETTERS, Vol. 17, No. 5 (May 1995) pp. 475-480) and plasmid pBS195 (Molekuliarnaia Genetika et al., May 1, 1991, (5): 26-29, PMID: 1896058) are shown to be able to replicate in the same replication initiation region in both Bacillus subtilis and E. coli, and such a nucleic acid sequence can be used as a nucleic acid sequence that promotes plasmid replication in both Bacillus subtilis and E. coli. In addition, the shuttle plasmid prepared by connecting BR322 (Escherichia coli plasmid) and pC194 (Bacillus subtilis plasmid) (P Trieu-Cuot et al., EMBO J. 1985 Dec 16; 4 (13A): 3583-3587), and the plasmid of the Bacillus subtilis Secretory Protein Expression System (B. subtilis Secretory Protein Expression System) containing pUBori and ColE1 ori provided by Takara Bio (Shiga Prefecture) can be replicated in both Escherichia coli and Bacillus subtilis, and such separately located nucleic acid sequences can also be used as nucleic acid sequences that promote plasmid replication in both Bacillus subtilis and Escherichia coli.As the replication mechanism of nucleic acid (plasmid) in Bacillus subtilis, rolling circle type, θ type, oriC, replication mechanism using bacteriophage, etc. can be cited, and as a sequence that can be replicated in Bacillus subtilis, a sequence using any mechanism can be used. The rolling circle type replication mechanism is a mechanism in which a single strand of a double-stranded DNA is replicated and then the other strand is replicated. Since the nucleic acid exists in the form of single-stranded DNA for a long time, there is a tendency for the plasmid to become unstable. The θ-type replication mechanism is a mechanism that starts the replication of double-stranded DNA (plasmid) in two directions simultaneously from the replication origin in the same manner as the replication of bacterial chromosomes, and can be preferably used in the replication of long DNA (e.g., 10 kb or more) such as the present disclosure (Janniere, L., A. Gruss, and SD Ehrlich. 1993. Plasmids, p. 625-644. In A. L. Sonenshein, JA Hoch, and R. Lo sick (ed.), Bacillus subtilis and other gram-positive bacteria: biochemistry, physiology and molecular genetics. American Society for Microbiology, Washington, DC). The replication mechanism of oriC works in the same manner as the replication of the host bacterium (e.g., Bacillus subtilis) chromosome. As the nucleic acid sequence that promotes plasmid replication in Bacillus subtilis, there can be mentioned plasmids or parts thereof or replication origins, or modified forms thereof, which are known to enable rolling circle type, θ type, or oriC, replication mechanisms utilizing bacteriophage, etc. to operate. As rolling circle type plasmids, pUB110, pC194, pE194, pT181, etc. are known, and as θ type plasmids, pAMβ1, pTB19, pLS32, pLS20, etc. are known. The nucleic acid sequence that promotes plasmid replication in Bacillus subtilis may have a sequence that is identical or similar to a known replication origin (e.g., sequence identity of 90% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 99.5% or more). For example, when a DNA fragment formed by linking a candidate DNA fragment to a selection marker gene effective in Bacillus subtilis, such as a drug resistance gene, is introduced into Bacillus subtilis and cultured (with the addition of a drug, etc.), and the DNA fragment is replicated outside the chromosome, it can be determined that the candidate DNA fragment has a nucleic acid sequence that promotes plasmid replication in Bacillus subtilis. The nucleic acid sequence that promotes plasmid amplification is a DNA fragment with a replication initiation point, and refers to a DNA fragment that can replicate independently of chromosomal DNA.Whether these DNA fragments can replicate can be confirmed by the following methods: linking a selection marker gene such as a drug resistance gene to these DNA fragments, culturing under a selection condition such as a drug, purifying the plasmid DNA, and observing the bands of the DNA by electrophoresis; etc. In addition to the replication origin, the plasmid may also contain a gene for a rep protein that induces the host's DNA replication enzyme at the replication origin, a distribution mechanism gene for reliably distributing the plasmid to daughter cells, a selection marker gene, etc. The replication origin may also be fused to the gene for the rep protein.

[0344] As used herein, the term "packaging cell" refers to a cell used to produce viral-derived constituent plasmids.

[0345] When used in this specification, the so-called "virus-derived construct plasmid" refers to a plasmid containing a gene carried in a virus-derived construct and used to produce a virus-derived construct in a producer cell. The virus-derived construct plasmid contains a sequence of a gene (desired gene) that is expressed in the target cell of the virus-derived construct between two terminal repeat sequences, and may also contain a promoter, and may further contain other elements (e.g., enhancer, terminator, etc.).

[0346] When used in this specification, the so-called "producer cell" refers to a cell that can produce the desired viral-derived construct, and can be a cell that uses chromosomes and introduced plasmids to express genes necessary for the production of viral-derived constructs. By introducing the viral-derived construct plasmid of the present disclosure into the producer cell, the desired viral-derived construct can be produced. For example, in the case of an AAV vector, its production requires E1A and E1B, and HEK293 has these genes, so these genes can be removed from the auxiliary plasmid. Even other cells can function as producer cells as long as they are modified in a manner that has such functional auxiliary factors.

[0347] In this specification, "transformed organism" refers to an organism that can be used in the OGAB method, takes in a non-circular long-chain nucleic acid and can generate a plasmid. As a transformed organism, a microorganism that spontaneously takes in nucleic acid can be used. A representative transformed organism is Bacillus subtilis.

[0348] In this specification, the so-called "Bacillus subtilis" is an aerobic Gram-positive catalase-positive bacterium that is commonly found in soil and plants and exists in the gastrointestinal tract of ruminants and humans, has a size of 0.7-0.8×2-3 μm, is mesophilic, has an optimal growth temperature of 25-40°C, and is believed to be able to form spores. It refers to any bacteria that is not pathogenic but has natural transformation ability, including Bacillus subtilis or Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus pumilus, etc., which are closely related to the genus Bacillus. In a preferred embodiment, Bacillus subtilis is the RM125 strain of Marburg 168 or its derivative strains, which is a strain with high natural transformation ability among Bacillus subtilis. Strain 168 is the most genetically studied Gram-positive bacterium and can be obtained from ATCC (American Type Culture Collection) together with strain RM125. It is harmless to humans and animals and has been shown to be applicable to the OGAB method. Considering the above aspects, it can be preferably used in the present disclosure.

[0349] In this specification, the term "microorganism" refers to organisms other than true bacteria and archaea, and also includes small (for example, less than 1 mm, or less than 0.1 mm, or invisible to the naked eye) algae, protists, fungi (mold, Japanese: カビ, fungi, etc.), yeasts, and animals (protozoa, metazoa, etc.).

[0350] In the present specification, "animal cells" refer to cells obtained from animals (human, mouse, rat, monkey, dog, etc.) or cells modified from cells obtained from animals.

[0351] In this specification, the so-called "construct derived from a virus" refers to a nucleic acid construct having at least partially a structure derived from a virus or a construct containing a protein produced therefrom. As a construct derived from a virus, viral vectors, virus-like particles (VLPs), oncolytic viruses (including viruses modified to proliferate only in cancer cells), and viral replicons (self-replicating viral genomes that lack the ability to produce viral particles) can be cited.

[0352] As used herein, the term "viral vector" refers to a construct that has at least a partial structure derived from a virus and can introduce a nucleic acid into a target cell. Typically, a viral vector is in the form of a viral particle containing viral structural proteins and a nucleic acid containing a heterologous gene.

[0353] In this specification, the so-called "nucleic acid sequence necessary for constituting a construct derived from a virus" refers to a nucleic acid sequence (for example, a combination of nucleic acid sequences) that enables a production cell containing it to produce a construct derived from a virus. In one embodiment, the nucleic acid sequence necessary for constituting a construct derived from a virus includes: a nucleic acid sequence encoding a structural protein of the virus; a nucleic acid sequence encoding a packaging factor; two terminal repeat sequences of the virus; and a nucleic acid sequence encoding a functional auxiliary factor. The so-called "nucleic acid sequence encoding a functional auxiliary factor", for example, may include or essentially become any nucleic acid sequence necessary for constituting a construct derived from a virus other than a nucleic acid sequence encoding a structural protein of the virus, a nucleic acid sequence encoding a packaging factor, and two terminal repeat sequences of the virus. The above-mentioned various nucleic acid sequences may be different for each construct derived from a virus. Their details are described in other parts of this specification. In a preferred embodiment, the nucleic acid sequence necessary for constituting a construct derived from a virus can utilize favorable sequences common to AAV and adenovirus, and more preferably, sequences favorable to AAV can be utilized. Such favorable sequences common to AAV and adenovirus have the characteristics of including the desired gene between the inverted terminal repeats (ITRs), and may also include functional auxiliary factors, rep, cap, or L1, L2, L3, L4, and L5. The sequence favorable to AAV includes the desired gene between the ITRs, and may also include functional auxiliary factors, rep, and cap. It has the characteristic that the configuration of functional auxiliary factors, rep, and cap may also be outside the two ITRs. For example, as such an example, the sequences of specific functional auxiliary factors E1A, E1B, E2A, E2B, E3, and E4 can be cited, but it is not limited to this.

[0354] In this specification, the so-called "packaging factor" includes proteins that encapsulate the genome of the virus in structural proteins, such as rep and ψ. Although not intended to be limiting, the packaging factor can be derived from adenovirus serotypes 1 to 52 or adeno-associated virus serotypes 1 to 12, or any of their modified forms (rh10, DJ, DJ / 8, PHP.eB, PHP.S, AAV2-retro, AAV2-QuadYF, AAV2.7m8, AAV6.2, rh.74, AAV2.5, AAV-TT, Anc80, etc.). The protein can be a natural protein or a protein obtained by artificially introducing mutations. The protein obtained by "artificially introducing mutations" can be made, for example, by introducing appropriate mutations into the sequence of a natural protein recorded in a known document.

[0355] As used herein, "structural protein" refers to a protein at least part of which is present on the surface of a virus or a construct derived from a virus (eg, across the envelope) and is produced by a gene possessed by the virus. Structural proteins may be responsible for infectivity to cells.

[0356] As used herein, the term "capsid" refers to a protein present on the surface of a virus or a construct derived from a virus (enclosed in an envelope as necessary) and produced by a gene possessed by the virus, and is also referred to as a "capsid protein."

[0357] In this specification, the so-called "repetitive sequence" or "tandem repeat" (nucleic acid sequence) is a general term for nucleic acid sequences in which the same sequence is repeated (especially more than several times) in the nucleic acid sequence of the genome of an organism. Any repetitive sequence used in the art can be used in this disclosure. Typically, the promoter sequence is repeated.

[0358] In this specification, "terminal repeat sequence" is a general term for the nucleic acid sequence present at the end in the nucleic acid sequence in which the same sequence is repeated (especially several times or more) in the nucleic acid sequence of the biological genome. As terminal repeat sequences, terminal inverted repeat sequences (ITR) or long terminal repeat sequences (LTR) can be cited, but are not limited to these. The terminal repeat sequence can be derived from the terminal repeat sequence of any one of serotypes 1 to 52 of adenovirus or serotypes 1 to 12 of adeno-associated virus, or its modified body (rh10, DJ, DJ / 8, PHP.eB, PHP.S, AAV2-retro, AAV2-QuadYF, AAV2.7m8, AAV6.2, rh.74, AAV2.5, AAV-TT, Anc80, etc.). As a terminal repeat sequence, it can be a natural terminal repeat sequence or a terminal repeat sequence obtained by artificially introducing mutations. The terminal repeat sequence obtained by "artificially introducing mutations" can be made, for example, by introducing appropriate mutations into the natural terminal repeat sequence recorded in the known literature.

[0359] In this specification, the so-called "functional auxiliary factor" refers to a gene that assists the amplification of a virus that cannot proliferate alone. In the present disclosure, for example, the functional auxiliary factor includes any nucleic acid sequence necessary for constituting a construct derived from the virus, proliferating the construct derived from the virus, increasing activity, and reducing toxicity, except for the nucleic acid sequence encoding the structural protein of the virus, the nucleic acid sequence encoding the packaging factor of the virus, and the two terminal repeat sequences of the virus, but is not limited to these. As functional auxiliary factors that can be used, for example, E1A, E1B, E2A, E2B, E4, RPE, WRPE, PPT, oPRE, enhancer, insulator, silencer sequence, etc. can be mentioned, but are not limited to these.

[0360] In the case of using in this manual, so-called "carrying (loaded) nucleic acid" refers to the nucleic acid carried by the construct (viral vector etc.) derived from the virus. About whether it is to carry nucleic acid, it can be confirmed in the following manner: the construct preparation derived from the virus is treated with DNase, after the nucleic acid outside the virus particle is decomposed, the DNase is inactivated, and then the nucleic acid extracted from the virus particle is confirmed. About whether it is to carry nucleic acid, it can also be confirmed by investigating the sequence (preferably the sequence of the length of the total length or close to the total length) of the nucleic acid product obtained.

[0361] As used herein, the term "host cell" refers to a cell into which an exogenous nucleic acid or protein, or a virus or a construct derived from a virus has been introduced (including the progeny of such a cell).

[0362] In this specification, "protein", "polypeptide" and "peptide" are used with the same meaning and refer to polymers of amino acids of any length. The polymer may be straight chain, branched chain or cyclic. The amino acid may be natural amino acid, non-natural amino acid or modified amino acid. In addition, the term also includes natural or artificially modified polymers. Such modifications include, for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation or any other operation or modification (for example, conjugation with a labeling component).

[0363] In this specification, "polynucleotide" and "nucleic acid" are used with the same meaning, and refer to polymers of nucleotides of any length. Examples of nucleic acids include DNA, RNA, cDNA, mRNA, rRNA, tRNA, microRNA (miRNA), and lncRNA. The term also includes "polynucleotide derivatives". The so-called "polynucleotide derivative" refers to a polynucleotide containing a nucleotide derivative or a polynucleotide having a different internucleotide bond than usual. The term "nucleotide derivative" refers to a nucleotide having a structure different from that of a normal nucleotide used in natural DNA or RNA, and includes, for example, locked nucleic acid (LNA), ethylene nucleic acids such as 2'-O,4'-C-ethylene bridged nucleic acid (ENA), other bridged nucleic acids (BNA), hexitol nucleic acid (HNA), amide-bridged nucleic acid (AmNA), morpholino nucleic acid, tricyclic-DNA (tcDNA), polyether nucleic acid (see, for example, U.S. Patent No. 5,908,845), cyclohexene nucleic acid (Ce NA), etc. Examples of internucleotide bonds different from the normal ones include internucleotide bonds formed by converting a phosphodiester bond into a phosphorothioate bond, internucleotide bonds formed by converting a phosphodiester bond into an N3'-P5' phosphoramidate bond, and internucleotide bonds formed by converting a ribose and phosphodiester bond into a peptide nucleic acid bond.

[0364] Unless otherwise indicated, it is expected that a specific nucleic acid sequence, like the sequence explicitly shown, also includes conservatively modified modifications thereof (e.g., degenerate codon substitutions) and complementary sequences. Specifically, degenerate codon substitutions can be achieved by creating a sequence in which the third position of one or more selected (or all) codons is substituted with mixed bases and / or deoxyinosine residues. For example, among the modifications based on specific wild-type sequences such as adenovirus serotypes 1 to 52 and adeno-associated virus serotypes 1 to 12, in addition to known modifications (for example, rh10, DJ, DJ / 8, PHP.eB, PHP.S, AAV2-retro, AAV2-QuadYF, AAV2.7m8, AAV6.2, rh.74, AAV2.5, AAV-TT, Anc80, etc.), it also includes a nucleic acid comprising a sequence having a sequence identity of at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 99.5% with the sequence serving as the basis.

[0365] In this specification, the so-called "gene" refers to a nucleic acid portion that performs a certain biological function. As the biological function, it can be cited: encoding polypeptides or proteins; encoding protein non-coding functional RNA (rRNA, tRNA, microRNA (miRNA), lncRNA, etc.); controlling the production of polypeptides, proteins or protein non-coding functional RNA; specifically binding to specific proteins; controlling the cutting or replication of nucleic acids. Therefore, in the gene in this specification, in addition to the nucleic acid portion encoding protein or protein non-coding functional RNA, it also includes transcription and translation regulatory sequences such as promoters, terminators, enhancers, insulators, silencers, replication origins, internal ribosome entry sites, and nucleic acid portions necessary for packaging into viral particles. In this specification, the so-called "gene product" can refer to a polypeptide, protein, or protein non-coding functional RNA encoded by a gene.

[0366] In this specification, so-called two genes are cis, which means that there are these genes on the nucleic acid molecule of the same nucleic acid molecule or complementary chain (in the case of double-stranded nucleic acid). In addition, in this specification, so-called two genes are trans, which means that in a certain cell (in a certain organism), these genes are not present on the nucleic acid molecule of the same nucleic acid molecule or complementary chain (in the case of double-stranded nucleic acid). For example, the gene present in the genome and the gene on the nucleic acid imported by the construct derived from the virus can be trans. As required, it can be judged whether the two genes are trans when the two genes become present in the cell at the same time (for example, nucleic acid is introduced into the cell).

[0367] In this specification, when the number of genes is mentioned, one gene refers to a gene having a continuous sequence in a form that is usually present (with the highest frequency or a probability of more than 50%) on the genome of a certain organism. For example, two exons encoding a certain protein can be two genes. For example, in the case where a promoter sequence and a protein-encoding sequence form a continuous sequence, the nucleic acid portion containing the promoter sequence and the protein-encoding sequence can be one gene. For example, in the case where a protein that becomes functional by cutting is encoded by a continuous sequence on the genome, the protein can be encoded by one gene. When referring to a gene from a functional aspect, the nucleic acid sequence does not have to be a continuous sequence. For example, multiple exons encoding a certain protein can be collectively referred to as the gene of the protein.

[0368] As used herein, a "gene deletion" means that the nucleic acid does not contain the gene, or contains a gene modified so as not to exert the normal function of the gene (eg, the function of producing a functional protein).

[0369] When used in this specification, the term "operably linked (linked)" means that the expression (operation) of the desired sequence is placed under the control of a certain transcriptional translation regulatory sequence (e.g., promoter, enhancer, etc.) or translation regulatory sequence. In order to link the promoter to the gene in an operable manner, the promoter is usually placed immediately upstream of the gene, but it does not necessarily need to be placed adjacently.

[0370] In the case of use in this specification, "transcriptional translation regulatory sequence" is a general term for promoter sequence, polyadenylation signal, transcription termination sequence, upstream regulatory domain, replication origin, enhancer, IRES, etc., which cooperate to enable replication, transcription and translation of the coding sequence in the recipient cell. As long as the replication, transcription and translation of the selected coding sequence can be carried out in an appropriate host cell, it is not necessary for all of these transcriptional translation regulatory sequences to exist. Those skilled in the art can easily identify regulatory nucleic acid sequences based on public information. In addition, those skilled in the art can identify transcriptional translation regulatory sequences that can be applied to the purpose of use, for example, in vivo, ex vivo or in vitro.

[0371] When used in this specification, "promoter" refers to a segment of a nucleic acid sequence that controls the transcription of a linked nucleic acid sequence in an operable manner. A promoter includes a specific sequence that is sufficient for the recognition, binding, and initiation of transcription by RNA polymerase. A promoter may also include a sequence that regulates the recognition, binding, or initiation of transcription of RNA polymerase.

[0372] When used in this specification, an "enhancer" refers to a fragment of a nucleic acid sequence that has a function of increasing the expression efficiency of a target gene.

[0373] When used in the present specification, a "silencer" refers to a fragment of a nucleic acid sequence that has a function of reducing the expression efficiency of a target gene, contrary to an enhancer.

[0374] As used herein, the term "insulator" refers to a fragment of a nucleic acid sequence having a cis-regulatory function for regulating the expression of a gene located at a separate position in a DNA sequence.

[0375] When used in the present specification, the term "terminator" refers to a fragment of a nucleic acid sequence that is located downstream of a protein-encoding region and is involved in the termination of transcription when a nucleic acid is transcribed into mRNA.

[0376] As used herein, the term "origin of replication" refers to a fragment of a nucleic acid sequence where a protein that recognizes the nucleic acid sequence (eg, initiator DnaA protein, etc.) binds to and synthesizes RNA, thereby partially unwinding the DNA double helix and initiating replication.

[0377] As used herein, an internal ribosome entry site ("IRES") refers to a nucleic acid fragment that promotes the entry or retention of ribosomes during translation of a downstream nucleic acid sequence.

[0378] In this specification, the so-called "homology" of nucleic acid refers to the degree of identity of more than two nucleic acid sequences relative to each other, and usually the so-called "homology" refers to the degree of identity or similarity. Therefore, the higher the homology of two nucleic acids, the higher the identity or similarity of these sequences. "Similarity" is a numerical value obtained by introducing similar bases into the calculation in addition to identity. Here, the so-called similar bases refer to the situation in which a part of the mixed bases (for example, R = A + G, M = A + C, W = A + T, S = C + G, Y = C + T, K = G + T, H = A + T + C, B = G + T + C, D = G + A + T, V = A + C + G, N = A + C + G + T) are consistent. Whether two nucleic acids have homology can be investigated by direct comparison of sequences or hybridization under strict conditions. When two nucleic acid sequences are directly compared, the genes are homologous when there is typically at least 50% identity between their nucleic acid sequences, preferably at least 70% identity, and more preferably at least 80%, 90%, 95%, 96%, 97%, 98% or 99% identity.

[0379] Amino acids can be referred to in this specification using any of their commonly known three-letter symbols or the single-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides can also be referred to using the single-letter codes commonly recognized. In this specification, the comparison of similarity, identity and homology of amino acid sequences and base sequences is calculated using BLAST, a tool for sequence analysis, using default parameters. The search for identity can be performed using, for example, NCBI's BLAST 2.10.1+ (issued on June 18, 2020). The value of identity in this specification generally refers to the value when the above-mentioned BLAST is used for comparison under default conditions. Wherein, in the case of a higher value due to a change in parameters, the highest value is used as the value of identity. In the case of evaluating identity in multiple regions, the highest value therein is used as the value of identity. Similarity is a numerical value obtained by introducing similar amino acids into the calculation in addition to identity.

[0380] In this specification, unless otherwise specified, reference to a biological substance (e.g., protein, nucleic acid, gene) may also be understood as reference to a variant of the biological substance (e.g., a variant having a modification in the amino acid sequence) that performs the same function as the biological function of the biological substance (which may not be to the same extent). Such variants may include molecules that are at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99% identical when compared to the sequence of the aligned original molecule in a fragment of the original molecule, in an amino acid sequence or nucleic acid sequence of the original biological substance of the same size, or when compared to the sequence of the aligned original molecule by alignment using a computer homology program known in the art. Variants may include molecules having modified amino acids (e.g., modifications by disulfide bond formation, glycosylation, lipidation, acetylation or phosphorylation) or modified nucleotides (e.g., modifications by methylation).

[0381] In this specification, the term "stringent conditions" refers to well-known conditions commonly used in the art. For example, the following conditions can be used as stringent conditions. (1) using low ionic strength and high temperature for washing (e.g., 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl sulfate at 50°C), (2) using a denaturing agent such as formamide during hybridization (e.g., 50% (v / v) formamide with 0.1% bovine serum albumin / 0.1% Ficolin / 0.1% polyvinyl pyrrolidone / 50 mM sodium phosphate buffer, pH 6.5, and 750 mM sodium chloride, 75 mM sodium citrate at 42°C), or (3) incubating overnight at 37°C in a solution containing 20% ​​formamide, 5×SSC, 50 mM sodium phosphate (pH 7.6), 5×Denhardt's solution, 10% dextran sulfate, and 20 mg / ml denatured sheared salmon sperm DNA, followed by washing the filter with 1×SSC at approximately 37-50°C. It should be noted that the formamide concentration can also be 50% or more. The washing time can be 5, 15, 30, 60 or 120 minutes, or more. As factors affecting the stringency of the hybridization reaction, multiple factors such as temperature and salt concentration can be considered. For details, please refer to Ausubel et al., Current Protocols in Molecular Biology, William Interscience Press, (1995). Examples of "high stringency conditions" are: 0.0015M sodium chloride, 0.0015M sodium citrate, 65-68°C; or, 0.015M sodium chloride, 0.0015M sodium citrate, and 50% formamide, 42°C. Hybridization can be performed according to the methods described in experimental books such as Molecular Cloning 2nd ed., Modern Molecular Biology Experimental Methods, Appendix 1-38, DNA Cloning 1: Core Techniques, A Practical Approach, Second Edition, Oxford University Press (1995). Here, preferably, sequences containing only A sequences or T sequences are excluded from sequences that hybridize under stringent conditions.Moderately stringent conditions can be easily determined by a person skilled in the art based on the length of the DNA, as described in Sambrook et al., Molecular Cloning: A Laboratory Manual, No. 3, Vol. 1, 7.42-7.45 (Cold Spring Harbor Laboratory Press), 2001. In addition, for nitrocellulose filters, a pre-washing solution of 5×SSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0) is used, hybridization conditions of about 50% formamide at about 40-50° C., 2×SSC-6×SSC (or other similar hybridization solutions such as Stark's solution in about 50% formamide at about 42° C.), and washing conditions of about 60° C., 0.5×SSC, 0.1% SDS are used. Therefore, the polypeptides used in the present disclosure also include polypeptides encoded by nucleic acid molecules that hybridize under highly or moderately stringent conditions with nucleic acid molecules encoding the polypeptides specifically described in the present disclosure.

[0382] In this specification, the so-called "corresponding" amino acid or nucleic acid refers to an amino acid or nucleotide having or predicted to have the same effect as the prescribed amino acid or nucleotide in a polypeptide or polynucleotide that becomes a comparative benchmark in a certain polypeptide molecule or polynucleotide molecule, especially in an enzyme molecule, refers to an amino acid that is present in the same position in the active site and makes the same contribution to the catalytic activity. For example, if it is an antisense molecule, it can be the same part in the ortholog corresponding to the specific part of the antisense molecule. The corresponding amino acid can be, for example, a specific amino acid that has been cysteineized, glutathionylated, SS bond formed, oxidized (for example, oxidation of the methionine side chain), formylated, acetylated, phosphorylated, sugar chain attached, myristylated (myristylation), etc. Alternatively, the corresponding amino acid can be an amino acid responsible for dimerization. Such "corresponding" amino acids or nucleic acids can also be regions or domains throughout a certain range. Therefore, in such a case, the "corresponding" region or domain is referred to in this specification.

[0383] In this specification, the so-called "corresponding" gene (e.g., a polynucleotide sequence or molecule) refers to a gene (e.g., a polynucleotide sequence or molecule) in a certain species that has or is predicted to have the same effect as a specified gene in a species that serves as a comparison benchmark. In the case where there are multiple genes with such an effect, it refers to a gene that has the same evolutionary origin. Therefore, the gene corresponding to a certain gene can be a direct homolog of the gene. For example, the cap of AAV serotype 1 can correspond to the cap of AAV serotype 2. For example, the corresponding gene in a certain virus can be found by searching the sequence database of the virus using the gene sequence of the virus that serves as the benchmark for the corresponding gene as a query sequence.

[0384] According to the present disclosure, the term "activity" in this specification refers to the function of a molecule in the broadest sense. Activity generally includes biological, biochemical, physical or chemical functions of a molecule, but is not intended to be limiting. Activity includes, for example: enzymatic activity; the ability to interact with other molecules; and the ability to activate, promote, stabilize, hinder, inhibit, or destabilize the functions of other molecules; stability; the ability to be localized in a specific intracellular location. Where applicable, the term is also related to the function of a protein complex in the broadest sense.

[0385] In this specification, the so-called "biological function", when referring to a certain gene or a nucleic acid molecule or polypeptide related thereto, refers to the specific function that the gene, nucleic acid molecule or polypeptide can have in vivo, for which, for example, specific cell surface structure recognition ability, enzymatic activity, binding ability with a specific protein, etc. can be cited, but are not limited to these. In this disclosure, for example, the function of a certain promoter being recognized in a specific host cell can be cited, but are not limited to these. In this specification, biological function can be exerted by "biological activity". In this specification, the so-called "biological activity" refers to the activity that a certain factor (for example, polynucleotides, proteins, etc.) can have in vivo, including the activity of exerting various functions (for example, transcription promoting activity), for example, also including the activity of activating or inactivating other molecules by interaction with a certain molecule. For example, when a certain factor is an enzyme, its biological activity includes its enzymatic activity. In other examples, when a certain factor is a ligand, it includes the binding of the ligand to the corresponding receptor. Such biological activity can be measured using techniques known in the art. Therefore, "activity" refers to various measurable indicators that show or indicate binding (either direct or indirect), or affect a response (i.e., having a measurable effect in response to some exposure or stimulus), such as the amount of upstream or downstream proteins in the host cell or other similar functional standards.

[0386] As used in this disclosure, the "infectivity" of a virus or a construct derived from a virus refers to the ability to introduce nucleic acids in the virus or a construct derived from a virus into cells through adhesion of the virus or a construct derived from a virus to cells or membrane fusion. The "replication ability" of a virus or a construct derived from a virus refers to the ability to produce infectious virus particles or virus-derived construct particles in infected cells.

[0387] When used in this specification, the terms "transformation", "transduction" and "transfection" are used interchangeably unless otherwise specified, and refer to the introduction of nucleic acids into host cells (via a virus or a construct derived from a virus as required). As a transformation method, any method can be used as long as it is a method of introducing nucleic acids into host cells, for example, various known techniques such as the use of competent cells, electroporation, a method using a particle gun (gene gun), and a calcium phosphate method can be cited.

[0388] In this specification, the so-called "purified" substance or biological factor (for example, nucleic acid or protein, etc.) refers to a substance obtained by removing at least a part of the factors naturally accompanying the biological factor. Therefore, usually, the purity of the biological factor in the purified biological factor is higher than the state in which the biological factor usually exists (that is, it is concentrated). The term "purified" used in this specification means: the presence of preferably at least 75% by weight, more preferably at least 85% by weight, further preferably at least 95% by weight, and most preferably at least 98% by weight of the same type of biological factor. The substance used in the present disclosure is preferably a "purified" substance.

[0389] In this specification, the so-called "pharmaceutical ingredient" refers to any ingredient that can constitute a medicine, for example, active ingredients (ingredients that show drug effects by themselves), additives (ingredients that are not expected to have drug effects by themselves, but can be expected to play a certain role when included in the form of medicine (for example, excipients, lubricants, surfactants, etc.)), etc. The pharmaceutical ingredient can be a single substance or a combination of multiple substances and reagents. It can also include any combination of active ingredients and additives, adjuvants and active ingredients.

[0390] In this specification, the "active ingredient" refers to an ingredient that exerts a desired medicinal effect, and may be a single ingredient or a plurality of ingredients.

[0391] In this specification, the so-called "additive ingredient" refers to any ingredient that is not expected to have a medicinal effect but exerts a certain effect when included in the form of a medicine, for example, pharmaceutically acceptable carriers, stabilizers, (auxiliary) adjuvants, solubility improvers, solubilizers, diluents, excipients, buffers, binders, diluents, fragrances, and lubricants.

[0392] In this specification, "drug", "reagent" or "factor" (all equivalent to agent in English) are used interchangeably in a broad sense, and can be any substance or other element (for example, energy such as light, radiation, heat, electricity, etc.) as long as the desired purpose can be achieved. As such substances, for example, proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (for example, DNA such as cDNA and genomic DNA, RNA such as mRNA), polysaccharides, oligosaccharides, lipids, organic low molecules (for example, hormones, ligands, information transmission substances, organic low molecules, molecules synthesized by combinatorial chemistry, low molecules that can be used as pharmaceuticals (for example, low molecular weight ligands, etc.)), their complex molecules and their mixtures, but are not limited to these.

[0393] When used in this specification, the so-called "complex" or "complex molecule" refers to any structure containing two or more parts. For example, when one part is a polypeptide, the other part can be a polypeptide, or it can be a substance other than this (for example, a substrate, a sugar, a lipid, a nucleic acid, other hydrocarbons, etc.). In this specification, the two or more parts constituting the complex can be bound by a covalent bond, or they can be bound by a bond other than this (for example, a hydrogen bond, an ionic bond, a hydrophobic interaction, a van der Waals force, etc.).

[0394] In this specification, the so-called "label" refers to the presence of a molecule or substance (for example, a substance, energy, electromagnetic wave, etc.) that is used to be recognized by other substances as a target. As such labeling methods, RI (radioisotope) method, fluorescence method, biotin method, chemiluminescence method, etc. can be cited. In the case of labeling multiple target proteins or factors or means for capturing them by fluorescence method, fluorescent substances with different maximum wavelengths of fluorescence emission are used for labeling. The difference in the maximum wavelength of fluorescence emission is preferably 10nm or more. Any label that does not affect the function can be used. As fluorescent substances, Alexa Fluor® can be cited. TM Fluor. Alex a TM Fluor is a water-soluble fluorescent dye obtained by modifying coumarin, rhodamine, fluorescein, cyanine, etc. It is a series that corresponds to a wide range of fluorescence wavelengths. Compared with other fluorescent dyes with corresponding wavelengths, it is very stable and bright, and has low pH sensitivity. As a combination of fluorescent dyes with a fluorescence maximum wavelength of more than 10nm, Alexa Fluor is listed. TM 555 with Alexa TM 633 combination, Alexa TM 488 and Alexa TM 555, etc. Other fluorescent labels include cyanine dyes (e.g., CyDyeTM series of Cy3, Cy5, etc.), rhodamine 6G reagent, N-acetoxy-N2-acetylaminofluorene (AAF), AAIF (iodine derivative of AAF), etc. In the present disclosure, such a label can be used to modify the target object in a manner that can be detected by the detection means used. Such modifications are known in the art, and those skilled in the art can appropriately implement such methods according to the label and the target object.

[0395] In this specification, the so-called "test kit" refers to a unit that is usually divided into two or more blocks and provides parts that should be provided (for example, constructs derived from viruses, instructions, etc.). When the purpose is to provide a composition that should not be mixed and provided for purposes such as stability, and preferably used after mixing immediately before use, the form of the test kit is preferred. Advantageously, such a test kit preferably has an instruction book or instruction manual that records how to use the provided parts or how to handle the reagents. In this specification, when the test kit is used in the form of a reagent kit, the test kit usually contains instructions that record the usage of constructs derived from viruses, etc.

[0396] In this specification, "instructions" are documents that record instructions for doctors or other users on how to use the method of the present disclosure. The instructions record the contents of instructions for administering the medicine of the present disclosure, etc. In addition, the instructions may also record the contents of instructions on the form of administration. The instructions may be prepared in accordance with the format prescribed by the supervisory authority of the country implementing the present disclosure (for example, the Ministry of Health, Labor and Welfare in Japan, the Food and Drug Administration (FDA) in the United States, etc.), and clearly record the subject matter that has been approved by the supervisory authority. The instructions are so-called package inserts, which are usually provided in paper media, but are not limited to this. For example, they may also be provided in the form of electronic media (for example, web pages or emails provided via the Internet).

[0397] The term "about" refers to the indicated value plus or minus 10%. "About" when used with respect to temperature refers to the indicated temperature plus or minus 5°C, and "about" when used with respect to pH refers to the indicated pH plus or minus 0.5.

[0398] (Preferred embodiment)

[0399] The preferred embodiments of the present disclosure are described below. The embodiments provided below are provided for a more complete understanding of the present disclosure, and it is understood that the scope of the present disclosure should not be limited to the following description. Therefore, it is obvious that those skilled in the art can make appropriate changes within the scope of the present disclosure with reference to the description in this specification. In addition, it is understood that the following embodiments can be used alone or in combination.

[0400] (Construct plasmid derived from virus)

[0401] In one aspect, the disclosure provides a plasmid encoding at least a portion of the elements of a construct derived from a virus. In one embodiment, the disclosure provides a construct plasmid derived from a virus that can be replicated in a combination of a first microorganism and a second microorganism. Any means that can be expected to be used to achieve it are all within the scope of the disclosure. For example, even if there is no explicit record, the record of the method using a certain component is also expected to include a composition comprising the same component, the use of the same component, and the same component used for the same method, etc., which reflect the embodiment of other means.

[0402] In one aspect, the present disclosure provides a plasmid encoding at least a portion of the elements of a construct derived from a virus. In one embodiment, the present disclosure provides a plasmid operably linked to include at least a portion of the nucleic acid sequences necessary to constitute a construct derived from a virus. In one embodiment, the nucleic acid sequences necessary to constitute a construct derived from a virus include: (A) a nucleic acid sequence containing a terminal repeat sequence (e.g., derived from any one of serotypes 1 to 12 or their modifications); (B) a nucleic acid sequence encoding a packaging factor (e.g., rep, which may be derived from any one of serotypes 1 to 12 of an adeno-associated virus or their modifications); (C) a nucleic acid sequence encoding a structural protein (e.g., cap, which may be derived from any one of serotypes 1 to 12 of an adeno-associated virus or their modifications); and (D) a nucleic acid sequence encoding a functional auxiliary factor (e.g., at least one of E1A, E1B, E2A, E4, and VA, which may be derived from any one of serotypes 1 to 52 of an adenovirus or their modifications). In one embodiment, the virus-derived construct plasmid of the present disclosure comprises 2, 3, or 4 of the nucleic acid sequences (A) to (D).

[0403] In one embodiment, the nucleic acid sequence necessary for constituting the virus is configured in a concentrated region on a construct plasmid derived from the virus. By integrating a nucleic acid fragment containing the nucleic acid sequence necessary for constituting the virus into a plasmid that becomes the basis, a construct plasmid derived from the virus of such a structure can be formed. In one embodiment, the nucleic acid sequence necessary for constituting the virus is present in a continuous region of base lengths of about 90% or less, about 80% or less, about 70% or less, about 60% or less, about 50% or less, about 40% or less, about 30% or less, about 25% or less, about 20% or less, about 15% or less, about 10% or less, or about 5% or less, and about 80% or more, about 70% or more, about 60% or more, about 50% or more, about 40% or more, about 30% or more, about 25% or more, about 20% or more, about 15% or more, about 10% or more, about 5% or more, or about 1% or more (a combination of upper and lower limits that are not contradictory) of the total base length of the construct plasmid derived from the virus. In one embodiment, elements other than the terminal repeats of the nucleic acid sequence necessary for the virus (e.g., one or more of the nucleic acid sequence encoding the structural protein of the virus, the nucleic acid sequence encoding the packaging factor, and the functional auxiliary factor) can be arranged between the two terminal repeats or on the outside. In the construct plasmid derived from the virus of the present disclosure, the elements constituting the nucleic acid sequence necessary for the virus can be arranged in any order and position, and it can be understood that various configurations other than the configurations specifically shown in the accompanying drawings can be used. In the case where a nucleic acid sequence recorded with a specific function such as a functional auxiliary factor contains multiple elements, the order and position of the elements in the construct plasmid derived from the virus can be arbitrary unless otherwise specified, and arbitrary elements (e.g., VA, E2A, E4) can also be arranged continuously with each other (without other genes sandwiched therebetween).

[0404] In one embodiment, the nucleic acid sequence necessary for constituting the virus includes two terminal repeat sequences of the virus, and the base length of the region sandwiched by the two terminal repeat sequences (excluding the terminal repeat sequences themselves) can be about 1 kb or more, about 5 kb or more, about 10 kb or more, about 20 kb or more, about 30 kb or more, about 40 kb or more, about 50 kb or more, about 70 kb or more, or about 100 kb or more. In one embodiment, the nucleic acid sequence necessary for constituting the virus includes two terminal repeat sequences of the virus and other parts, and the other parts are located outside the region sandwiched by the aforementioned two terminal repeat sequences. In one embodiment, the construct plasmid derived from the virus of the present disclosure includes a promoter, a desired gene and a terminator from upstream between the 5'ITR and the 3'ITR. In particular, it is expected that the nucleic acid sequence encoding the structural protein of the virus can also be a modified form of the wild-type sequence (for example, serotypes 1 to 12 of adeno-associated virus).

[0405] In one embodiment, the viral-derived construct plasmid of the present disclosure contains a promoter upstream of the element as needed. For example, the viral-derived construct plasmid of the present disclosure may contain a promoter upstream of one or more of the nucleic acid sequences (B), (C) and (D) or the genes contained therein that constitute the nucleic acid sequences necessary for the viral-derived construct. For example, the viral-derived construct plasmid of the present disclosure may contain a promoter upstream of one or more of one or more desired genes. In one embodiment, the viral-derived construct plasmid of the present disclosure contains a drug screening marker nucleic acid sequence between any two of the nucleic acid sequences (A) to (D). In one embodiment, the viral-derived construct plasmid of the present disclosure contains a drug screening marker nucleic acid sequence between any two genes encoded by the nucleic acid sequences (A) to (D).

[0406] In one embodiment, the viral-derived construct plasmid of the present disclosure is used to produce viral vectors, virus-like particles (VLPs), oncolytic viruses (including oncolytic viruses modified in a way that they can only proliferate in cancer cells), or viral replicons (self-replicating viral genomes that lack the ability to produce viral particles).

[0407] In one embodiment, the viral-derived construct plasmid of the present disclosure can be prepared by the following method, the method comprising: i) a step of obtaining a viral-derived construct plasmid from a first microbial host cell, the viral-derived construct plasmid comprising at least one of the nucleic acid sequences necessary to constitute a viral-derived construct; and ii) a step of introducing the viral-derived construct plasmid into a second microbial host cell, and configuring the second microbial host cell under conditions where the viral-derived construct plasmid is amplified. In one embodiment, the first microbial host cell is Bacillus subtilis. In one embodiment, the second microbial host cell is Escherichia coli. Compared with a viral-derived construct plasmid synthesized in Bacillus subtilis and replicated in Bacillus subtilis, which is obtained only from Bacillus subtilis, a viral-derived construct plasmid synthesized in Bacillus subtilis and replicated in Escherichia coli unexpectedly provides more viral-derived constructs per plasmid when introduced into production cells at the same molar number. Therefore, viral-derived construct plasmids produced via different microbial host cells can have excellent performance. In addition, there are cases where specific genes (GC-rich genes, etc.) cannot be amplified in Escherichia coli but can be amplified in Bacillus subtilis, for example, due to the introduction of unexpected mutations. In this way, it may be advantageous to use a variety of microorganisms in the amplification of viral-derived construct plasmids. In one embodiment, step i) includes forming a viral-derived construct plasmid from nucleic acid fragments. In one embodiment, after constructing a viral-derived construct plasmid using the method for making a viral-derived construct plasmid of the present disclosure, a portion of the viral-derived construct plasmid (e.g., a region containing nucleic acid sequences of (A) to (D)) can be introduced into another plasmid to make a new viral-derived construct plasmid.

[0408] In one embodiment, the viral-derived construct plasmid of the present disclosure is linked in an operable manner to include: a nucleic acid sequence that promotes plasmid replication in a first microbial host cell; and a nucleic acid sequence that promotes plasmid replication in a second microbial host cell. In one embodiment, the first microbial host cell is a transforming organism (Bacillus subtilis, etc.). In one embodiment, the second microbial host cell is Escherichia coli. In one embodiment, the nucleic acid sequence that promotes plasmid replication in Bacillus subtilis may include a replication origin that works in Bacillus subtilis, for example, oriC, and pTB19 (Imanaka, T., et al., J. Gen. Microbioi. 130, 1399-1408. (1984)), pLS32 (Tanaka, T and Ogra, M. FEBS Lett. 422, 243-246. (1998)), pAMβ1 (Swinfield, TJ et al., Gene 87, 79-90. (1990)) and other plasmids. As nucleic acid sequences that promote plasmid replication in Bacillus subtilis, plasmids or parts thereof or replication origins or modified forms thereof, which are known to enable rolling circle type, θ type, or oriC replication mechanisms using bacteriophages, etc., can be cited. In one embodiment, the nucleic acid sequence that promotes plasmid replication in Bacillus subtilis may have a sequence that is identical or similar to a known replication initiation point (e.g., more than 90%, more than 95%, more than 97%, more than 98%, more than 99%, or more than 99.5% sequence identity). In one embodiment, the nucleic acid sequence that promotes plasmid replication in a microbial host cell may be arranged in a continuous region where a nucleic acid sequence necessary for constituting a virus exists, or may be arranged outside the continuous region.

[0409] In one embodiment, the viral construct plasmid of the present disclosure may have a promoter and / or enhancer that works in Bacillus subtilis. For example, as a promoter of Bacillus subtilis, Pspac (Yansura, D. and Henner, DJ Pro. Natl. Acad. Sci, USA 81, 439-443. (1984.)) or Pr promoter (Itaya, M. Biosci. Biotechnol. Biochem. 63, 602-604. (1999)) that can be controlled by IPTG (isopropyl sD-thiogalactopyranoside) can be cited. The nucleic acid element that works in Bacillus subtilis does not need to be derived from Bacillus subtilis, and nucleic acid elements that work efficiently can be selected. In one embodiment, the replication origin, promoter and / or enhancer that work in Bacillus subtilis in the viral construct plasmid are located outside the genome (which may also include modification) or a part thereof of the original virus encoding the viral construct.

[0410] In one embodiment, the viral construct plasmid of the present disclosure can be made or used in the cells of organisms other than Bacillus subtilis, and therefore can include transcriptional translation regulatory sequences such as replication origin, promoter, transcription termination sequence, etc. that work in these organisms. The transcriptional translation regulatory sequences of each organism are known, and those skilled in the art can select them appropriately. In one embodiment, the viral construct plasmid of the present disclosure can be made or replicated in Escherichia coli, yeast, etc., and therefore can include transcriptional translation regulatory sequences that work in these microorganisms. In one embodiment, the viral construct plasmid of the present disclosure can be introduced into production cells, and therefore can include transcriptional translation regulatory sequences that work in production cells. In particular, production cells can be animal cells, and therefore the viral construct plasmid of the present disclosure can include transcriptional translation regulatory sequences that work in animal cells. In one embodiment, the viral construct plasmid of the present disclosure does not include the sequence of at least a portion of the genes in the entire genome of the virus.

[0411] In one embodiment, the construct plasmid derived from the virus of the present disclosure includes the desired gene. In one embodiment, the desired gene can be configured between 2 terminal repeats. In one embodiment, the desired gene in the construct plasmid derived from the virus of the present disclosure may eventually be included in the carrier nucleic acid of the construct derived from the virus. For such a desired gene, therapeutic proteins can be encoded, genes for gene therapy can be encoded, genes for gene cell therapy such as CART therapy can be encoded, protein non-coding functional RNA (rRNA, tRNA, microRNA (miRNA), lncRNA, etc.) can also be encoded, and promoters, terminators, insulators, enhancers, silencers, transcriptional translation regulatory sequences such as replication origins can also be included in combination with them or independently. In one embodiment, the desired gene includes viral promoters such as cytomegalovirus promoters, CAG promoters, SV40 promoters, RSV promoters (upstream of protein coding genes as needed). In one embodiment, the desired gene includes IRES (upstream of protein coding genes as needed). In one embodiment, the desired gene can be integrated into the chromosome of the subject to which the virus-derived construct is administered. In this embodiment, the desired gene can have the function of controlling the expression of the gene originally possessed by the subject, and can also cause the expression of the protein in the long term. For example, a virus-derived construct based on adeno-associated virus, retrovirus, etc. can be integrated into the chromosome of the subject. In one embodiment, the desired gene can be integrated into therapeutic cells (e.g., chromosomes) (e.g., by cell treatment performed in vitro using a virus-derived construct). In one embodiment, the virus-derived construct plasmid of the present disclosure can also be constructed as follows: it does not contain all the genes required for the proliferation of the original virus of the virus-derived construct, so that the virus-derived construct produced thereby does not have the ability to proliferate.

[0412] In one embodiment, the virus-derived construct plasmid of the present disclosure, when introduced into production cells, can provide 1×10 2 Above, 4×10 2 Above, 1×10 3 Above, 4×10 3 Above, 1×10 4 Above, 4×10 4 Above, or 1×10 5In one embodiment, the viral-derived construct plasmid of the present disclosure can provide a viral-derived construct having a viral-derived construct particle number (VP / VG) of 35, 30, 25, 20, 15, 10, 5 or less relative to the viral-derived construct genome copy number.

[0413] In one embodiment, the above-mentioned properties of the viral-derived construct plasmid are determined when the evaluation is performed under the following conditions: 1.5×10 7 293T cells were seeded in a 15 cm culture dish. After 22 hours, the medium was replaced with 19 mL of DMEM (2% FBS, 1% penicillin / streptomycin) and cultured at 37°C and 5% CO2 for 2 hours to reach a confluent 293T cell population (cell number: 3 × 10 7 ) add the following transfection solution, the transfection solution is a mixture of 500 μL of DMEM medium containing 2.1 pmol of a construct plasmid derived from a virus and 500 μL of a DMEM medium containing 1-fold amount of PEIpro of DNA, and cultured for 72 hours at 37°C and 5% CO2, then add 1 / 80 volume of 0.5M EDTA (pH 8.0), and let stand at room temperature for 10 minutes. In one embodiment, the above performance of the construct plasmid derived from a virus is determined when evaluated under the following conditions: on the day of transfection, 9.0×10 7 VPC2.0 cells were inoculated into a 125 mL conical flask. After 1 hour, 3 mL of AAV-MAX Enhancer was added and cultured for 2 hours at 37°C and 8% CO2. The following transfection solution was added to the VPC2.0 cells, wherein the transfection solution was a solution containing 3.0 pmol of the viral-derived construct plasmid Viral-Plex TM Complexation buffer 3mL is mixed with AAV-MAX Transfection Booster 90μL and AAV-MAX Transfection Reagent 180μL, and cultured at 37°C, 8% CO2 for 72 hours, and then the cell suspension is recovered and centrifuged at 180×g for 5 minutes, and the supernatant is completely removed. In one embodiment, the above-mentioned performance of the construct plasmid derived from the virus is determined under the following conditions: the genome titer (VG) is quantified by real-time PCR (SYBR Green method), and the particle titer (VP) is quantified and evaluated by ELISA.

[0414] In one embodiment, the desired gene in the viral-derived construct plasmid of the present disclosure may include a plurality of genes. In one embodiment, the desired gene may include 2 to 100, for example, more than 2, more than 3, more than 4, more than 5, more than 7, more than 10, more than 12, more than 15, more than 20, more than 25, more than 30, more than 40, or more than 50, and less than 100, less than 90, less than 80, less than 70, less than 60, less than 50, less than 40, less than 35, more than 30, less than 25, less than 20, less than 17, less than 15, less than 12, or less than 10 genes. In one embodiment, the desired gene in the viral-derived construct plasmid of the present disclosure may include a base length of about 0.1 to 1000 kbp, for example, about 0.1 kbp or more, about 0.3 kbp or more, about 1 kbp or more, about 2 kbp or more, about 5 kbp or more, about 7 kbp or more, about 10 kbp or more, about 20 kbp or more, about 50 kbp or more, or about 100 kbp or more, and about 1000 kbp or less, about 700 kbp or less, about 500 kbp or less, about 200 kbp or less, about 100 kbp or less, about 70 kbp or less, about 50 kbp or less, about 20 kbp or less, or about 10 kbp or less. The viral-derived construct plasmid of the present disclosure can be constructed into a complex structure containing multiple genes using the OGAB method, so the desired gene can also be constructed into a complex structure. The size of the nucleic acid carried may be limited by the type of construct derived from the virus, so the type of construct derived from the virus can be selected according to the size of the desired gene. In one embodiment, by making the desired gene include multiple genes, a combination of a promoter that is specific or period-specific to the tissue (e.g., cancer tissue) of the subject and a therapeutic gene (therapeutic protein coding sequence, gene therapy gene, gene cell therapy gene, etc.) linked to the promoter in a workable manner, a sequence encoding a series of enzymes that enables the coordinated expression of a series of enzymes that control metabolic cascades, and other highly functional nucleic acids can be delivered to the subject.

[0415] In one embodiment, the viral-derived construct plasmid of the present disclosure comprises at least 2, at least 3, at least 4, at least 5, or more nucleic acid fragments comprising a vector partial nucleic acid sequence in the nucleic acid fragments produced by chemical synthesis or enzyme reaction (e.g., a reaction using a restriction endonuclease). In one embodiment, the viral-derived construct plasmid of the present disclosure is produced by merely circularizing a plurality of nucleic acid fragments produced by chemical synthesis or enzyme reaction. In one embodiment, the viral-derived construct plasmid of the present disclosure is produced by more than 3, more than 4, more than 5, more than 7, more than 10, more than 15, more than 20, or more nucleic acid fragments. In one embodiment, the nucleic acid fragment used in the preparation of the virus-derived construct plasmid of the present disclosure may independently have a length of less than 20 kb, less than 15 kb, less than 10 kb, less than 7 kb, less than 5 kb, less than 4 kb, less than 3 kb, less than 2 kb, less than 1.5 kb, less than 1 kb, less than 0.7 kb, or less than 0.5 kb.

[0416] In one embodiment, the vector part nucleic acid sequence accounts for less than about 60%, less than about 50%, less than about 40%, less than about 30%, less than about 20%, or less than about 10% of the total sequence of the construct plasmid derived from the virus of the present disclosure. The vector part nucleic acid sequence designed for the construct plasmid derived from a specific virus can be shortened by omitting unnecessary elements and can be designed to account for a lower proportion of the plasmid as a whole. In one embodiment, the vector part nucleic acid sequence includes a nucleic acid sequence having at least one function of nucleic acid replication, drug resistance, copy number adjustment, and stability improvement. Recognition sequences based on specific restriction endonucleases (e.g., those described in the specification of the present application) may be included upstream and / or downstream of these elements or the entire vector part nucleic acid sequence. Such a restriction endonuclease recognition sequence may have a sequence that does not appear in other parts of the construct plasmid derived from the virus (e.g., a nucleic acid sequence necessary to constitute a construct derived from the virus), and in this way, the vector part can be operated independently.

[0417] In one embodiment, examples of the protein encoded by the desired gene in the virus-derived construct plasmid of the present disclosure include therapeutic polypeptides (eg, replacement therapy), immunogenic polypeptides (eg, pathogen polypeptides, cancer antigen polypeptides), and the like. Examples of therapeutic polypeptides include cystic fibrosis transmembrane conductance regulator (CFTR), dystrophin (mini-dystrophin and micro-dystrophin), myostatin propeptide, follistatin, activin type II soluble receptor, IGF-1, anti-inflammatory polypeptides, sarcospan, utrophin, mini-utrophin, coagulation factors (e.g., factor VIII, factor IX, factor X, etc.), erythropoietin, angiostatin, endostatin, catalase, tyrosine hydroxylase, superoxide dismutase, leptin, LDL receptor, lipoprotein lipase, ornithine transcarbamylase, and the like. transcarbamylase), β-globin, α-globin, spectrin, α1-antitrypsin, adenosine deaminase, hypoxanthine-guaninephosphoribosyltransferase, β-glucocerebrosidase, sphingomyelinase, lysosomal hexosaminidase A, branched-chain ketoacid dehydrogenase, RP65 protein, cytokines (e.g., α-interferon, β-interferon, interferon-γ, interleukin-2, interleukin-4, granulocyte-macrophage colony-stimulating factor, lymphotoxin, etc.), peptide growth factors, neurotrophic factors and hormones (e.g.,Growth hormone, insulin, insulin-like growth factor 1 and insulin-like growth factor 2, platelet-derived growth factor, epidermal growth factor, fibroblast growth factor, nerve growth factor, neurotrophic factor-3 and neurotrophic factor-4, brain-derived neurotrophic factor, bone morphogenetic protein, glial-derived growth factor, transforming growth factor-α and transforming growth factor-β, etc.), lysosomal acid α-glucosidase, α-galactosidase A, tumor necrosis growth factor α soluble receptor, S100A1, parvalbumin, adenylate cyclase type 6, anti-inflammatory factors, anti-myostatin protein, aspartate acylase, suicide gene products (e.g., thymidine kinase, cytosine deaminase, diphtheria toxin, tumor necrosis factor), tumor suppressor gene products (e.g., p53, Rb, Wt-1), TRAIL, FAS-ligand, etc.,

[0418] Examples of pathogen polypeptides include cell surface proteins of pathogenic organisms such as bacteria, fungi, and parasites, and proteins expressed on the surface of viruses (e.g., spike proteins, envelope proteins, capsid proteins, etc.). Specific examples of pathogen polypeptides include orthomyxovirus immunogens (e.g., influenza virus hemagglutinin (HA), nucleoprotein), lentivirus immunogens (e.g., envelope GP160 protein, matrix / capsid protein, gag, pol, env gene products of HIV or SIV), arenavirus immunogens (e.g., Lassa fever virus), virus) nucleocapsid protein, envelope glycoprotein), poxvirus immunogens (e.g., vaccinia L1 or L8 gene products), flavirvirus immunogens (e.g., yellow fever virus or Japanese encephalitis virus immunogens), filovirus immunogens (e.g., Ebola virus or Marburg virus immunogens such as NP and GP gene products), bunyavirus immunogens (e.g., RVFV, CCHF, SFS virus immunogens), coronavirus immunogens (e.g., human coronavirus envelope glycoprotein and human coronavirus immunogens), polio immunogens, herpes virus immunogens (e.g., CMV, EBV, HSV immunogens), mumps virus immunogens, measles virus immunogens, rubella virus immunogens, diphtheria toxin or other diphtheria immunogens, pertussis antigens, and hepatitis (e.g., hepatitis A, hepatitis B, hepatitis C, etc.) immunogens, etc.

[0419] Examples of cancer antigen polypeptides include BRCA1 gene products, BRCA2 gene products, gp100, tyrosinase, GAGE-1 / 2, BAGE, RAGE, LAGE, NY-ESO-1, CDK-4, β-catenin, MUM-1, caspase-8, KIAA0205, HPVE, SART-1, PRAME, p15, melanoma tumor antigen, MART-1, gp100 MAGE-1, MAGE-2, MAGE-3, CEA, TRP-1, TRP-2, P-15, tyrosinase, HER-2 / neu gene products, CA125, LK26, FB5 (endosialin), ialin), TAG72, AFP, CA19-9, NSE, DU-PAN-2, CA50, SPan-1, CA72-4, HCG, STN (sialyl Tn antigen), c-erbB-2 protein, PSA, L-CanAg, estrogen receptor, milk fat globulin, p53 tumor suppressor protein, mucin antigen, telomerase, nuclear matrix protein, prostatic acid phosphatase, papillomavirus antigen, etc.

[0420] In one embodiment, the desired gene may be a gene for treating a specific disease (eg, a gene for gene therapy). A person skilled in the art can appropriately select a gene to be selected for a specific disease.Examples of such diseases include infections caused by various pathogens, cystic fibrosis, hemophilia A, hemophilia B, thalassemia, anemia, Alzheimer's disease, multiple sclerosis, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, spinal muscular atrophy, epilepsy, cancer (melanoma, adenocarcinoma, thymoma, lymphoma, sarcoma, lung cancer, liver cancer, colon cancer, leukemia, uterine cancer, breast cancer, prostate cancer, ovarian cancer, cervical cancer, bladder cancer, kidney cancer, pancreatic cancer, brain cancer, etc.), diabetes, muscular dystrophy, Gaucher disease, Hurler disease, adenosine deaminase deficiency, glycogen storage disease, congenital emphysema, Lesch-Nyhan syndrome, Niemann-Pick disease, Tay-Sachs disease, and the like. disease), Angelman syndrome, maple syrup urine disease, age-related macular degeneration, amaurosis, diabetic retinopathy, retinal degeneration, astrocytoma, glioblastoma, heart failure, peripheral arterial disease, arthritis, articular disorder, intimal hyperplasia, AIDS, muscular atrophy, renal coloboma, hepatitis, LDL receptor deficiency, hyperammonemia, Krabbe disease, Batten disease, spinocerebral ataxia, phenylketonuria, autoimmune disease, amino acid metabolism disorder, organic acid metabolism disorder, fatty acid metabolism disorder, mitochondrial disease, carbohydrate metabolism disorder, lysosomal disease, peroxisomal disease, metal metabolism disorder, purine pyrimidine metabolism disorder, vitamin metabolism disorder, neurotransmitter disorder, lipid metabolism disorder, connective tissue abnormality, congenital porphyria, α1-antitrypsin deficiency, lysosomal storage disease, mucopolysaccharidosis, Fabry disease disease), Canavan disease, Leigh's disease, Refsum disease, Tourette's syndrome, primary lateral sclerosis, progressive muscular atrophy, Pick's disease, muscular dystrophy, myasthenia gravis, Binswanger disease, cerebral infarction, mood disorders, depression, bipolar disorder, persistent affective disorder, secondary mood disorder, schizophrenia, drug dependence, anxiety, obsessive-compulsive disorder, somatoform disorder, dissociative disorder, sadness, postpartum depression, hallucinations, delusions, dementia, paranoia, autism spectrum disorder, attention deficit disorder, psychosexual disorder, sleep disorder, pain disorder, eating disorder, weight disorder, obesity, cachexia, anorexia nervosa, bulimia, etc.In one embodiment, the desired gene can be integrated into therapeutic cells (e.g., chromosomes) used in CART therapy, etc. (e.g., by treating cells in vitro with a virus-derived construct).

[0421] (Viral-derived constructs)

[0422] The viral-derived construct plasmid of the present disclosure is used to produce a viral-derived construct. In one embodiment, the present disclosure provides a method for making a viral-derived construct using the viral-derived construct plasmid of the present disclosure. In one embodiment, the present disclosure provides a composition containing a viral-derived construct or a viral-derived construct made in this way. As a viral-derived construct, a viral-derived construct based on a retrovirus, a lentivirus, an adeno-associated virus, or an adenovirus can be cited. In one embodiment, the present disclosure is a method for making a viral-derived construct, which may include: i) a step of obtaining a viral-derived construct plasmid from a first microbial host cell, wherein the viral-derived construct plasmid contains at least one of the nucleic acid sequences necessary to constitute a viral-derived construct; ii) a step of introducing a viral-derived construct plasmid into a second microbial host cell, and configuring the second microbial host cell under conditions where the aforementioned viral-derived construct plasmid is amplified; and iii) a step of introducing an introduced plasmid based on a viral-derived construct plasmid into a production cell (e.g., an animal cell) to form a viral-derived construct.

[0423] In one embodiment, a viral-derived construct plasmid of the present disclosure is introduced into a producer cell to produce the viral-derived construct. Examples of producer cells include human embryonic kidney cells (cells produced by transfecting human embryonic kidney cells with DNA obtained by cleaving adenovirus 5), 911 cells, PER.C6 cells, E1-transformed amniotic cells, E1-transformed A549 cells, GH329: HeLa cells, HEK293 cells, IT293SF cells, HEK293T, HEK293F, Vero cells, CHO cells, Sf9 cells, Freestyle (trademark) 293-F, Expi293-F (trademark), Expi293 inducible, Expi293 NGT-Viral Production Cells 1.0, Viral Production Cells 2.0 (VPC2.0 cells), AAVpro (registered trademark) 293T Cell Line, Lenti-X (trademark) 293T Cell Line, FreeStyle (trademark) CHO-S cells, ExpiCH OS (trademark), VirusExpress (trademark) 293AAV production cells, VirusExpress (trademark) 293T lentivirus production cells, etc., but not limited to these. Any known suitable production cell can be selected according to the type of virus-derived construct produced. In one embodiment, the virus-derived construct plasmid of the present disclosure may lack a few (e.g., 1, 2, 3, 4 or 5) of the genes of the origin virus of the virus-derived construct and contain all other genes. In one embodiment, the virus-derived construct plasmid of the present disclosure lacks a part of the gene set (gene set) necessary for producing a virus-derived construct, and the genes lacked by the virus-derived construct plasmid in the gene set are trans-supplied with the virus-derived construct plasmid in the production cell. In one embodiment, the virus-derived construct plasmid of the present disclosure can produce a virus-derived construct by being introduced into the production cell alone without being combined with other plasmids. In one embodiment, the viral-derived construct plasmid of the present disclosure can be introduced into the following production cells, wherein the production cells express all genes that are deleted from the viral-derived construct plasmid among the gene sets necessary for producing the viral-derived construct. For example, the viral-derived construct plasmid of the present disclosure containing cap and rep of AAV and E2A, E4 and VA of adenovirus can be introduced separately into HEK293 cells expressing E1A and E1B of adenovirus, thereby producing the viral-derived construct.In one embodiment, the viral-derived construct plasmid of the present disclosure can be introduced into a production cell together with other nucleic acids or gene products thereof (e.g., viral particles) containing genes deleted from the viral-derived construct plasmid among the gene set necessary for producing the viral-derived construct plasmid.

[0424] In one embodiment, the construct derived from a virus can be produced by introducing a construct plasmid derived from a virus into a production cell infected with the origin virus of the construct derived from a virus, and performing homologous recombination in the cell. The construct plasmid derived from a virus used in this embodiment comprises a desired gene and a nucleic acid sequence having homology with any region in the genome of the origin virus (e.g., an intergenic region). In one embodiment, the construct plasmid derived from a virus may have a structure comprising a desired gene between any genes in the genome of the origin virus of the construct plasmid derived from a virus produced. In one embodiment, at least a portion of the nucleic acid contained in the construct plasmid derived from a virus is integrated into the chromosome of the production cell.

[0425] In one embodiment, the viral-derived construct plasmid of the present disclosure contains a nucleic acid-carrying segment (LTR in retrovirus, ITR in AAV virus, etc.) for cutting out the origin virus of the viral-derived construct to be produced, and in one embodiment, the desired gene is contained between the segments. In one embodiment, the viral-derived construct plasmid of the present disclosure contains the desired gene and a promoter and / or terminator linked thereto in a workable manner (for example, capable of working in the target object of the viral-derived construct) between the segments. In one embodiment, the viral-derived construct plasmid of the present disclosure does not contain genes necessary for the replication of the origin virus of the viral-derived construct between the segments. In one embodiment, the viral-derived construct plasmid of the present disclosure contains a packaging signal of the origin virus of the viral-derived construct to be produced.

[0426] The produced construct derived from the virus has structural proteins (capsid, etc.), and the structural proteins can participate in the binding with tissues or cells. Therefore, by modifying the structural proteins to change the binding with tissues or cells (or their surface structures), the targeting of the construct derived from the virus to tissues or cells can be adjusted. In one embodiment, the construct plasmid derived from the virus of the present disclosure may have a gene encoding a structural protein, and the structural protein may be modified. For example, as a modification of the structural protein for adjusting the targeting of tissues or cells, replacement or fusion with other proteins (other viral capsids (for example, capsids of other serotypes of viruses, VSV-G), antigen binding regions of antibodies, ligand proteins of subject organisms (ligands for cancer antigens), etc.) can be cited. In addition, the construct derived from the virus with an envelope can contain cell membrane components of the production cell in the envelope. Therefore, by changing the cell membrane components of the production cell, the targeting of the construct derived from the virus with an envelope to tissues or cells can be adjusted. In one embodiment, in the case of a construct derived from the virus without structural proteins, lipid particles and other substances that are not derived from the virus can be used to adjust the targeting to the cell. In one embodiment, the construct derived from a virus can be designed to target neural cells (cells of the peripheral nervous system or the central nervous system, brain cells such as neurons and oligodendrocytes, etc.), lung cells, eye cells (retinal cells, retinal pigment epithelium, corneal cells, etc.), epithelial cells (e.g., epithelial cells of the intestine or respiratory organs), muscle cells (e.g., skeletal muscle cells, cardiomyocytes, smooth muscle cells, diaphragmatic cells), dendritic cells, pancreatic cells (islet cells, etc.), liver cells, cardiomyocytes, bone cells (e.g., bone marrow stem cells), hematopoietic stem cells, spleen cells, keratinocytes, fibroblasts, endothelial cells, prostate cells, germ cells, cancer cells, etc. Specific surface structures (receptors, etc.) on various cells are known, and those skilled in the art can appropriately select proteins that bind firmly or specifically to the surface structures.

[0427] In one embodiment, the viral construct plasmid of the present disclosure may also contain genes encoding proteins obtained by attenuating proteins of the virus from which the viral construct is produced. The viral construct plasmid of the present disclosure may contain genes encoding any known attenuated viral protein.

[0428] In one embodiment, the present disclosure provides a composition containing a plasmid, which includes a cluster of viral-derived construct plasmids of the present disclosure. In one embodiment, for a composition containing a plasmid, the CCC (covalently closed circular) purity of the plasmid can be about 60% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, or about 95% or more. The viral-derived construct plasmid of the present disclosure and the composition containing the viral-derived construct plasmid of the present disclosure prepared by the method of the present disclosure may have structural features that are completely impossible to analyze or very difficult to analyze in terms of the three-dimensional structure, base modification, etc. of the plasmid. Therefore, the use of the method of the present disclosure to prepare this feature is one of the features of the viral-derived construct plasmid of the present disclosure and the composition containing the viral-derived construct plasmid of the present disclosure appropriately.

[0429] Adenovirus-derived constructs

[0430] Adenovirus is a virus of the genus Adenovirus of the family Adenoviridae. The virus particle consists of a nucleocapsid and a double-stranded linear DNA genome, and has a regular icosahedral structure of 90 to 100 nm. Adenovirus infection begins by adsorption of the viral capsid to the adenovirus receptor (coxackie-adenovirus receptor, CAR) on the cell surface, and then the virus can invade the cell through the integrin on the cell surface. Then, the viral genome that escapes from the lysosome reaches the cell nucleus and can cause the replication of the viral genome. First, the E1A protein is expressed, and the expression of E1B, E2, E3, and E4, which are other early proteins, is activated, thereby starting viral replication. For the viral genome, the terminal protein (TP) expressed by E2 is covalently bonded to deoxycytidine, and the polymerase is further bound thereto to form a complex, thereby starting replication. In addition, the genome encodes structural proteins including penton (L2), hexon (L3), skeletal protein (L4), and fibrous protein (L5), and also includes 5 late transcription units (L1, L2, L3, L4 and L5) under the control of a single promoter. Both ends of the genome contain reverse terminal sequences (inverted terminal repeats: ITR) necessary for viral replication. After the structural proteins of the virus are translated in the cytoplasm, they move to the nucleus to form viral particles, which recognize the packaging signal (ψ) of the viral genome and package the genome. In addition, adenovirus produces protein non-coding VA RNA, which is encoded by the VA gene. Adenovirus particles can have L2 and L3 capsids.

[0431] To date, 52 antigenic types of human adenovirus have been identified, which are divided into six subgroups based on the properties of hemagglutination reactions and sequence homology: subgroup A (e.g., serotypes 12, 18, and 31), subgroup B (e.g., serotypes 3, 7, 11, 14, 16, 21, 34, 35, and 50), subgroup C (e.g., serotypes 1, 2, 5, and 6), subgroup D (e.g., serotypes 8, 9, 10, 13, 15, 17, 19, 20, 22-30, 32, 33, 36-39, and 42-48), subgroup E (e.g., serotype 4), subgroup F (e.g., serotypes 40 and 41), and unclassified serotype groups (e.g., serotypes 49 and 51).

[0432] In one embodiment, the construct plasmid derived from adenovirus contains at least one of the nucleic acid sequences necessary for constituting a construct derived from adenovirus and a desired gene. In one embodiment, the construct plasmid derived from adenovirus contains the desired gene between 5'ITR and 3'ITR. In one embodiment, the construct plasmid derived from adenovirus contains the desired gene, promoter and terminator between 5'ITR and 3'ITR. In one embodiment, the construct plasmid derived from adenovirus does not contain one or more (e.g., all) of the nucleic acid sequences necessary for constituting a construct derived from adenovirus between 5'ITR and 3'ITR. In one embodiment, the construct plasmid derived from adenovirus is constructed in a manner that allows the construct plasmid derived from virus and the production cell to function in such a production cell that contains the nucleic acid sequences necessary for constituting a construct derived from adenovirus. In one embodiment, one or more (e.g., all) of the genes not contained in the construct plasmid derived from virus in the nucleic acid sequences necessary for constituting a construct derived from adenovirus can also be encoded by the chromosome of the production cell.

[0433] In one embodiment, the nucleic acid sequence necessary for constituting a construct derived from an adenovirus may include genes encoding E1A, E1B, E2A, E2B, E3, E4, L1, L2, L3, L4, L5, IX, and IVa2. In one embodiment, the nucleic acid sequence necessary for constituting a construct derived from an adenovirus may be all genes of the adenovirus except E3. In one embodiment, the nucleic acid sequence necessary for constituting a construct derived from an adenovirus may include: nucleic acid sequences encoding structural proteins (L2, L3); nucleic acid sequences encoding packaging factors (E1A, E1B, E2A, E2B, E4); two terminal repeat sequences (5'ITR, 3'ITR); and nucleic acid sequences encoding functional auxiliary factors. In one embodiment, the nucleic acid sequence encoding functional auxiliary factors may be all adenovirus genes except L2, L3, E1A, E1B, E2A, E3, E2B, E4, 5'ITR, and 3'ITR. In one embodiment, the construct plasmid derived from adenovirus may not contain one or more of VA, E1A, E1B, E2A, E2B, and E4. In one embodiment, the nucleic acid sequence necessary for constituting the construct derived from adenovirus contains them. In a specific embodiment, the construct plasmid derived from adenovirus does not contain E1A and E1B. In one embodiment, the construct plasmid derived from adenovirus may be deficient in E1A, and a desired gene may be inserted into the deletion site. It is known that VA RNA interacts with export proteins, RISK, Dicer, etc. in humans. By deleting VA from the construct plasmid derived from adenovirus, the side effects on cells infected with the construct derived from adenovirus can be reduced. Since E1A, E1B, E2A, E2B, and E4 are genes necessary for the replication of adenovirus, the replication ability of the construct plasmid derived from adenovirus obtained by deleting them in infected cells can be reduced.

[0434] In one embodiment, the adenovirus-derived construct of the present disclosure may be derived from human subgroup C, such as serotype 2 or serotype 5. In one embodiment, the adenovirus-derived construct of the present disclosure may be derived from serotype 12 (subgroup A), serotype 7 or serotype 35 (subgroup B), serotype 30 or serotype 36 (subgroup D), serotype 4 (subgroup E), or serotype 41 (subgroup F). Examples of production cells for producing adenovirus-derived constructs include HEK293, HEK293T, HEK293F, Hela, Sf9, and the like.

[0435] Adeno-associated virus-derived constructs

[0436] Adeno-associated virus (AAV) is a linear single-stranded DNA virus of the genus Dependaviridae of the family Parvoviridae, and the diameter of the virus particles is 20 to 26 nm. The proliferation of AAV requires adenoviral elements. There is a T-shaped hairpin structure called ITR (inverted terminal repeat) at the two ends of the AAV genome. A part of this ITR becomes the starting point of replication and plays the role of a primer. In addition, the packaging into the virus particles and the integration into the chromosomal DNA of the host cell also require this ITR. In the left half of the genome, there is a rep gene encoding non-structural proteins, that is, regulatory proteins (Rep78, Re p76, Rep52, Rep40) that control replication and transcription, and in the right half of the genome, there is a cap gene encoding three capsid proteins that are structural proteins (VP1, VP2, VP3).

[0437] The life cycle of AAV can be divided into latent infection and lytic infection. The former is characterized by being integrated into the AAV S1 region (19q13.3-qter) of the long arm of chromosome 19 of the host cell in the case of single infection. This integration is carried out by non-homologous recombination and is related to Rep. It has been reported that Rep78 / Rep76 binds to the base sequence (GAGC repeat sequence) that is common in the AAVS1 region and the Rep binding region of the ITR. Therefore, it is believed that when wild-type AAV infects the target cell, Rep binds to the ITR and AAVS1 of AAV, and through the mediation of Rep, site-specific integration occurs on chromosome 19 of the AAV genome. In the case of simultaneous infection with helper viruses such as adenovirus, and in the case of further repeated infection of AAV latently infected cells with helper viruses, AAV replication occurs, and a large amount of virus is released due to cell destruction (lytic infection).

[0438] In one embodiment, the construct plasmid derived from AAV contains at least one of the nucleic acid sequences necessary for constituting a construct derived from AAV and a desired gene. In one embodiment, the construct plasmid derived from AAV contains the desired gene between 5'ITR and 3'ITR. In one embodiment, the construct plasmid derived from AAV contains the desired gene, promoter and terminator between 5'ITR and 3'ITR. In one embodiment, the construct plasmid derived from AAV does not contain one or more (e.g., all) of the nucleic acid sequences necessary for constituting a construct derived from AAV between 5'ITR and 3'ITR. In one embodiment, the construct plasmid derived from AAV is constructed in a manner that allows the construct plasmid derived from the virus and the production cell to function in such a production cell that contains the nucleic acid sequences necessary for constituting a construct derived from AAV. In one embodiment, one or more (e.g., all) of the genes not included in the construct plasmid derived from the virus in the nucleic acid sequences necessary for constituting a construct derived from AAV can be encoded by the chromosome of the production cell.

[0439] In one embodiment, the nucleic acid sequences necessary for constituting a construct derived from AAV may be 5'ITR, rep, cap, AAP (assembly activating protein), MAAP (membrane-associated accessory protein) and 3'ITR of AAV, and E1A, E1B, E2A, VA and E4 of adenovirus. In one embodiment, the nucleic acid sequences necessary for constituting a construct derived from AAV may include: a nucleic acid sequence encoding an AAV structural protein (cap); a nucleic acid sequence encoding an AAV packaging factor (rep); two terminal repeat sequences of AAV (5'ITR, 3'ITR); and a nucleic acid sequence encoding a functional accessory factor (E1A, E1B, E2A, VA, E4 of adenovirus). In one embodiment, the construct plasmid derived from AAV may not include one or more of rep, cap, VA, E1A, E1B, E2A, E4. In one embodiment, the nucleic acid sequences necessary for constituting a construct derived from adenovirus include them.

[0440] Regarding AAV, serotypes 1 to 12 have been reported based on the capsid. In addition, serotypes rh10, DJ, DJ / 8, PHP.eB, PHP.S, AAV2-retro, AAV2-QuadYF, AAV2.7m8, AAV6.2, rh.74, AAV2.5, AAV-TT, and Anc80 have also been reported. The AAV-derived construct of the present disclosure can be prepared based on an appropriate serotype of AAV depending on the target tissue. For example, the relationship of (serotype): (target tissue) can be selected as follows; (AAV1): (muscle, liver, respiratory tract, nerve cells), (AAV2): (muscle, liver, nerve cells), (AAV3): (muscle, liver, nerve cells), (AAV4): (muscle, ependymal cells), (AAV5): (muscle, liver, nerve cells, glial cells, respiratory tract), (AAV6): (muscle, liver, respiratory tract, nerve cells), (AAV7): (muscle, liver), (AAV 8): (muscle, liver), (AAV9): (muscle, liver, respiratory tract). Examples of producer cells for producing AAV-derived constructs include HEK293, HEK293T, HEK293F, Hela, Sf9 and the like. As the capsid of AAV, in addition to the wild-type capsid, there can be mentioned capsids with targeted mutations (AAV2i8, AAV2.5, AAV-TT, AAV9.HR, etc.), capsids with random mutations (AAV-PHP.B, etc.), and capsids designed in silico (Anc80, etc.). In one embodiment, the construct derived from AAV of the present disclosure can include these modified capsids, and the construct plasmid derived from AAV of the present disclosure can also be constructed in a manner encoding these modified capsids. In this specification, when it is recorded that the nucleic acid sequence is derived from a specific serotype, it can be expected that the nucleic acid sequence can encode a wild-type capsid or a capsid modified as described above based on the wild-type capsid.

[0441] · Retroviral-derived constructs

[0442] In this specification, "retrovirus" generally refers to viruses of the Retroviridae family. Retroviruses are double-stranded RNA enveloped viruses, which are mainly characterized by the ability to reverse transcribe the genome from RNA to DNA. The length of the virion is about 100 to 120 nm in diameter, and contains a dimeric genome of the same positive-strand RNA that forms a complex with the nucleocapsid protein. The genome is enclosed in a capsid containing enzyme proteins necessary for viral infection, namely reverse transcriptase, integrase and protease. The matrix protein forms a layer on the outside of the capsid core, which interacts with the envelope surrounding the viral core particle, which is a lipid bilayer derived from the host cell membrane. Viral envelope glycoproteins that recognize specific receptors on host cells and start the infection process are fixed on the bilayer. The envelope protein is formed by two subunits, a transmembrane (TM) that fixes the protein in the lipid membrane and a surface (SU) that binds to cell receptors.

[0443] As retrovirus, mouse leukemia virus (MLV), human immunodeficiency virus (HIV), equine infectious anemia virus (EIAV), mouse mammary tumor virus (MMTV), Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney mouse leukemia virus (Mo-MLV), FBR mouse osteosarcoma virus (FBR MSV), Moloney mouse sarcoma virus (Mo-MSV), Abelson mouse leukemia virus (A-MLV), avian myeloma virus 29 (MC29), and avian encephalomyelitis virus (AEV), and lentivirus can be cited, but are not limited to these. Slow virus can be divided into "primates" and "non-primates". As an example of primate slow virus, human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV), which are the causative substances of human acquired immunodeficiency syndrome (AIDS), can be cited. The non-primate lentivirus group includes the prototype “lentivirus” Vesna-Medie virus (VMV), as well as the related caprine arthritis encephalitis virus (CAEV), equine infectious anemia virus (EIAV), and the recently described feline immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV).

[0444] During the infection process, retroviruses initially attach to specific cell surface receptors. If they invade sensitive host cells, the retroviral RNA genome is copied into DNA by reverse transcriptase. The DNA is transported to the host cell nucleus and then integrated into the host genome, a state known as provirus. Proviruses are stable in host chromosomes during cell division and are transcribed like other cellular proteins. Proviruses can encode proteins and packaging mechanisms needed to make more viruses and leave the cell in a budding manner. If retroviruses sprout from host cells, they contain host cell lipid membranes. As described above, membrane proteins derived from host cells become part of retroviral particles.

[0445] The genome of retrovirus contains four genes: gag (group-specific antigen), pro (protease), pol (polymerase) and env (envelope). The gag sequence encodes three major structural proteins: matrix protein, nucleocapsid protein, and capsid protein. The pro sequence encodes a protease that is responsible for cutting Gag and Gag-Pol during the aggregation, budding and maturation of particles. The pol sequence encodes the enzymes of reverse transcriptase and integrase, the former catalyzing the reverse transcription from the RNA of the viral genome to DNA during the infection process, and the latter responsible for processing the LTR and integrating the proviral DNA into the host cell genome. The env sequence encodes both the SU and TM subunits of the envelope glycoprotein. The ability of retroviruses to bind to their target host cells using specific cell surface receptors can be provided by the surface component (SU) of the Env protein, and the ability of retroviruses to enter cells through membrane fusion can be conferred by the membrane-anchored transmembrane component (TM). The retroviral genome contains elements necessary for promoting gene expression, reverse transcription, and integration into host cell chromosomes, such as two LTRs (long terminal repeats), a packaging signal (ψ) sequence necessary for specific packaging of viral RNA into newly formed virions, and a non-coding cis-acting sequence such as a polypurine tract (PPT) that functions as a site for starting positive-strand DNA synthesis during reverse transcription. The long terminal repeat (LTR) is about 600 nt in length, of which the U3 region is 450 nt in length, the R sequence is 100 nt in length, and the U5 region is about 70 nt in length.

[0446] The genome of complex retroviruses such as lentiviruses may contain, in addition to gag, pro, pol and en v, additional genes that regulate viral gene expression, aggregation of infectious particles, and viral replication in infected cells. A representative lentivirus is HIV-1. Lentiviruses may contain two control genes, tat and rev. For example, HIV-1 also contains vif, vpr, vpu and nef. In addition, there are additional genes such as vpx. These additional genes are involved in the synthesis and processing of viral RNA and the control of other replication functions. In particular, HIV also contains structural landmarks (TAR, RRE, PE, SLIP, CRS, INS) and the like. Lentivirus particles may contain p24 capsid protein.

[0447] In one embodiment, the construct plasmid derived from a retrovirus includes at least one of the nucleic acid sequences necessary for constituting a construct derived from a retrovirus and a desired gene. In one embodiment, the construct plasmid derived from a retrovirus includes a desired gene between 5'LTR and 3'LTR. In one embodiment, the construct plasmid derived from a retrovirus may include a primer binding site (PBS) and / or a polypurine tract (PPT) between 5'LTR and the desired gene. In one embodiment, the construct plasmid derived from a retrovirus may include a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) between the desired gene and 3'LTR. In one embodiment, the construct plasmid derived from a retrovirus is constituted in a manner that allows the construct plasmid derived from a virus and the production cell to include the nucleic acid sequence necessary for constituting a construct derived from a retrovirus, and the production cell to function in such a production cell. In one embodiment, one or more (e.g., all) of the genes not included in the construct plasmid derived from a virus in the nucleic acid sequence necessary for constituting a construct derived from a retrovirus can be encoded by the chromosome of the production cell. In one embodiment, when constructing a construct derived from a retrovirus, env can be replaced with a gene encoding VSV-G (glycoprotein G of vesicular stomatitis virus (VSV)). In one embodiment, a plasmid of a construct derived from a retrovirus (including a lentivirus) can additionally contain the VSV-G gene. In one embodiment, when constructing a construct derived from a retrovirus (including a lentivirus), a fusion glycoprotein (FuG-B) formed by replacing the glycoprotein gene (RV-G) of the rabies virus or the intracellular domain of RV-G with the intracellular domain of the vesicular stomatitis virus glycoprotein (VSV-G) can be used on the basis of env or in place of env, and the plasmid of a construct derived from a retrovirus (including a lentivirus) can also contain these genes.

[0448] In one embodiment, the nucleic acid sequence necessary for constituting a construct derived from a retrovirus may include a nucleic acid sequence encoding a structural protein (gag), a packaging factor (ψ), two terminal repeat sequences (5'LTR, 3'LTR), and a nucleic acid sequence encoding a functional auxiliary factor. In one embodiment, the nucleic acid sequence encoding a functional auxiliary factor may be pro, pol, and env. In one embodiment, the construct plasmid derived from a retrovirus may not include one or more of gag, pro, pol, and env. In one embodiment, the nucleic acid sequence necessary for constituting a construct derived from a retrovirus includes them. Since pol is a gene necessary for the replication of a retrovirus, the replication ability of the construct plasmid derived from a retrovirus obtained by deleting it in infected cells is reduced. In one embodiment, the construct plasmid derived from a retrovirus does not include one or more (e.g., all) of the nucleic acid sequences necessary for constituting a construct derived from a retrovirus between 5'LTR and 3'LTR. In one embodiment, the construct plasmid derived from a retrovirus includes the desired gene between 5'LTR and 3'LTR. In one embodiment, the construct plasmid derived from retrovirus contains the desired gene, promoter, and terminator between 5'LTR and 3'LTR. In one embodiment, the construct plasmid derived from retrovirus can be modified in a manner that the U3 region of LTR is deleted. As production cells for producing constructs derived from retrovirus, cells such as HEK293T can be cited.

[0449] In one embodiment, the nucleic acid sequences necessary for constituting a construct derived from a lentivirus may include: nucleic acid sequences encoding structural proteins (gag, pol, VSV-G, env); packaging factors (packaging signal (ψ) sequence); two terminal repeat sequences (5'LTR, 3'LTR); and nucleic acid sequences encoding functional auxiliary factors. In one embodiment, the nucleic acid sequence encoding the functional auxiliary factor may be rev. In one embodiment, the construct plasmid derived from a lentivirus may not include one or more of rev, gag, pro, pol, and env. In one embodiment, the nucleic acid sequences necessary for constituting a construct derived from a lentivirus include them. Since pol and rev are genes necessary for the replication of the lentivirus, the replication ability of the construct plasmid derived from the lentivirus obtained by deleting them in infected cells is reduced. In one embodiment, the construct plasmid derived from a lentivirus may include one or more of tat, vif, vpr, vpu, nef, vpx, TAR, RRE, PE, SLIP, CRS, INS, APP, MAAP, RPE, PPT, PRE, WRPE, and oPRE. In one embodiment, the construct plasmid derived from a lentivirus does not include one or more (e.g., all) of the nucleic acid sequences necessary for constituting a construct derived from a lentivirus between 5'LTR and 3'LTR. In one embodiment, the construct plasmid derived from a lentivirus includes the desired gene between 5'LTR and 3'LTR. In one embodiment, the construct plasmid derived from a lentivirus includes the desired gene, promoter, terminator, and WPRE between 5'LTR and 3'LTR. In one embodiment, the construct plasmid derived from a lentivirus may be modified in a manner that the U3 region and TAT of the LTR are deleted. In one embodiment, the construct plasmid derived from a retrovirus may be modified in a manner that the U3 region of the LTR is deleted. Examples of producer cells for producing a construct derived from a lentivirus include HEK293T, HEK293, Hela and the like cells.

[0450] In one embodiment, the present disclosure provides a composition containing a virus-derived construct, which includes a cluster of virus-derived constructs of the present disclosure. In one embodiment, for a composition containing a virus-derived construct, the number of virus-derived construct particles relative to the number of virus-derived construct genome copies (VP / VG) can be 35, 30, 25, 20, 15, 10 or 5 or less. The virus-derived construct of the present disclosure and the composition containing the virus-derived construct of the present disclosure prepared by the method of the present disclosure can have structural features that are completely impossible to analyze or very difficult to analyze in terms of the three-dimensional structure, surface modification, etc. of the virus-derived construct. Therefore, the feature of preparing this feature using the method of the present disclosure is one of the features of the virus-derived construct of the present disclosure and the composition containing the virus-derived construct of the present disclosure that are appropriately described.

[0451] (Preparation of virus-derived construct plasmid)

[0452] In one embodiment, the present disclosure provides a method for making a viral-derived construct plasmid of the present disclosure, the method comprising the step of linking a plurality of nucleic acid sequences in an operable manner. In one embodiment, the method for making a viral-derived construct plasmid of the present disclosure comprises: a step of obtaining a viral-derived constituent plasmid from a first microbial host cell, the viral-derived constituent plasmid comprising at least one of the nucleic acid sequences necessary to constitute a viral-derived construct; and ii) a step of introducing the viral-derived constituent plasmid into a second microbial host cell, and configuring the second microbial host cell under conditions for amplifying the viral-derived constituent plasmid. In one embodiment, the first microbial host cell may be a transformant (Bacillus subtilis, etc.). In one embodiment, the second microbial host cell may be Escherichia coli. In one embodiment, the method for making a viral-derived construct plasmid of the present disclosure comprises the steps of introducing a nucleic acid having a sequence that replicates in Bacillus subtilis and comprising a nucleic acid sequence for producing a viral-derived construct into a host cell, and forming a plasmid in the aforementioned host cell. In this specification, in one embodiment, since Bacillus subtilis can form a plasmid from a nucleic acid taken in from the outside, in this method, the introduced nucleic acid may not be a plasmid. For example, after Bacillus subtilis is contacted with a nucleic acid (e.g., a non-circular nucleic acid having a tandemly repeated nucleic acid sequence), the nucleic acid can be taken in to form a plasmid in Bacillus subtilis (e.g., with reference to the OGAB method described in this specification).

[0453] In one embodiment, when making a virally derived constituent plasmid, a nucleic acid sequence other than a nucleic acid sequence necessary for constituting a virally derived constituent (recorded as a vector portion nucleic acid sequence in this specification) can be fragmented into a plurality of fragments. In the OGAB method, nucleic acid fragments are used to construct a plasmid, but the vector portion nucleic acid sequence can also be fragmented by combining with a nucleic acid sequence necessary for constituting a virally derived constituent and / or independently thereof, and provided to the OGAB method, thereby also being able to flexibly design the vector portion. The vector portion that can be commonly used for the construction of various viral vector plasmids can also include portions that are not required when constructing different viral vector plasmids, so the flexibility of the design of the vector portion can achieve miniaturization of the vector plasmid. In one embodiment, the step of obtaining a viral-derived constituent plasmid from a first microbial host cell (the viral-derived constituent plasmid comprises at least one of the nucleic acid sequences necessary for constituting a viral-derived construct) comprises obtaining the viral-derived constituent plasmid from a plurality of nucleic acid fragments, the plurality of nucleic acid fragments comprising at least 2 (e.g., 2 to 20, 2 to 10, 2 to 5, 3 to 20, 3 to 10, 3 to 5, 4 to 20, 4 to 10, 5 to 20, 5 to 10, etc.) nucleic acid fragments containing a vector partial nucleic acid sequence.

[0454] The vector part usually includes a nucleic acid sequence having a function different from an element (e.g., a sequence encoding a capsid, a sequence controlling it, etc.) related to the production of a construct derived from a virus, and may include an element for making the handling of a viral vector plasmid easy, etc. In one embodiment, the vector part nucleic acid sequence includes a nucleic acid sequence having a function of nucleic acid replication, drug resistance, adjustment of the copy number, improvement of stability, or improvement of operability based on genetic engineering (design of a multiple cloning site). For example, the vector part nucleic acid sequence may include a nucleic acid sequence of a replication start point, a drug resistance gene, a promoter, a centromere sequence, a transfer gene, a replication regulatory gene, a transfer regulatory gene, a toxin gene, an antitoxin gene, a homologous recombination site, or a multiple cloning site. The vector part nucleic acid sequence can be modularized (blocked) according to each functional unit, where one module can be contained in one nucleic acid fragment or in multiple nucleic acid fragments. By preparing a variety of nucleic acid fragments in advance as modules with similar functions such as drug resistance, a novel viral-derived construct plasmid can be effectively produced.

[0455] In one embodiment, the present disclosure provides: a method for making a viral-derived construct plasmid of the present disclosure, which makes a construct plasmid derived from an adeno-associated virus in Bacillus subtilis; a viral-derived construct plasmid and a viral-derived construct made by such a method. Virus-derived genes often have difficulty replicating due to host cells due to the generation of mutations and the hindrance of host cell proliferation. In particular, the ITR contained in AAV is also prone to mutations in Escherichia coli and is difficult to replicate. In addition, even with existing technology, the replication of viral-derived construct plasmids is not easy to achieve in any host cell. Various studies have been conducted on the replication of viral-derived construct plasmids based on Escherichia coli, but it is not easy to construct and replicate viral-derived construct plasmids by changing the host to Bacillus subtilis. Through the experiments of the present disclosure, the formation and production of viral-derived construct plasmids in Bacillus subtilis can be achieved for the first time.

[0456] In one embodiment, the method for producing a virus-derived construct plasmid of the present disclosure may also include the following step: taking out a portion of the virus-derived construct plasmid of the present disclosure (e.g., a plasmid obtained by the method for producing a virus-derived construct plasmid of the present disclosure), and integrating (cloning) it into another plasmid (which may be a virus-derived construct plasmid of the present disclosure). A portion of the other plasmid may also be removed during integration. For example, in the case where a nucleic acid sequence that can provide a higher yield of a virus-derived construct is found in one or more of the nucleic acid sequences (A) to (D) that are necessary for constituting a virus-derived construct, the yield of the virus-derived construct can be increased by replacing it with the corresponding nucleic acid sequence (A) to (D) of an existing virus-derived construct plasmid. For example, in the case where a virus-derived construct plasmid containing a promoter that expresses a desired gene well when arranged upstream of a specific desired gene is obtained, a virus-derived construct that highly expresses the desired gene can be obtained by integrating the promoter and the nucleic acid sequence of the desired gene region into an existing virus-derived construct plasmid.

[0457] In one embodiment, the method for introducing nucleic acid into Bacillus subtilis can be any method, for example, the use of competent Bacillus subtilis, electroporation, a method using a particle gun (gene gun), a calcium phosphate method, etc. The so-called "competent state" refers to a state in which the cell becomes more permeable to exogenous substances (e.g., nucleic acids). In order to make Bacillus subtilis competent, any known method can be used, for example, the method described in Anagnostopoulou, C. and Spizizen, JJ Bacteriol., 81, 741-746 (1961) can be used. In one embodiment, the virus-derived construct plasmid of the present disclosure can be made in Bacillus subtilis and amplified directly in the same Bacillus subtilis.

[0458] When a nucleic acid is introduced into Bacillus subtilis to produce a virus-derived construct plasmid having a structure different from that of the nucleic acid, the introduced nucleic acid may contain the elements of the virus-derived construct plasmid described in detail above.

[0459] (OGAB method)

[0460] In one embodiment, the virus-derived construct plasmid of the present disclosure can be prepared using the OGAB method. The OGAB (Ordered Gene Assembly in Bacillus subtilis) method is a method of generating a circular plasmid in a transformed organism by ingesting a clustered nucleic acid into the transformed organism. The OGAB method can easily prepare a plasmid containing a large-sized nucleic acid. In this specification, the nucleic acid ingested by the transformed organism is referred to as a "clustered nucleic acid". Typically, the clustered nucleic acid has a tandem repeating structure in which one unit of the plasmid and one group of unit nucleic acids are repeated in the same direction. By using a clustered nucleic acid with such a structure, the generation of plasmids in the transformed organism can be promoted. In this specification, the so-called "unit nucleic acid" refers to a nucleic acid molecule or a portion of a nucleic acid molecule having a portion of the sequence constituting the clustered nucleic acid. As described in detail below, a plurality of unit nucleic acids are prepared into a unit vector, and then the clustered nucleic acid is constructed.

[0461] The following describes the steps for preparing the aggregated nucleic acid for ingestion by the transformed organism.

[0462] Preparation of unit nucleic acid

[0463] Prepare unit nucleic acids for integration into aggregated nucleic acids. Unit nucleic acids can be prepared by any known method, for example, by polymerase chain reaction (PCR) or chemical synthesis. Unit nucleic acids may have any desired sequence, such as a sequence encoding a desired protein (therapeutic protein, protein constituting a construct derived from a virus, etc.) or a portion thereof, a sequence controlling a gene (promoter, enhancer, etc.), a sequence for operating nucleic acids (restriction endonuclease recognition sequence, etc.). When integrated into aggregated nucleic acids, in order to arrange a plurality of unit nucleic acids in a specific order and / or characteristic direction, the ends of each unit nucleic acid may be constructed in a manner that produces a specific protruding sequence.

[0464] Finally, many unit nucleic acids can be accumulated on the plasmid, so it can be designed in a way that one or more unit nucleic acids encode one or more genes with a long base length. As genes with a long base length, for example, a gene set constituting a series of metabolic pathways can be cited.

[0465] Preparation of unit carrier

[0466] The unit nucleic acid and the additional nucleic acid different therefrom can be linked to prepare a unit vector. By using a unit vector, the unit nucleic acid can be handled more easily.

[0467] The additional nucleic acid may be a linear nucleic acid or a circular plasmid. When a circular plasmid is used as an additional nucleic acid, the unit vector also has a circular structure, and therefore, it can be used for transformation of, for example, Escherichia coli. In one embodiment, in order to replicate the unit vector in the introduced host, the additional nucleic acid may include a replication start point. In one embodiment, all unit nucleic acids used to construct a certain aggregated nucleic acid may be linked to additional nucleic acids of the same type. In this way, the size difference between unit vectors can be reduced, and the operation of multiple unit vectors becomes easy. In one embodiment, the unit nucleic acid used to construct a certain aggregated nucleic acid may be linked to additional nucleic acids of different types. In one embodiment, for one or more unit nucleic acids used to construct a certain aggregated nucleic acid, the ratio of (base length of unit nucleic acid) / (base length of unit vector) or its average value may be 50% or less, 40% or less, 30% or less, 20% or less, 15% or less, 10% or less, 7% or less, 5% or less, 2% or less, 1.5% or less, 1% or less, or 0.5% or less. The larger the size of the additional nucleic acid is compared to the unit nucleic acid, the more uniform the operation of different types of unit vectors can be performed. The connection between the unit nucleic acid and the additional nucleic acid can be implemented by any method such as connection using DNA ligase, TA cloning, etc. In one embodiment, for one or more unit nucleic acids used to construct a certain aggregated nucleic acid, the ratio of (base length of unit nucleic acid) / (base length of unit vector) or its average value can be 1% or more, 0.3% or more, 0.1% or more, 0.03% or more, 0.01% or more, 0.003% or more or 0.001% or more, and the operation of the unit vector will become easy.

[0468] In one embodiment, the length of the unit nucleic acid can be more than 10 bp, more than 20 bp, more than 50 bp, more than 70 bp, more than 100 bp, more than 200 bp, more than 500 bp, more than 700 bp, more than 1000 bp or more than 1500 bp, and less than 5000 bp, less than 5000 bp, less than 2000 bp, less than 1500 bp, less than 1200 bp, less than 1000 bp, less than 700 bp or less than 500 bp.

[0469] In one embodiment, the aggregated nucleic acid can be constructed from 2 or more, 4 or more, 6 or more, 8 or more, 10 or more, 15 or more, 20 or more, 30 or more, 40 or more, 50 or more, 60 or more, 70 or more, 80 or more, 90 or more, or 100 or more, and 1000 or less, 700 or less, 500 or less, 200 or less, 120 or less, 100 or less, 80 or less, 70 or less, 60 or less, or 50 or less unit nucleic acids. By adjusting the molar number of each unit nucleic acid (or unit vector) to be approximately the same, the desired aggregated nucleic acid having a tandem repeat structure can be efficiently produced.

[0470] In one embodiment, the unit nucleic acid may have a base length obtained by dividing a group of repetitive sequences in the aggregated nucleic acid by approximately equal parts according to the number of unit nucleic acids. In this way, it becomes easy to make the molar number of each unit nucleic acid (or unit carrier) consistent. In one embodiment, the unit nucleic acid may have a base length that is increased or decreased by less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 7% or less than 5% from the base length obtained by dividing a group of repetitive sequences in the aggregated nucleic acid by approximately equal parts according to the number of unit nucleic acids.

[0471] In one embodiment, the unit nucleic acid can be designed to have a non-palindromic sequence (a sequence that is not a palindromic sequence) at the end of the unit nucleic acid. For the unit nucleic acid designed in this way, when the non-palindromic sequence is a protruding sequence, it is easy to provide a structure in which the unit nucleic acids in the aggregated nucleic acid are linked in a state where the order is maintained.

[0472] ·Production of aggregated nucleic acids

[0473] Aggregate nucleic acids can be constructed by linking unit nucleic acids to each other. In one embodiment, unit nucleic acids can be prepared by cutting out from unit vectors using restriction endonucleases or the like. Aggregate nucleic acids may contain more than one, more than two, more than three, more than four, more than five, more than six, more than seven, more than eight, more than nine, or more than ten repetitive sequence groups. The repetitive sequence in the aggregate nucleic acid may include the sequence of the unit nucleic acid and the sequence of the aggregate vector nucleic acid as required. Aggregate nucleic acids may have a sequence that enables replication of nucleic acids in transformed organisms. In one embodiment, the sequence that enables replication of nucleic acids in transformed organisms may be included in a replication start point that is effective in a transformed organism (e.g., a bacterium of the genus Bacillus (Bacillus subtilis)). The sequence of the replication start point that is effective in Bacillus subtilis is not particularly limited. For example, as a sequence having a θ-type replication mechanism, there can be cited sequences of the replication start point contained in plasmids such as pTB19 (Imanaka, T. et al., J. Gen. Microbioi. 130, 1399-1408. (1984)), pLS32 (Tanaka, T and Ogra, M. FEBS Lett. 422, 243-246. (1998)), and pAMβ1 (Swinfield, TJ et al., Gene 87, 79-90. (1990)).

[0474] In addition to the unit nucleic acid, the aggregated nucleic acid may contain additional base sequences as needed. In one embodiment, the aggregated nucleic acid may contain base sequences that control transcription and translation such as promoters, operators, activators, and terminators. As promoters in the case of using Bacillus subtilis as a host, specifically, Pspac (Yansura, D. and He nner, DJ Pro. Natl. Acad. Sci, USA 81, 439-443. (1984.)) that can control expression using IPTG (isoproyl sD-thiogalactopyranoside) or P r promoter (Itaya, M. Biosci. Biotechnol. Biochem. 63, 602-604. (1999)) and the like can be cited.

[0475] The unit nucleic acid can form a repetitive structure that maintains a certain order and direction in the aggregated nucleic acid. In one embodiment, the unit nucleic acid is constructed in a manner that the base sequences of the protruding ends of the unit nucleic acid cut out from the unit vector are complementary to each other, thereby being able to form a repetitive structure that maintains a certain order and direction in the aggregated nucleic acid. In one embodiment, the structure of the protruding end of each different unit nucleic acid is made unique, thereby being able to efficiently form a repetitive structure that maintains a certain order and direction. In one embodiment, the protruding end can have a non-palindromic sequence, and can be either a 5' end protrusion or a 3' end protrusion.

[0476] In one embodiment, a restriction endonuclease can be used to cut out a unit nucleic acid with a protruding end from a unit vector. In this embodiment, the unit vector may have one or more restriction endonuclease recognition sequences. When the unit vector has multiple restriction endonuclease recognition sequences, each restriction endonuclease recognition sequence can be recognized by the same restriction endonuclease or by different restriction endonucleases. In one embodiment, the unit vector can include a pair of regions recognized by the same restriction endonuclease in a manner that a complete unit nucleic acid region is included between these regions. The restriction endonuclease used is not particularly limited, and type II restriction endonucleases, such as type IIS restriction endonucleases such as AarI, BbsI, Bbv I, BcoDI, BfuAI, BsaI, BsaXI, BsmAI, BsmBI, BsmFI, BspMI, BspQI, BtgZI, FokI, and SfaNI can be used, and these restriction endonucleases can produce protruding ends at a position separated from the recognition sequence by a certain distance on the outside of the recognition sequence. If (e.g., a single IIS type restriction endonuclease is used, the sequence of the protruding end of the excised unit nucleic acid will be different for each unit nucleic acid, and therefore, it will be beneficial to aggregate multiple unit nucleic acids in a certain order and direction. In one embodiment using an IIS type restriction endonuclease, the unit carrier does not include a region recognized by the IIS type restriction endonuclease in the unit nucleic acid region. In an embodiment using a restriction endonuclease that cuts a recognition region, the unit carrier may include a region recognized by the restriction endonuclease at the end of the unit nucleic acid region.

[0477] In one embodiment, when the same type of restriction endonuclease is used to cut out unit nucleic acids from multiple unit carriers, the restriction endonuclease treatment can be performed in a solution containing the multiple unit carriers, thereby improving the efficiency of the operation. The types of restriction endonucleases used to make a certain aggregated nucleic acid can be, for example, less than 5, less than 4, less than 3, less than 2, or 1. By using fewer types of restriction endonucleases, the deviation in the number of moles between unit nucleic acids can be reduced. In one embodiment, the unit nucleic acids cut out from the unit carriers can be easily purified using any known fractionation method such as agarose gel electrophoresis.

[0478] The unit nucleic acid and the aggregation carrier nucleic acid as required can be linked to each other using DNA ligase or the like. In this way, the aggregation nucleic acid can be produced. For example, the linkage of the unit nucleic acid and the aggregation carrier nucleic acid as required can be carried out in the presence of components such as polyethylene glycol (for example, PEG2000, PEG4000, PEG6000, PEG8000, etc.) and salts (for example, monovalent alkali metals, sodium chloride, etc.). The concentration of each unit nucleic acid in the connection reaction solution is not particularly limited and can be 1 fmol / μl or more. The reaction temperature and time of the connection are not particularly limited and are 37°C, 30 minutes or more, etc. In one embodiment, before the unit nucleic acid and the aggregation carrier nucleic acid as required are linked, the composition containing the unit nucleic acid and the aggregation carrier nucleic acid as required can be subjected to any conditions that inactivate the restriction endonuclease (for example, phenol·chloroform treatment).

[0479] For the unit nucleic acid, the method described in WO2015 / 111248 can be used to adjust to approximately the same molar number. By adjusting the unit nucleic acid to approximately the same molar number, the desired aggregated nucleic acid with a tandem repeat structure can be efficiently prepared. By measuring the concentration of the unit carrier or unit nucleic acid, the molar number of the unit nucleic acid can be adjusted.

[0480] · Make plasmids from aggregated nucleic acids

[0481] By bringing the aggregated nucleic acid into contact with the transformed organism, a plasmid can be formed in the transformed organism. In one embodiment, as the transformed organism, Bacillus bacteria, Streptococcus bacteria, Haemophilus bacteria, Neisseria, etc. can be mentioned. As Bacillus bacteria, Bacillus subtilis (B.subtilis), Bacillus megaterium (B.megaterium), Thermophilic Bacillus (B.stearothermophilus), etc. can be mentioned. In a preferred embodiment, the transformed organism is Bacillus subtilis. In one embodiment, the transformed organism that ingests the aggregated nucleic acid is in a competent state and can actively ingest the nucleic acid. For example, Bacillus subtilis in a competent state will cut the double-stranded nucleic acid that will become the substrate on the cell, decompose any one of the two chains from the cutting point, and ingest the other chain into the bacteria. The ingested one chain will be repaired into a circular double-stranded nucleic acid in the bacteria. Any known method can be used to make the transformed organism competent. For example, Bacillus subtilis can be made competent by the method described in Anagnostopoulou, C. and Spizizen, JJ Bacteriol., 81, 741-746 (1961). The transformation method can be a known method suitable for various transformed organisms.

[0482] In one embodiment, the viral construct plasmid produced by the packaging cell can be purified by any known method, and the present disclosure also provides a viral construct plasmid purified in this way. In one embodiment, the purified viral construct plasmid can be confirmed to have the desired nucleic acid sequence by a method for investigating the size pattern of fragments produced by restriction endonuclease cleavage, a PCR method, a base sequencing method, etc. In one embodiment, for a composition containing a viral construct plasmid prepared by the method for preparing a viral construct plasmid of the present disclosure, the endotoxin contained can be a small amount. In one embodiment, a Bacillus subtilis containing a viral construct plasmid of the present disclosure is provided. In one embodiment, the viral construct plasmid of the present disclosure is prepared by at least 2, at least 3, at least 4, at least 5, or more nucleic acid fragments containing a vector partial nucleic acid sequence in the nucleic acid fragment prepared by chemical synthesis or enzyme reaction. In one embodiment, for the viral construct plasmid of the present disclosure, only a plurality of nucleic acid fragments prepared by chemical synthesis or enzyme reaction are circularized and prepared. In one embodiment, the viral construct plasmid of the present disclosure is prepared from 3 or more, 4 or more, 5 or more, 7 or more, 10 or more, 15 or more, 20 or more nucleic acid fragments. In one embodiment, the nucleic acid fragments used in the preparation of the viral construct plasmid of the present disclosure may independently have a length of 20 kb or less, 15 kb or less, 10 kb or less, 7 kb or less, 5 kb or less, 4 kb or less, 3 kb or less, 2 kb or less, 1.5 kb or less, 1 kb or less, 0.7 kb or less, or 0.5 kb or less.

[0483] (Composition)

[0484] In one embodiment, the present disclosure provides a composition comprising a virus-derived construct plasmid or a virus-derived construct described in the present specification.

[0485] (Dosage form, etc.)

[0486] The composition described in this specification can be provided in various forms. As the form of the composition, for example, it can be an injection, capsule, tablet, granule, inhalant, etc. The aqueous solution for injection can be stored in a vial or a stainless steel container. In addition, the aqueous solution for injection can also be combined with, for example, physiological saline, sugar (such as trehalose), NaCl, or NaOH, etc.

[0487] In one embodiment, the composition of the present disclosure includes a pharmaceutically acceptable carrier or excipient. Such a carrier may also be a sterile liquid, such as water and oil, including materials of petroleum, animal, plant or synthetic origin, although not limited, including peanut oil, soybean oil, mineral oil, sesame oil, etc. In the case of oral administration of medicine, water is a preferred carrier. In the case of intravenous administration of pharmaceutical compositions, physiological saline and aqueous glucose are preferred carriers. Physiological saline solutions, as well as aqueous glucose and glycerol solutions are preferably used as liquid carriers for injectable solutions. Suitable excipients include light silicic anhydride, crystalline cellulose, mannitol, starch, glucose, lactose, sucrose, gelatin, malt, rice, wheat flour, chalk, silica gel, sodium stearate, glyceryl monostearate, talc, sodium chloride, skimmed milk powder, glycerol, propylene, ethylene glycol, water, ethanol, carboxymethylcellulose calcium, carboxymethylcellulose sodium, hydroxypropyl cellulose, hydroxypropyl methylcellulose, polyvinyl alcohol acetal diethylamino acetate, polyvinyl pyrrolidone, gelatin, medium chain fatty acid triglyceride, polyoxyethylene hydrogenated castor oil 60, poloxamer, white sugar, carboxymethyl cellulose, corn starch, inorganic salts, etc. When desired, the composition may also contain a small amount of wetting agent or emulsifier, or pH buffer. These compositions may also be in the form of solution, suspension, emulsion, tablet, pill, capsule, powder, sustained release complex, etc. Traditional binders and carriers, such as triglycerides, may also be used to prepare the composition as a suppository. Oral complexes can also include standard carriers such as medical grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate. Examples of suitable carriers are described in EWMartin, Remington's Pharmaceutical Sciences (Mark Publishing Company, Easton, USA). In addition, for example, surfactants, excipients, colorants, flavoring agents, preservatives, stabilizers, buffers, suspending agents, isotonic agents, binders, disintegrants, lubricants, fluidity promoters, flavoring agents, etc. can also be included. In one embodiment, the pH of any liquid composition of the present disclosure can be about 3, about 3.5, about 4, about 4.5, about 5, about 5.5, about 6, about 6.5, about 7, about 7.5, about 8, about 8.5, about 9, about 9.5, about 10, about 10.5, about 11 or the range between any two values ​​thereof.

[0488] Any component of the composition of the present disclosure may be provided in the form of a pharmaceutically acceptable salt, for example, a salt formed with a free carboxyl group derived from hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid, etc., a salt formed with a free amine group such as an amine group derived from isopropylamine, triethylamine, 2-ethylaminoethanol, histidine, procaine, etc., and a salt formed with sodium, potassium, ammonium, calcium and ferric hydroxide.

[0489] In a preferred embodiment, the composition can be prepared in the form of a pharmaceutical composition suitable for administration to a human being according to known methods. Such a composition can be administered by injection. Typically, the composition for administration by injection is a solution in a sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizer and a local anesthetic such as lidocaine to relieve pain at the injection site. Typically, the components can be supplied separately or mixed together in a unit administration model, for example, in a sealed container such as an ampoule or a pouch showing the amount of the active agent, in the form of a lyophilized powder or a water-free concentrate. In the case of administering the composition by injection, an injection bottle containing sterile pharmaceutical grade water or saline can also be used for distribution. In the case of administering the composition by injection, an ampoule of sterile water or saline for injection can also be provided in a manner that the components can be mixed before administration.

[0490] (Use and Purpose)

[0491] The viral-derived construct plasmid or viral-derived construct described in the present specification, or a composition comprising the same, can be used for various purposes such as gene therapy, functional genomics, cancer vaccination, and / or antiviral vaccination.

[0492] When the virus-derived construct of the present disclosure or a composition containing a virus-derived construct is applied to a subject, the subject is not particularly limited and may be a mammal (e.g., mouse, rat, hamster, rabbit, cat, dog, cow, sheep, pig, monkey, human, etc.), bird, reptile, amphibian, arthropod, fish, etc.

[0493] The amount of the viral-derived construct or the composition containing the viral-derived construct of the present disclosure may vary depending on the nature of the disorder or state to be treated or prevented, and those skilled in the art may determine it based on the description of this specification and standard clinical techniques. Depending on the circumstances, in vitro analysis may also be used to assist in determining the optimal dosage range. In addition, the exact dosage to be used in the complex may also vary depending on the route of administration and the severity of the disease or disorder, and therefore should be determined based on the judgment of the responsible physician and the condition of each patient. The administration amount of the viral-derived construct or the composition containing the viral-derived construct of the present disclosure is not particularly limited, and for example, it may be 1×10 5 pcs, 1×10 6 pcs, 1×10 7 pcs, 1×10 8 pcs, 1×10 9 pcs, 1×10 10 pcs, 1×10 11 pcs, 1×10 12 pcs, 1×10 13 pcs, 1×10 14 or 1×10 15 The number of constructs derived from viruses may be within the range of any two values ​​mentioned above. The administration interval is not particularly limited, for example, it may be administered once or twice every 1, 7, 14, 21 or 28 days, or it may be administered once or twice within the range of any two values ​​mentioned above. The administration amount, administration interval, and administration method may be appropriately selected according to the patient's age, weight, symptoms, target organ, etc.

[0494] The administration route of the construct derived from the virus or the composition containing the construct derived from the virus recorded in this specification can be, for example, intravenous, intradermal, subcutaneous, intramuscular, intraperitoneal, intramedullary, intraventricular, intracerebral parenchyma, transpulmonary, intranasal, epidural, or oral administration, etc. In one embodiment, the composition of the present disclosure and various conveying (delivery) systems can be used together. In such a system, there are, for example, encapsulation in liposomes, microparticles, and microcapsules, and the application of receptor-mediated endocytosis, etc. The medicine can be administered by a suitable route, for example, by injection, by bolus injection, by absorption through the epithelium or skin mucosal lining (e.g., oral cavity, rectum and intestinal mucosa, etc.), and an aerosolizing agent can be used as needed and an inhaler or nebulizer can be used, and it can also be administered together with other medicaments. Administration can also be systemic or local.

[0495] The composition of the present disclosure may be provided in the form of a kit. In one embodiment, the present disclosure provides a kit, which is a kit for preparing a construct plasmid derived from a virus, comprising at least one nucleic acid (which comprises: a nucleic acid sequence that promotes plasmid replication in Bacillus subtilis; and a nucleic acid sequence necessary for constituting a virus). In one embodiment, the present disclosure provides a drug pack or a kit, which comprises one or more containers filled with one or more ingredients that can be added to the composition of the present disclosure. Depending on the circumstances, such a container may also be accompanied by information indicating that the manufacture, use or sale for administration to humans is approved by a government agency in a form prescribed by a government agency that regulates the manufacture, use or sale of pharmaceuticals or biological products.

[0496] The preparation steps of the composition of the present disclosure as medicines are known in the art, and are described in, for example, the Japanese Pharmacopoeia, the United States Pharmacopoeia, and pharmacopoeias of other countries, etc. Therefore, those skilled in the art can determine the amount to be used and other embodiments without excessive experiments as long as they have the description of this specification.

[0497] In this specification, "or" is used when "at least one (one) or more" of the items listed in the article can be used. The same applies to "or". In this specification, when it is clearly stated that "two values" are "within the range", the two values ​​themselves are also included in the range.

[0498] References such as scientific literature, patents, and patent applications cited in the present specification are incorporated herein by reference in their entirety to the same extent as if each was specifically described.

[0499] The above is a description of the present disclosure by showing preferred embodiments for ease of understanding. The following is a description of the present disclosure based on examples, but the above description and the following examples are provided for the purpose of illustration only and not for the purpose of limiting the present disclosure. Therefore, the scope of the present disclosure is neither limited to the embodiments specifically described in this specification nor to the examples, but is limited only by the claims.

[0500] Example

[0501] As reagents, the products described in the Examples were specifically used, but equivalent products from other manufacturers (Sigma-Aldrich, Wako Pure Chemical Industries, Ltd., Nacalai, R&D Systems, USCN Life Science INC, etc.) may be substituted.

[0502] (Example 1: Construction of pGETS103-AAV-Helper-RC2 using the OGAB method)

[0503] Construction of vector DNA for OGAB aggregation

[0504] The plasmid pGETS103ΔAarI was cleaved with the restriction endonuclease HindIII, purified by TE saturated phenol treatment, butanol extraction, and ethanol precipitation, and a linker DNA prepared by annealing the single-stranded DNAs shown in sequence numbers 3 and 4 was inserted therein to prepare pGETS103-ΔAarI-Linker, a vector for OGAB aggregation. The plasmid was cleaved with the restriction endonuclease AarI, size-separated by low-melting-point agarose gel electrophoresis, and a large fragment of 15 kb was cut out from the gel and purified to obtain a vector fragment for OGAB aggregation.

[0505] Preparation of aggregated fragments for OGAB

[0506] For pGETS103-AAV-Helper-RC2 ( Figure 1 ) of the base sequence of AAV-Helper-RC2 excluding the base sequence of pGETS103 in the vector part ( Figure 2 ), and studied whether it could be constructed using the OGAB method. Figure 1 The above-mentioned DNA region is designed in the manner of the 22 segments shown. The 3rd segment includes the boundary region between the AAV segment and the Helper segment, and the 16th segment includes the boundary region between the Helper segment and the RC2 segment. Therefore, the 1st, 3rd and 16th segments are prepared by the MAP method (Japanese Patent Application No. 2018-93024) after chemically synthesizing the material DNA as shown below. Specifically, for the 1st segment, a double-stranded DNA assembled by the MAP method using single-stranded DNAs of sequence numbers 5 to 10 was used, for the 3rd segment, a double-stranded DNA assembled by the MAP method using single-stranded DNAs of sequence numbers 11 to 16 was used, and for the 16th segment, a double-stranded DNA assembled by the MAP method using single-stranded DNAs of sequence numbers 17 to 22 was used. For the remaining regions, a combination of primers F and R with the numbers of each fragment shown in sequence numbers 23 to 66 was used, and the pAAV-CMV vector was used as a template for the second fragment, the pHelper vector was used as a template for the 4th to 15th fragments, and the pRC2-mi342 vector was used as a template for the 17th to 22nd fragments, and amplification was performed by PCR using the following conditions. In each reaction, 10 μL of 2× Prime Star mix (Takara Bio), 1 μL of template DNA, 1 μL of a solution containing 3.2 pmol of each of the two primers, and 8 μL of sterile water were added, and after 2 minutes at 96°C, 30 cycles of 10 seconds at 98°C, 15 seconds at 55°C, and 5 seconds at 72°C were performed.

[0507] OGAB uses clustered fragments to clone into vectors

[0508] After obtaining DNA fragments by MAP or PCR, the DNA was purified using MinElute PCR Purification Kit (Qiagen), and finally eluted from the column using 15 μL of TE buffer (Nacalai Tesque). 0.2 μL of 10×Ex-Taq buffer (Takara Bio), 0.2 μL of 2mM dNTP (Takara Bio), and 0.2 μL of 10xA-attachment mix (TOYOBO) were added to 1.4 μL of the obtained DNA solution, and reacted at 60°C for 1 hour. Then, 1 μL of pMD19 simple (Takara Bio) was diluted to 20 times with TE buffer, 3 μL of DNA Ligation Kit <Mighty Mix> was added, and the ligation reaction was carried out at 16°C for 3 hours, and transformed using E. coli JM109 competent cells (TakaraBio). After culturing overnight, the base sequences of colonies that appeared on an LB plate supplemented with carbenicillin were confirmed, thereby obtaining clones with the correct sequence for each fragment.

[0509] · Adjustment of equimolar mixture of fragments for OGAB

[0510] After the Escherichia coli with these clones was propagated in 2ml of LB medium, 900μL of it was used to purify the plasmid by the automated system QIAcube using QIAprep Spin Miniprep Kit (Qiagen), and finally eluted into 30μL of TE buffer. For the solution containing the plasmid DNA equivalent to 2.5μg, TE buffer was added in a manner of becoming 50μL. Further, 6μL of 10XPlasmid safe buffer (epicentre), 2.4μL of 25mM ATP, and 2μL of Plasmid-Safe ATP-Dependent DNase (epicentre) were added thereto, and after reacting at 37°C for 1 hour, it was inactivated at 70°C for 30 minutes, thereby decomposing the DNA outside the circular structure. Then, the reaction solution was purified using MinElute PCR purification kit (Qiagen), and finally 15μL of TE buffer (Nacalai Tesque) was used to elute it from the column. Use micro-spectrophotometer (Nano drop One, Thermofisher) to measure the obtained DNA solution, add TE buffer to become 100ng / μL mode and dilute.Then, measure concentration again, accurately calculate the required DNA volume to 2 decimal places (μL) when dividing 500ng DNA, utilize micropipette (Micropipette) to divide, thus carry out the equimolar division of each plasmid.For the DNA solution divided, according to the kind of restriction endonuclease used thereafter, be divided into 2 centrifuge tubes of 1.5ml and merge.Respectively, the plasmid of the 1st, 3rd, 5th, 7th, 9th, 11th, 13th, 14th, 17th, 19th, 21st fragment cloned is merged in the pipe that utilizes restriction endonuclease AarI to cut, and the plasmid of the 2nd, 4th, 6th, 8th, 10th, 12th, 15th, 16th, 18th, 20th, 22nd fragment cloned is merged in the group that utilizes restriction endonuclease BsaI to cut respectively. Then, in the tube cut with AarI, when the total volume of each plasmid was set to 1 volume, 1.94 volumes of sterile water, 0.33 volumes of 10×Buffer AarI (Thermofisher), 0.06 volumes of 50×oligonucleotide (0.025 mM), and 0.17 volumes of AarI (Thermofisher) were added, and the reaction was carried out at 37° C. for 2 hours. In addition, in the tube cut with BsaI, when the total volume of each plasmid was set to 1 volume, 2 volumes of sterile water, 0.33 volumes of 10×CutSmart buffer (NEB), and 0.17 volumes of BsaI-HF v2 were added, and the reaction was carried out at 37° C. for 2 hours.Add an equal amount of TE-saturated phenol to the restriction endonuclease reaction solution to each tube, mix thoroughly to inactivate the restriction endonuclease, and then integrate the emulsified phenol and DNA solution mixture into a 2ml centrifuge tube, centrifuge at 20,000×g for 10 minutes, and separate into a phenol phase and an aqueous phase. Transfer the upper layer to a new tube, add an equal amount of 1-butanol to it, stir thoroughly, and centrifuge at 20,000×g for 1 minute. Then, remove the upper layer with a pipette, repeat the operation of adding an equal amount of 1-butanol, centrifuging, and discarding the upper layer until the volume of the lower layer becomes less than 450μl. Then, add 50μL of P3 buffer, add 900μL of ethanol, and centrifuge at 20,000×g for 10 minutes. After discarding the supernatant in a way that does not lose the precipitate, rinse with 900μL of 70% ethanol, and then, aspirate and discard the supernatant with a pipette. Then, the supernatant remaining was collected at the bottom by centrifugation again, and the liquid was completely removed with a pipette. 50 μl of TE was immediately added, and the precipitate was flicked for 5 minutes to completely dissolve it. Then, an equimolar mixture of 22 fragments of about 750 bp cut out from pMD19 was size-fractionated by electrophoresis based on low melting point agarose gel, and the mixture of 22 fragments was purified according to the method of cutting out and purifying DNA fragments from electrophoresis gel.

[0511] · Construction of pGETS103-AAV-Helper-RC2 based on the OGAB method

[0512] Then, TE buffer was added to 1 fmol of the obtained DNA solution and 1 fmol of pGETS103ΔAarI-Linker obtained by cleavage and purification with AarI to make a total of 4 μL, and 5 μL of 2× ligation buffer (15% polyethylene glycol 6000, 500 mM NaCl, 132 mM Tris·HCl (pH 7.6), 13.2 mM MgCl2, 20 mM DTT, 0.2 mM ATP) was added thereto, and after thorough mixing, 1 μL of T4 DNA ligase (Takara Bio) was added, and incubated at 37°C for 5 hours. 100 μL of Bacillus subtilis competent cells were added thereto, and cultured at 37°C for 30 minutes using a duck rotor. Then, 300 μL of LB medium was added and cultured at 37° C. for 1 hour using a duck rotor, and then the culture was spread on an LB plate supplemented with 10 μg / ml tetracycline (Sigma-Aldrich) and cultured overnight at 37° C. 94 colonies were obtained.

[0513] ·Confirmation of plasmid structure of transformants

[0514] 12 colonies were randomly selected and cultured overnight in 2 ml of LB medium with 10 μg / ml tetracycline. In order to amplify the number of copies of the internal plasmid, IPTG was added in a final concentration of 1 mM, and further cultured at 37 ° C for 3 hours. A small amount of plasmid was extracted from the obtained bacteria as described below. 900 μL of bacterial solution was taken into a 1.5 ml centrifuge tube, centrifuged at 6800 × g for 3 minutes, and the supernatant was removed using a micropipette. After the obtained bacterial pellet was well suspended, 100 μL of P1 buffer containing 10 mg / ml egg white lysozyme (wako) was added, and then incubated at 37 ° C for 5 minutes. 200 μL of P2 buffer was added thereto, and inverted and mixed 4 times. Then, 150 μL of P3 was added and inverted and mixed 4 times. It was centrifuged at 20,000 × g for 10 minutes, thereby separating into a white precipitate and a supernatant. Transfer the supernatant to a new 1.5 ml centrifuge tube, add 450 μl of TE-saturated phenol (Nacalai Tesque) thereto, mix thoroughly, and centrifuge at 20,000×g for 10 minutes to separate into a phenol phase and an aqueous phase. Transfer 320 μl of the aqueous phase to a new tube, add 900 μL of ethanol thereto, and centrifuge at 20,000×g for 10 minutes. Remove the supernatant with a micropipette, add 900 μL of 70% ethanol, and rinse the entire tube. Then, remove the 70% ethanol with a micropipette, and dissolve the resulting precipitate with 27 μL of TE buffer. Take 8 μL of the resulting plasmid solution, add 1 μL of 10×3.1 NEB buffer (NEB) and 1 μL of SmaI thereto, react at 37°C for 1 hour, and confirm the cutting pattern by agarose gel electrophoresis. Figure 3 As shown, one clone (clone number 3) among the 12 clones showed the expected cleavage pattern. The entire base sequence of this clone was determined, and it was confirmed that pGETS103-AAV-Helper-RC2 was constructed.

[0515] (Example 2: Construction of various AAV integrated vector plasmids)

[0516] As in Example 1, seven vector plasmids with integrated structures for producing AAV vectors were constructed using components obtained from AAV genomes and adenovirus genomes of other serotypes. Each plasmid (in Figure 4 The serotypes of the viral genomes from which the ITRs, Rep, Cap, and Helpers (VA, E2A, and E4) used in the respective vector plasmids are shown in the following table (see also Figure 5 ).

[0517] [Table 1]

[0518] Table 1: The composition of each plasmid

[0519]

[0520] *1 is the vector plasmid of Example 1 (pGETS103-AAV-Helper-RC2. AAV: adeno-associated virus serotype, Ad: adenovirus serotype and group

[0521] Each of the above-mentioned integrated nucleic acids (total length 15 to 16 kb) is designed, and a DNA fragment containing 18 to 19 unit DNA fragments (700 to 900 bp) is chemically synthesized according to its length. These DNA fragments are cut out using any one of the restriction endonucleases AarI, BbsI, BsaI, and BsmBI to prepare unit DNA fragments. These unit DNA fragments are linked to pGETS118 obtained by cutting with AarI in a tandem repeat manner, and then, in the same manner as in Example 1, a circular plasmid is formed in Bacillus subtilis using the OGAB method. As a result, the construction of the vector plasmid with the integrated structure of the above-mentioned 7 additional AAV vectors was confirmed.

[0522] (Example 3: Evaluation of viral vector production in adherent culture (flask culture))

[0523] Large-scale culture of plasmid DNA

[0524] The constructed pGETS103-AAV-Helper-RC2 was transformed into Escherichia coli JM109 competent cells (purchased from Takara Bio) and Bacillus subtilis BUSY9797 strain (transferred from Kobe University, Tsuge, K., Sato, Y., Kobayashi, Y., Gondo, M., Hasebe, M., Togashi, T., Tomita, M., Itaya, M. (2015) Method of preparing an equimolar DNA mixture for one-step DNA assembly of over 50 fragments, Scientific Reports, 5, 10655.), and cultured in large quantities in Bacillus subtilis and Escherichia coli, respectively. Prepare 200 mL of liquid containing antibiotics (tetracycline) added to LB medium (dissolve 10 g of bacterial tryptone, 5 g of yeast extract, and 5 g of sodium chloride in 1 L of water), add 100 ml to each 500 mL conical flask, inoculate Escherichia coli or Bacillus subtilis plasmid-maintaining strain, and culture at 37°C overnight (for further large-scale culture, repeat this flask culture). Centrifuge to collect bacteria from the culture solution, lyse the bacteria, and purify using cesium chloride density gradient ultracentrifugation (cesium chloride density: about 0.84 g / mL) to recover the supercoiled plasmid DNA. Use a UV-visible spectrophotometer to measure the concentration of the recovered plasmid DNA. It should be noted that pAAV-CMV ( Figure 6 )、pHelper( Figure 7 )、pRC2-mi342( Figure 8 ) was purchased from Takara Bio and similarly cultured in large quantities in E. coli. In addition, pGETS103-AAV ( Fig. 9 )、pGETS103-Helper( Fig.10 )、pGETS103-RC2( Fig.11 ) is a plasmid DNA obtained by treating pAAV-CMV, pHelper, pRC2-mi342pGETS103 with restriction endonucleases, and cloning each gene necessary for viral vector production into pGETS-103, and similarly mass-culturing in Escherichia coli and Bacillus subtilis.

[0525] [Table 2]

[0526] Table 2: Summary of plasmid DNA used

[0527]

[0528] · Production of rAAV

[0529] One day before transfection, 1.5 × 10 7 293T cells were seeded in a 15 cm culture dish. After 22 hours, the medium was replaced with 19 mL of DMEM medium (2% FBS, 1% penicillin / streptomycin) and cultured at 37°C and 5% CO2 for 2 hours. 7 ) The following transfection solution was added, wherein 500 μL of DMEM medium containing 2.7 pmol of plasmid and 500 μL of DMEM medium containing PEIpro (registered trademark) in an amount equal to that of DNA were mixed.

[0530] After culturing for 72 hours at 37°C and 5% CO2, 1 / 80 volume of 0.5M EDTA (pH 8.0) was added and the mixture was allowed to stand at room temperature for 10 minutes. The detached cell suspension was recovered and centrifuged at 180×g for 5 minutes to completely remove the supernatant. The cell pellet was suspended in 1.2 mL of Lysis buffer (2mM MgCl2, 150mM NaCl, 50mM Tris, 0.1% Triton (registered trademark) X-100; pH 8.5), and Benzonase (registered trademark) (50 units / mL) was further added to react at 37°C for 30 minutes. Then, 2 / 100 volume of 1.9M MgSO4 solution was added and the mixture was allowed to stand at room temperature for 10 minutes. The supernatant was recovered by centrifugation at 12,000×g, 4°C, for 10 minutes, and Pluronic (registered trademark) F-68 was added at a final concentration of 0.001%.

[0531] Three cesium chloride solutions (1.50 g / cm 3 , 1.30g / cm 3 , 1.25g / cm 3 ) Multilayer density gradient centrifugation was performed at 226,000 × g and 18°C ​​for 1.5 hours, from 1.30 g / cm 3 About 3.5 mL of rAAV was recovered from the solution.

[0532] Evaluation of rAAV Fig.12 )

[0533] In order to quantify the genome titer of rAAV, DNaseI treatment was performed for 30 minutes, reaction was performed at 95°C for 10 minutes, and the obtained sample was diluted 1000 times for qPCR. The primer sequences used were 5'-GGAACCCCTAGTGATGGAGTT-3' (sequence number 1) and 5'-CGGCCTCAGTGAGCGA-3' (sequence number 2). As for the PCR conditions, after 10 minutes at 95°C, 95°C / 15 seconds, 55°C / 5 seconds, and 72°C / 30 seconds were set as one cycle, and 40 cycles were repeated.

[0534] The particle titer was quantified using the ELISA method. The quantitative kit used AAV2Titration ELISA 2.0R to perform the test based on the protocol. In a 96-well plate fixed with the anti-AAV2 antibody contained in the kit, rAAV and the standard (empty capsid reagent contained in the kit) were added in an amount of 100 μL each. After standing at 37°C for 1 hour, the liquid was discarded and washed 3 times with 200 μL of detection buffer. 100 μL of biotin-conjugated anti-AAV2 antibody was added, and after standing at 37°C for 1 hour, the liquid was discarded and washed 3 times with 200 μL of detection buffer. Further 100 μL of HRP-labeled streptavidin was added, and after standing at 37°C for 1 hour, the liquid was discarded and washed 3 times with 200 μL of detection buffer. Finally, 100 μL of TMB was added, and the cells were allowed to stand at room temperature for 15 minutes before adding the reaction stop reagent. The absorbance (450 nm, 650 nm) was measured using a microplate reader. The VP / VG ratio was calculated by dividing the particle titer by the genome titer. The VG / cell ratio was calculated by dividing the genome titer by the number of cells at confluence.

[0535] [Table 3]

[0536] Table 3: Results of viral vector production

[0537]

[0538] (Example 4: Evaluation of Viral Vector Production in Adherent Culture (Pot Culture))

[0539] Large-scale culture of plasmid DNA

[0540] pGETS103-AAV-Helper-RC2 was transformed into competent cells of Escherichia coli JM109 and Bacillus subtilis BUSY9797, and cultured in large quantities in a fermenter (Biott, BMS-P). As a pre-culture, 50 mL of LB medium was added to a 500 mL flask, and batch culture was performed after inoculation. A portion of the liquid obtained by overnight culture was collected and inoculated into 4 L of initial culture medium in a 10 L fermenter, and formal culture (batch culture) was started. The culture was continued while maintaining the dissolved oxygen (Escherichia coli: 3.6-7.3 ppm, Bacillus subtilis: 5.4-6.9 ppm) and pH (6.95-7.05) constant, and the culture was terminated after confirming that the turbidity (OD600 value) was above the fixed value (Escherichia coli: 21, Bacillus subtilis: 38). The bacteria were collected from the culture solution by centrifugation, lysed, and purified by cesium chloride density gradient ultracentrifugation (cesium chloride density: about 0.84 g / mL) to recover supercoiled plasmid DNA. The concentration of the recovered plasmid DNA was measured using a UV-visible spectrophotometer.

[0541] [Table 4]

[0542] Table 4: Composition of plasmid DNA used

[0543]

[0544] · Production of rAAV

[0545] One day before transfection, 3 × 10 6 293T cells were seeded in a 10 cm culture dish. After 22 hours, the medium was replaced with 9.5 mL of DMEM medium (2% FBS, 1% penicillin / streptomycin) and cultured at 37°C and 5% CO2 for 2 hours. 6 250 μL of DMEM medium containing 11.53 μg of plasmid and 250 μL of DMEM medium containing PEIpro (registered trademark) (PolyPlus-transfectionSAS) in an amount equal to that of DNA were mixed and added to each of the two culture mediums.

[0546] After culturing for 72 hours at 37°C and 5% CO2, 1 / 80 volume of 0.5M EDTA (pH8.0) was added and the mixture was allowed to stand at room temperature for 10 minutes. The detached cell suspension was recovered and centrifuged at 180×g for 5 minutes, and the supernatant was completely removed. The cell pellet was suspended in 400 μL of Lysis buffer (2mM MgCl2, 150mM NaCl, 50mM Tris, 0.1% Triton (registered trademark) X-100 (Nacalai Tesque); pH8.5), and Benzonase (registered trademark) (50 units / mL, Novagen) was further added and reacted at 37°C for 30 minutes. Then, 2 / 100 volume of 1.9M MgSO4 solution was added and the mixture was allowed to stand at room temperature for 10 minutes. The supernatant was recovered by centrifugation at 12,000×g and 4° C. for 10 minutes, and Pluronic (registered trademark) F-68 (Thermo Fisher Scientific) was added to a final concentration of 0.001%.

[0547] Three cesium chloride solutions (1.50 g / cm 3 , 1.30g / cm 3 , 1.25g / cm 3 ) Multilayer density gradient centrifugation was performed at 226,000 × g and 18°C ​​for 1.5 hours, from 1.30 g / cm 3 About 3.5 mL of rAAV was recovered from the solution.

[0548] Evaluation of rAAV Fig.13 )

[0549] In order to quantify the genome titer of rAAV, DNaseI treatment was performed for 30 minutes, reacted at 95°C for 10 minutes, and the obtained sample was diluted 1000 times for qPCR. The primer sequences used were 5'-GGAACCCCTAGTGATGGAGTT-3' (sequence number 1) and 5'-CGGCCTCAGTGAGCGA-3' (sequence number 2). As for the PCR conditions, after 10 minutes at 95°C, 95°C / 15 seconds, 55°C / 5 seconds, and 72°C / 30 seconds were used as one cycle, and 40 cycles were repeated.

[0550] The particle titer was quantified using the ELISA method. The quantitative kit used AAV2Titration ELISA 2.0R (PROGEN), and the test was carried out according to the operating instructions. In a 96-well plate fixed with the anti-AAV2 antibody contained in the kit, 100 μL of rAAV and standard (empty capsid reagent contained in the kit) were added. After standing at 37°C for 1 hour, the liquid was discarded and washed 3 times with 200 μL of detection buffer. 100 μL of biotin-conjugated anti-AAV2 antibody was added, and after standing at 37°C for 1 hour, the liquid was discarded and washed 3 times with 200 μL of detection buffer. Further, 100 μL of HRP-labeled streptavidin was added, and after standing at 37°C for 1 hour, the liquid was discarded and washed 3 times with 200 μL of detection buffer. Finally, 100 μL of TMB was added, and the mixture was allowed to stand at room temperature for 15 minutes. Then, a reaction termination reagent was added, and the absorbance (450 nm, 650 nm) was measured using a microplate reader.

[0551] The VP / VG ratio was calculated by dividing the particle titer by the genomic titer. The VG / cell ratio was calculated by dividing the genomic titer by the number of cells at confluence.

[0552] [Table 5]

[0553] Table 5: Results of viral vector production

[0554]

[0555] (Example 5: Production of viral vectors using different plasmid vectors)

[0556] Large-scale culture of plasmid DNA

[0557] In the base sequence of pGETS103-AAV-Helper-RC2, the region of AAV-Helper-RC2 excluding the base sequence of pGETS103 in the vector part ( Figure 2 ), cloned into pGETS151 to construct pGETS151-AAV-Helper-RC2 ( Fig.14). pGETS151-AAV-Helper-RC2 was transformed into competent Escherichia coli JM109 cells and Bacillus subtilis MI112 strains, and cultured in large quantities in fermenters (Biott, BMS-P), respectively. As a pre-culture, 50 mL of LB medium (Bacillus subtilis uses a medium with a 2-fold concentration of peptone and YE) was added to a 500 mL flask, and batch culture was carried out after inoculation. A portion of the liquid obtained from overnight culture was collected and inoculated into 4 L of the initial culture medium in a 10 L fermenter, and formal culture (Fed-Batch culture) was started. The culture was continued while maintaining the dissolved oxygen (4.3-7.3 ppm) and pH (6.95-7.1) constant, and the culture was terminated after confirming that the turbidity (OD600 value) was above 50. The bacteria were collected from the culture solution by centrifugation, lysed, and purified by cesium chloride density gradient ultracentrifugation (cesium chloride density: about 0.84 g / mL) to recover supercoiled plasmid DNA. The concentration of the recovered plasmid DNA was measured using a UV-visible spectrophotometer.

[0558] [Table 6]

[0559] Table 6: Plasmid DNA used in Example 5

[0560]

[0561] · Production of rAAV

[0562] One day before transfection, 1.5 × 10 7 293T cells were seeded in a 15 cm culture dish. After 22 hours, the medium was replaced with 19 mL of DMEM medium (2% FBS, 1% penicillin / streptomycin) and cultured at 37°C and 5% CO2 for 2 hours. 7 ) A transfection solution was added, wherein 500 μL of a DMEM medium containing 2.1 pmol of the plasmid and 500 μL of a DMEM medium containing PEIpro (registered trademark) in an amount equal to that of the DNA were mixed.

[0563] After culturing for 72 hours at 37°C and 5% CO2, 1 / 80 volume of 0.5M EDTA (pH 8.0) was added and the mixture was allowed to stand at room temperature for 10 minutes. The detached cell suspension was recovered and centrifuged at 180×g for 5 minutes to completely remove the supernatant. The cell pellet was suspended in 1.2 mL of Lysis buffer (2mM MgCl2, 150mM NaCl, 50mM Tris, 0.1% Triton (registered trademark) X-100; pH 8.5), and Benzonase (registered trademark) (50 units / mL) was further added to react at 37°C for 30 minutes. Then, 2 / 100 volume of 1.9M MgSO4 solution was added and the mixture was allowed to stand at room temperature for 10 minutes. The supernatant was recovered by centrifugation at 12,000×g, 4°C, for 10 minutes, and Pluronic (registered trademark) F-68 was added at a final concentration of 0.001%.

[0564] Three cesium chloride solutions (1.45 g / cm 3 , 1.27g / cm 3 , 1.25g / cm 3 ) Multilayer density gradient centrifugation was performed at 226,000 × g and 18°C ​​for 1.5 hours, from 1.27 g / cm 3 About 2 mL of rAAV was recovered from the solution.

[0565] Evaluation of rAAV Fig.15 )

[0566] In order to quantify the genome titer of rAAV, DNaseI treatment was performed for 30 minutes, reacted at 95°C for 10 minutes, and the obtained sample was diluted 1000 times for qPCR. The primer sequences used were 5'-GGAACCCCTAGTGATGGAGTT-3' (sequence number 1) and 5'-CGGCCTCAGTGAGCGA-3' (sequence number 2). As for the PCR conditions, after 10 minutes at 95°C, 95°C / 15 seconds, 55°C / 5 seconds, and 72°C / 30 seconds were used as one cycle, and 40 cycles were repeated. The VG / cell ratio was calculated by dividing the genome titer by the number of cells in the confluent state.

[0567] [Table 7]

[0568] Table 7: Results of viral vector production

[0569]

[0570] (Example 6: Evaluation of viral vector production in suspension culture)

[0571] Large-scale culture of plasmid DNA

[0572] pGETS151-AAV-Helper-RC2 was transformed into competent cells of Escherichia coli JM109 and Bacillus subtilis MI112, and cultured in large quantities in fermenters (Biott, BMS-P), respectively. As a pre-culture, 50 mL of LB medium (Bacillus subtilis uses a medium with a 2-fold concentration of tryptone and YE) was added to a 500 mL flask, and batch culture was carried out after inoculation. A portion of the liquid obtained from overnight culture was collected and inoculated into 4 L of the initial culture medium in a 10 L fermenter, and formal culture (fed batch culture) was started. The culture was continued while maintaining the dissolved oxygen (4.3-7.3 ppm) and pH (6.95-7.1) constant, and the culture was terminated after confirming that the turbidity (OD600 value) was above 50. The bacteria were collected from the culture solution by centrifugation, lysed, and purified by cesium chloride density gradient ultracentrifugation (cesium chloride density: about 0.84 g / mL) to recover supercoiled plasmid DNA. The concentration of the recovered plasmid DNA was measured using a UV-visible spectrophotometer.

[0573] [Table 8]

[0574] Table 8: Composition of plasmid DNA used

[0575]

[0576] · Production of rAAV

[0577] On the day of transfection, 9.0 × 10 7 VPC2.0 (registered trademark) cells (suspension cells derived from HEK293) were inoculated into a 125 mL conical flask. After 1 hour, 3 mL of AAV-MAX Enhancer was added and cultured for 2 hours at 37°C and 8% CO2. VPC2.0 (registered trademark) cells (cell number: 9.0×10 7 ) add the following transfection solution, the transfection solution is a Viral-Plex containing 3.0 pmol of plasmid TM 3 mL of Complexation Buffer was mixed with 90 μL of AAV-MAX Transfection Booster and 180 μL of AAV-MAX Transfection Reagent.

[0578] After culturing for 72 hours at 37°C and 8% CO2, the cell suspension was recovered and centrifuged at 180×g for 5 minutes to completely remove the supernatant. The cell pellet was suspended in 3.6 mL of Lysis buffer (2 mM MgCl2, 150 mM NaCl, 50 mM Tris, 0.1% Triton (registered trademark) X-100; pH 8.5), and Benzonase (registered trademark) (167 units / mL) was further added and reacted at 37°C for 30 minutes. Then, 2 / 100 volume of 1.9 M MgSO4 solution was added and allowed to stand at room temperature for 10 minutes. The supernatant was recovered by centrifugation at 12,000×g, 4°C, for 10 minutes, and Pluronic (registered trademark) F-68 was added at a final concentration of 0.001%.

[0579] Three cesium chloride solutions (1.35 g / cm 3 , 1.27g / cm 3 , 1.25g / cm 3 ) Multilayer density gradient centrifugation was performed at 226,000 × g and 18°C ​​for 1.5 hours, from 1.27 g / cm 3 About 2.0 mL of rAAV was recovered from the solution.

[0580] Evaluation of rAAV Fig.16 )

[0581] In order to quantify the genome titer of rAAV, DNaseI treatment was performed for 30 minutes, reacted at 95°C for 10 minutes, and the obtained sample was diluted 1000 times for qPCR. The primer sequences used were 5'-GGAACCCCTAGTGATGGAGTT-3' (sequence number 1) and 5'-CGGCCTCAGTGAGCGA-3' (sequence number 2). As for the PCR conditions, after 10 minutes at 95°C, 95°C / 15 seconds, 55°C / 5 seconds, and 72°C / 30 seconds were used as one cycle, and 40 cycles were repeated. The VG / cell ratio was calculated by dividing the genome titer by the number of cells in the confluent state.

[0582] [Table 9]

[0583] Table 9: Results of viral vector production

[0584]

[0585] (Example 7: Construction of adenovirus integrated vector plasmid)

[0586] Regarding the adenovirus vector Ad5, an integrated structure for producing adenovirus vectors with a total length of about 36 kb was designed by introducing the GIO gene into Takara Bio's pAxCAwtit2 ( Fig.17 ). It is divided into 40 parts of about 800 bp, and a DNA fragment containing a unit DNA fragment is prepared by PCR or chemical synthesis. These DNA fragments are cut out using any one of the restriction endonucleases AarI, BbsI, BsaI, and BsmBI to prepare unit DNA fragments. Then, the unit DNA fragments are prepared by introducing the linker DNA into the BamHI site of pBET131 (Tanaka, T., and M. Ogura. 1998. A novel Bacillus natto plasmid pLS32 capable of replication in Bacillus subtilis. FEBS Lett. 422: 243-246) to introduce two new AarI sites into the pGETS118-AarI ( Fig.18 ) were cut with AarI and the two large fragments were linked in a tandem repeat manner, and then, in the same manner as in the above-mentioned Example, a circular plasmid was formed in Bacillus subtilis using the OGAB method. As a result, the construction of a clone having an integrated structure for producing an adenoviral vector was confirmed.

[0587] (Example 8: Further AAV integrated vector plasmid structure example)

[0588] It is also expected Figures 19 to 24 AAV integration vector plasmids are shown.

[0589] · Fig.19 This is an example of a construction using Rep of AAV1 and Cap of AAV6 based on pGETS103-ΔAarI.

[0590] · Fig. 20 This is an example of a construction based on pGETS103-ΔAarI using the CAG promoter, AAV5 Rep, and AAV1 Cap.

[0591] · Fig.21 This is an example of a construction based on pGETS103-ΔAarI using the EF1α promoter, AAV8 Rep, and AAV9 Cap.

[0592] · Fig. 22This is an example of a construction based on pGETS103-ΔAarI using the SV40 promoter and arranging Rep, Cap, and Helper in a different order.

[0593] · Fig.23 This is an example of a construction based on pGETS131-AarI in which Rep, Cap, and Helper are arranged in a different order.

[0594] · Fig.24 This is an example of construction of an element with a modified Helper gene based on pBETS103-ΔAarI (adenovirus E1A and E1B were added separately from other elements).

[0595] (Example 9: Construction of viral vector plasmids based on various viruses)

[0596] When using producer cells other than HEK293 (NIH3T3, HT1080, A549, HeLa, HEK 293T, etc.), the AAV vector plasmid can be constructed so as to include E1A and E1B genes in addition to the structure of the above-mentioned examples.

[0597] For example, as a specific structure of a retroviral vector plasmid, a lentiviral vector plasmid, or an adenoviral vector plasmid, it is assumed that the pGETS103ΔAarI of the above-mentioned example is Figures 25-27 .

[0598] Lentiviral vector plasmid ( Fig.25 )

[0599] The vector plasmid was constructed based on pGETS103ΔAarI and supplemented with the following nucleic acid sequence.

[0600] ·CMV promoter, VSV-G (glycoprotein G of vesicular stomatitis virus), poly A (polyA) ·CMV promoter, rev, poly A

[0601] 5'LTR, Ψ (packaging signal sequence), RPE, PPT, CMV promoter, WPRE, 3'LTR

[0602] CMV promoter, gag, pol, RPE, poly A

[0603] (The desired gene can be located between the LTRs, downstream of the promoter.)

[0604] Retroviral vector plasmid ( Fig.26 )

[0605] The vector plasmid was constructed based on pGETS103ΔAarI and supplemented with the following nucleic acid sequence.

[0606] CMV promoter, env, poly A

[0607] 5'LTR, Ψ (packaging signal sequence), RPE, PPT, CMV promoter, WPRE, 3'LTR

[0608] CMV promoter, gag, pol, RPE, poly A

[0609] (The desired gene can be located between the LTRs, downstream of the promoter.)

[0610] Adenovirus vector plasmid ( Fig. 27 )

[0611] The vector plasmid was constructed based on pGETS103ΔAarI and supplemented with the following nucleic acid sequence.

[0612] 5'ITR, genome of adenovirus serotype 5 (the E1 gene site is replaced with the promoter and E1A gene), 3'ITR

[0613] (In addition to the E1A gene, a desired gene can also be located downstream of the above or other promoters.)

[0614] (Example 10: Construction of total viral vector plasmid based on OGAB method)

[0615] In addition to the elements related to the production of AAV vectors, DNA fragments of elements of other vector plasmids such as encoding drug resistance genes (recorded as vector parts in this specification) are also used to prepare the entire viral vector plasmid using the OGAB method. The vector part is also prepared using the OGAB method, so that the part of the vector plasmid that is not directly related to the production of the viral vector can be designed more flexibly. If the vector part is suitable for various vector plasmids, it may be necessary for the vector part to include a large number of elements, but if the vector part is designed for each vector plasmid, the unnecessary part for the vector plasmid can be omitted, so the miniaturization of the vector plasmid can be achieved.

[0616] Preparation of aggregated fragments for OGAB

[0617] like Fig.28As shown, each fragment (sequence number 67 to 96) is designed in a manner that the overall sequence containing the vector region is divided into 30. For each of the 2nd to 4th, 22nd, 23rd, 28th, and 30th fragments, after chemically synthesizing the material DNA having the sequence of sequence numbers 97 to 138, respectively, the MAP method (Japanese Patent Laid-Open No. 2019-198236) is used to prepare. Specifically, double-stranded DNA is prepared by assembly based on the MAP method using the single-stranded DNA constituting each fragment. For the remaining fragments, a combination of F and R primers with the numbers of each fragment shown in sequence numbers 139 to 184 is used, and pGETS151-AAV-Helper-RC2 is used as a template, and amplified by PCR under the following conditions. In each reaction, 2 μL of 10×ExTaq buffer (Takara Bio), 1.6 μL of 2.5 mM dNTP (Takara Bio), 1 μL of template DNA (1 ng), 1 μL of a solution containing 3.2 pmol of each of two primers, F and R, and 13.3 μL of sterile water were added. After maintaining the temperature at 94°C for 2 minutes, 30 cycles were performed with 98°C for 20 seconds, 58°C for 30 seconds, and 72°C for 1 minute as one cycle.

[0618] Cloning of OGAB fragments into vectors

[0619] The double-stranded DNA fragment was purified using the MinElute PCR purification kit (Qiagen), and finally eluted from the column using 15 μL of TE buffer (Nacalai Tesque). 0.2 μL of 10×Ex-Taq buffer (Takara Bio), 0.2 μL of 2mM dNTP (Takara Bio), and 0.2 μL of 10xA-attachment mix (TOYOBO) were added to 1.4 μL of the obtained DNA solution, and reacted at 60°C for 1 hour. Then, 0.5 μL of pBR322-ΔTypeIIS (4 ng / μL) and 2.5 μL of DNA Ligation Kit <Mighty Mix> were added, and the ligation reaction was carried out at 16°C for 1 night, and Escherichia coli JM109 competent cells (Takara Bio) were used for transformation. The base sequence was confirmed for the colonies that appeared on the LB plate supplemented with carbenicillin after being cultured at 37°C overnight, thereby obtaining clones with the correct sequence for each fragment.

[0620] Preparation of equimolar mixture of fragments for OGAB

[0621] After the Escherichia coli with these clones is propagated in 2mL of LB culture medium, 900 μL thereof is used, QIAprep Spin Miniprep Kit (Qiagen company) is utilized, plasmid is purified by automation system QIAcube, and finally eluted into 30 μL of TE buffer. For the solution of plasmid DNA comprising 4 μg therein, TE buffer is added until liquid volume becomes 50 μL. Further 6 μL of 10xPlasmid Safe buffer (epicentre company), 2.4 μL of 25mM ATP, 2 μL of Plasmid-Safe ATP-Dependent DNase (epicentre) are added thereto, after 1 hour at 37°C, inactivation treatment is carried out for 30 minutes at 75°C, thus DNA beyond the circular structure is decomposed. Then, MinElutePCR purification kit (Qiagen company) is used to purify the reaction solution, and finally 15 μL of TE buffer (NacalaiTesque company) is utilized to make it eluted from the column. Use micro-spectrophotometer Nanodrop One (Thermofisher company) that obtained DNA solution is measured, add TE buffer to become 100ng / μL mode and dilute.Then, use micro-spectrophotometer Lunatic (Unchained Lab company) to measure concentration again, accurately will divide the DNA volume (μL) required when taking 500ng, calculate to 2 decimal places, utilize micropipette to divide this volume, carry out thus the equimolar division of each plasmid.For the DNA solution taken by dividing, according to the kind of restriction endonuclease used thereafter, respectively be divided into 2 1.5mL centrifuge tubes and merge. Separately, plasmids cloned into fragments 1, 3, 4, 6, 7, 9, 10, 13, 17, 19, 20, 23, 25, 27, and 29 were combined into tubes for cutting with restriction endonuclease AarI, and plasmids cloned into fragments 2, 5, 8, 11, 12, 14, 15, 16, 18, 21, 22, 24, 26, 28, and 30 were combined into tubes for cutting with restriction endonuclease BbsI. Then, in the tube cut with AarI, when the total volume of the aliquoted solution of each plasmid was set to 1 volume, 2 volumes of sterile water, 0.33 volumes of 10xBuffer AarI (Thermofisher), 0.06 volumes of 50x oligonucleotide (0.025 mM), and 0.17 volumes of AarI (Thermofisher) were added, and the reaction was carried out at 37°C for 2 hours.In addition, in the tube used for cutting with BbsI, when the total volume of the fractionated solution of each plasmid is set to 1 volume, 2 volumes of sterile water, 0.33 volumes of 10xCutSmart buffer (NEB), and 0.17 volumes of BbsI-HF are added, and the reaction is carried out at 37°C for 2 hours. TE-saturated phenol equal to the restriction endonuclease reaction solution is added to each tube and mixed thoroughly to inactivate the restriction endonuclease. Then, the mixture of phenol and DNA solution in an emulsified state is integrated into a 2mL centrifuge tube, centrifuged at 15,000×g for 5 minutes, and separated into a phenol phase and an aqueous phase. The upper layer is transferred to a new tube, 50μL of P3 buffer is added thereto, 900μL of ethanol is added, and centrifuged at 15,000×g for 10 minutes. The supernatant is discarded in a manner that does not lose the precipitate, the precipitate is rinsed with 900μL of 70% ethanol, and then the liquid portion is aspirated and removed with a pipette. Then, the mixture was centrifuged again, and the remaining liquid was collected at the bottom, and the liquid was completely removed with a pipette to obtain a precipitate. Then, the precipitate was dissolved in 30 μL of TE buffer.

[0622] An equimolar mixture of 25 fragments of approximately 850 bp cut out from pBR322 was size-fractionated by electrophoresis based on low-melting-point agarose gel electrophoresis, and the DNA fragment region was cut out from the gel after electrophoresis, and the DNA fragment was purified to obtain a DNA solution as a purified product of the mixture of 25 DNA fragments.

[0623] · Construction of pGETS151-AAV-EGFP-WPRE-Helper-RC2 based on the OGAB method

[0624] To the obtained DNA solution 6.4 μL (300 ng), 5.6 μL of sterilized water and 15 μL of 2× ligation buffer (15% polyethylene glycol 6000, 500 mM NaCl, 132 mM Tris·HCl (pH 7.6), 13.2 mM MgCl2, 20 mM DTT, 0.2 mM ATP) were added and mixed well, and then 2 μL of T4 DNA Ligase (Takara Bio) was added to 18 μL of the solution, and cultured at 37°C for 5.5 hours. The solution was divided into two tubes of 10 μL each, and 100 μL of Bacillus subtilis competent cells were added to each of them, and the culture was rotated at 37°C using a duck rotor for 30 minutes. The culture solution thus obtained was spread on an LB plate with 10 μg / mL of tetracycline (Nacalai Tesque) added, and cultured at 37°C overnight.

[0625] ·Confirmation of plasmid structure of transformants

[0626] Six colonies were randomly selected and cultured overnight in 2 mL of a medium containing 10 μg / mL of tetracycline at 37° C. A small amount of plasmid was extracted from the obtained bacterial cells in the following manner.

[0627] First, take 900 μL of bacterial solution to a 1.5 mL tube, centrifuge at 6800 × g for 3 minutes, and remove the supernatant with a micropipette. After the obtained bacterial precipitate is well suspended, add 100 μL of P1 buffer containing 10 mg / mL of egg white lysozyme (wako company), suspend it with a vortex mixer, and incubate it at 37 ° C for 5 minutes. Add 200 μL of P2 buffer and mix it upside down. Then, add 150 μL of P3 buffer and shake it vigorously 3 times along the longitudinal axis of the tube to mix it. Centrifuge it at 15,000 rpm for 5 minutes to separate it into a white precipitate and a supernatant. Transfer the supernatant to a new 1.5 mL centrifuge tube, add 450 μL of TE saturated phenol (Nacalai Tesque company) to it and mix it well, centrifuge it at 10,000 rpm for 10 minutes, and separate it into a phenol phase and an aqueous phase. 300 μL of the aqueous phase was transferred to a new tube, 900 μL of ethanol was added thereto, and the tube was centrifuged at 10,000 rpm for 10 minutes. The supernatant was removed using a micropipette, 900 μL of 70% ethanol was added, and the entire tube was rinsed. Then, 70% ethanol was removed using a micropipette and centrifuged again at 10,000 rpm for 1 minute. The supernatant was completely removed using a micropipette, and the precipitate was dissolved using 27 μL of TE buffer with 30 μg / mL of RNaseA. 8 μL of the resulting plasmid solution was taken, 1 μL of 10X CutSmart buffer (NEB) and 0.5 μL of SacI-HF or SfiI were added thereto, and the enzyme was inactivated by heating at 65 ° C for 5 minutes. The restriction endonuclease cleavage pattern was confirmed by agarose gel electrophoresis of the restriction endonuclease treated product. The complete base sequence of the clones showing the correct cleavage pattern was determined, and it was confirmed that pGETS151-AAV-EGFP-WPRE-Helper-RC2 ( Fig.29 ).

[0628] · Production of rAAV using an integrated plasmid (pGETS151-AAV-EGFP-WPRE-Helper-RC2)

[0629] Using an integrated plasmid with the same genes as the three plasmids used in triple-transfection, the effect on viral particle production was evaluated.

[0630] One day before transfection, 1×106 HEK293 cells were seeded in 6-well plates. After 22 hours, the medium was replaced with 1.9 mL of DMEM medium (2% FBS, 1% penicillin / streptomycin) and cultured at 37°C, 5% CO2 for 2 hours. For triple transfection, pAAV-EGFP-WPRE plasmid ( Fig.30 )0.48μg, pRC-mi342 plasmid ( Figure 7 )0.52μg, pHelper plasmid ( Figure 8 )0.95μg, 1 times the amount of PEI pro and DMEM medium to mix the transfection solution 100μL. For single transfection (Single-transfection), add pGETS151-AAV-EGFP-WPRE-Helper-RC2 plasmid ( Fig.29 )1.95μg, 1 times the amount of PEI pro and 100μL of transfection solution mixed with DMEM culture medium. After culturing for 72 hours at 37°C and 5% CO2, add 1 / 80 volume of 0.5M EDTA (pH8.0) and let it stand at room temperature for 10 minutes. Recover the peeled cell suspension, centrifuge at 180×g for 5 minutes, and completely remove the supernatant. Suspend the cell pellet in 200μL of Lysis buffer (2mM MgCl2, 150mM NaCl, 50mM Tris, 0.1% Triton (registered trademark) X-100; pH8.5), further add Benzonase (25 units), and react at 37°C for 30 minutes. Then, add 2 / 100 volume of 1.9MMgSO4 solution and let it stand at room temperature for 10 minutes. The supernatant was recovered by centrifugation at 12,000×g and 4° C. for 10 minutes, and Pluronic (registered trademark) F-68 was added thereto at a final concentration of 0.001%.

[0631] Evaluation of rAAV

[0632] The supernatant was treated with DNaseI for 30 minutes, reacted at 95°C for 10 minutes, and the obtained sample was diluted 1000 times for qPCR. The CMV promoter was used as the target, and the primer sequences of 5'-CATCAATGGGCGTGGATAGC-3' (SEQ ID NO. 185) and 5'-GGAGTTGTTACGACATTTTGGAAA-3' (SEQ ID NO. 186) were used. As for the reaction conditions, after 10 minutes at 95°C, 95°C / 15 seconds, 55°C / 5 seconds, and 72°C / 30 seconds were used as one cycle, and 40 cycles were repeated.

[0633] Each plasmid used in the above-mentioned Examples was obtained or prepared as follows.

[0634] 6230_pAAV-CMV

[0635] Purchased from TAKARA (6230_pAAV-CMV).

[0636] 6230_pRC2-mi342

[0637] Purchased from TAKARA (6230_pRC2-mi342).

[0638] ·6230_pHelper

[0639] Purchased from TAKARA (6230_pHelper).

[0640] ·SYNp204_pAAV-EGFP-WPRE

[0641] The pAAV-CMV plasmid (TAKARA: 6230) was treated with restriction endonucleases (AflII, BamHI). The following fragments were inserted into it using InFusion. For the EGFP-WPRE fragment, pGETS151-AAV-EGFP-WPRE-Helper-RC2 was used as a template and the following primers were used to prepare it: Primer sequence 5'-GAGCTGGTTTAGTGGATATC-3' (SEQ ID NO. 187), 5'-CAGGGATGCCACCCGTTTAATTA-3' (SEQ ID NO. 188).

[0642] The amount of viral vector produced under the conditions of triple transfection and single transfection is shown in Fig.31 It was confirmed that the entire viral vector plasmid can be designed and prepared using the OGAB method, and that the viral vector plasmid prepared in this manner can efficiently produce viral vectors.

[0643] (Note)

[0644] As described above, the present disclosure is exemplified using the preferred embodiments of the present disclosure, but it should be understood that the scope of the present disclosure should be interpreted only in accordance with the claims. It should be understood that the contents of the patents, patent applications and documents cited in this specification are incorporated into this specification as references in the same manner as if their contents themselves were specifically recorded in this specification.

[0645] This application claims the benefit of priority based on Japanese Patent Application No. 2022-76060 filed with the Japan Patent Office on May 2, 2022, the entire contents of which are incorporated into this specification by reference.

[0646] Industrial Applicability

[0647] The present disclosure can provide a virus-derived construct plasmid of a novel structure, and can provide a virus-derived construct based on the virus-derived construct plasmid.

[0648] [Sequence Listing Free Text]

[0649] Sequence number 1: Primer

[0650] GGAACCCCTAGTGATGGAGTT

[0651] Sequence number 2: Primer

[0652] CGGCCTCAGTGAGCGA

[0653] Serial No. 3: Connector F

[0654] AGCTTGCGCAGGTGCACCTGCATGCGG

[0655] Serial No. 4: Connector R

[0656] AGCTCCGCATGCAGGTGCACCTGCGCA

[0657] Sequence No. 5: No. 1-1

[0658] TAGAGGCAAGGGGTTGTTTTTATTGACTACACCTGCGATCAAGCTTGCCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGGGAGTGGCCAACTCCATCACTAGG

[0659] Sequence No. 6: 1-2

[0660] GGTCGTTGGGCGGTCAGCCAGGCGGGCCATTTACCGTAAGTTATGTAACGCGGAACTCCATATATGGGCTATGAACTAATGACCCCGTAATTGATTACTATTAAAGCTTGATATCGATAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCT

[0661] Sequence No. 7: 1-3

[0662] ATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCAT

[0663] Sequence number 8: positions 1-4

[0664] GTAATAGCGATGACTAATACGTAGATGTACTGCCAAGTAGGAAAGTCCCATAAGGTCATGTACTGGGCATAATGCCAGGCGGGCCATTTACCGTCATTGACGTCAATAGGGGGCGTACTTGGCATATGATACACTTGATGTACTGCCAAGTGGGC

[0665] Sequence number 9: positions 1-5

[0666] GTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACT

[0667] Sequence number 10: positions 1-6

[0668] TACTGGTTGGAAGAAAGACCTCTATCACCTGCGATCCTGGGCCCTTAAGGATATCCACTAAACCAGCTCTGCTTATATAGACCTCCCACCGTACACGCCTACCGCCCATTTGCGTCAATGGGGCGGAGTTGTTACGACATTTTGGAAAGTCCCGTTGATTTTGGTGCCAAAACAAAC

[0669] Sequence number 11: positions 3-1

[0670] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCGGAACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTT

[0671] Sequence number 12: Section 3-2

[0672] AGGGAGCAGTGGTTCACGCCTGTAATCCCAGCAATTTGGGAGGCCAAGGTGGGTAGATCACCTGAGATTAGGAGTTGGAGACCAGCCTGGCCAATATGGTGAAACCCCGTCTCTACCAAAAAAACAAAAATTAGCTGAGCCTGGTCATGC

[0673] Sequence number 13: Section 3-3

[0674] GGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTTATCGATAGATCTAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGG

[0675] Sequence number 14: Section 3-4

[0676] GGAAGCTGTAGAGCTGTTCCTGGTTGCGACGCAGGGTGGGCTGTACCTGGGGACTGTTAAGCATGGAGTTGGGTACCGGATCTGCCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACC

[0677] Sequence number 15: Section 3-5

[0678] CGCAACCAGGAACAGCTCTACAGCTTCCTGGAGCGCCACTC GCCCTACTTCCGCAGCCACAGTGCGCAGATTAGGAGCGCCACTTCTTTTTGTCACTTGAAAAACATGTAAAAATAATGTACTAGGAGACACTTTCAATAAAGGCAAATGT

[0679] Sequence number 16: positions 3 - 6

[0680] TACTGGTTGGAAGAAAGACCTCTATCACCTGCGATCTGTCCCTGCCAGTGGCGCATAGCGATGCGCGGCAGAACCCCTTTGATTTTTAAACGGCGCAGACGGCAAGGGTGGGGGGTAAATAATCACCCGAGAGTGTACAAATAAAAACATTTGCCTTTATTGAAAGTGTCTCCT

[0681] Sequence number 17: positions 16 - 1

[0682] TAGAGGCAAGGGTTGTTTTTATTGACTAGGTCTCGCAGGTACATCTACGGATTACGTCGACGTTTAAACCATATGAGCGGCCGCTCTAGAACTAGTGGATCCCCCGGAAGATCAGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCTGATCTGCGCAGCCGCC

[0683] Sequence number 18: positions 16 - 2

[0684] CAGAATCTGGCGGCAACTCCCATTCCTTCTCGGCCACCCAGTTCACAAAGCTGTCAGAAATGCCGGGCAGATGCTCGTCAAGGTCGCTGGGGACCTTAATCACAATCTCGTAAAACCCCGGCATGGCGGCTGCGCAGATCAGAAGTTCCTATAC

[0685] Sequence number 19: positions 16 - 3

[0686] AGAAGGAATGGGAGTTGCCGCCAGATTCTGACATGGATCTGAATCTGATTGAGCAGGCACCCCTGACCGTGGCCGAGAAGCTGCAGCGCGACTTTCTGACGGAATGGCGCCGTGTGAGTAAGGCCCCGGAGGCCCTTTTCTTTGTGCAAT

[0687] Sequence number 20: 16-4

[0688] CCGCGGTAAATTCTCTGAATCAGTTTTTCGCGAATCTGACTCAGGAAACGTCCCAAAACCATGGATTTCACCCCGGTGGTTTCCACGAGCACGTGCATGTGGAAGTAGCTCTCTCCCTTCTCAAATTGCACAAAGAAAAGGGCCTCCGGGGCCT

[0689] Sequence number 21: 16-5

[0690] CGAAAAACTGATTCAGAGAATTTACCGCGGGATCGAGCCGACTTTGCCAAACTGGTTCGCGGTCACAAAGACCAGAAATGGCGCCGGAGGCGGGAACAAGGTGGTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAG

[0691] Sequence number 22: 16-6

[0692] TACTGGTTGGAAGAAAGACCTCTATGGTCTCCCTGCTCCTGCGTCTGCGACACGTGCGTCAGATGCTGCGCCACCAACCGTTTACGCTCCGTGAGATTCAAACAGGCGCTTAAATACTGTTCCATATTAGTCCACGCCCACTGGAGCTCAGGCTGGGTTTTGGGGAGCAAGTAATT

[0693] Sequence number 23: 1-F

[0694] TAGCACCTGCATGCAAGCTTGCCTGCAGGCA

[0695] Sequence number 24: 1-R

[0696] TAGCACCTGCGCATCTGGGCCCTTAAGGATATC

[0697] Sequence No. 25: 2-F

[0698] TAGGGTCTCGCCAGCCGGCC

[0699] Sequence No. 26: 2-R

[0700] TAGGGTCTCCTTCCCAATAGACCCCGCA

[0701] Serial No. 27: 3-F

[0702] TAGCACCTGCATGCGGAACCAAGCTGGAGTG

[0703] Sequence No. 28: 3rd-R

[0704] TAGCACCTGCGCATTGTCCCTGCCAGTGG

[0705] Serial No. 29: 4-F

[0706] TAGGGTCTCGGACACGTTGCGATACTGGT

[0707] Sequence No. 30: 4-R

[0708] TAGGGTCTCCCACGAGCCCACGG

[0709] Serial No. 31: 5-F

[0710] TAGCACCTGCATGCCGTGGTGCTTGTAGGTTAC

[0711] Serial No. 32: 5-R

[0712] TAGCACCTGCGCATGAGCGCGGACGC

[0713] Serial No. 33: No. 6-F

[0714] TAGGGTCTCGGCTCGGGGGTGGT

[0715] Serial No. 34: 6-R

[0716] TAGGGTCTCCTTGCCGCGCGTTTCTC

[0717] Serial No. 35: 7-F

[0718] TAGCACCTGCATGCGCAAACGCCTCTGCAACAAGA

[0719] Serial No. 36: 7-R

[0720] TAGCACCTGCGCATGTCCGCCAGGTGC

[0721] Serial No. 37: 8-F

[0722] TAGGGTCTCGGGACATTATCTCCCCGAAC

[0723] Serial No. 38: 8-R

[0724] TAGGGTCTCCGTGGCGGCGGC

[0725] Serial No. 39: 9-F

[0726] TAGCACCTGCATGCCCACCCACGGACGA

[0727] Serial No. 40: 9-R

[0728] TAGCACCTGCGCATGAGGGAGCGCAGAGA

[0729] Serial No. 41: 10-F

[0730] TAGGGTCTCGCCTCACCCGCAGCTG

[0731] Serial No. 42: 10-R

[0732] TAGGGTCTCCGACTAAAAAATGACGTAACGGTTAAAGTC

[0733] Serial No. 43: 11-F

[0734] TAGCACCTGCATGCAGTCCTATATATACTCGCTCTGTACT

[0735] Serial No. 44: 11-R

[0736] TAGCACCTGCGCATGGAGCTATGCTAACCAGC

[0737] Serial No. 45: 12-F

[0738] TAGGGTCTCGCTCCGAGTATGCGTGTCA

[0739] Serial No. 46: 12-R

[0740] TAGGGTCTCCGTAGTTGTAGTATATCCACTCTCTCA

[0741] Serial No. 47: 13-F

[0742] TAGCACCTGCATGCCTACTACACAGAGCGAGCT

[0743] Serial No. 48: 13-R

[0744] TAGCACCTGCGCATGCACAGCACCACAATATTGTTCA

[0745] Serial No. 49: 14-F

[0746] TAGCACCTGCATGCGTGCTGCAGTTACTGTGCT

[0747] Serial No. 50: 14-R

[0748] TAGCACCTGCGCATTAGCGAGGTAAGCACTTACTCT

[0749] Serial No. 51: No. 15-F

[0750] TAGGGTCTCGGCTAGTTTCTGTGGATTCACTAGA

[0751] Serial No. 52: 15-R

[0752] TAGGGTCTCCCCTGGACATCCAGGTGA

[0753] Serial No. 53: 16-F

[0754] TAGGGTCTCGCAGGTACATCTACGGATTACGT

[0755] Serial No. 54: 16-R

[0756] TAGGGTCTCCCTGCTCCTGCGTCTG

[0757] Serial No. 55: No. 17-F

[0758] TAGCACCTGCATGCGCAGAACAAAGAGAATCAGAATCC

[0759] Serial No. 56: 17-R

[0760] TAGCACCTGCGCATGGTGAGTTCAAATTTGAACATCCG

[0761] Serial No. 57: 18-F

[0762] TAGGGTCTCGCACCCGCCGTCTG

[0763] Serial No. 58: No. 18-R

[0764] TAGGGTCTCCCGAGGGCCGCG

[0765] Serial No. 59: No. 19-F

[0766] TAGCACCTGCATGCCTCGAGCACGACAAAGC

[0767] Serial No. 60: 19-R

[0768] TAGCACCTGCGCATTGACTTGAATGTTAAAGAGCTTGAAGT TGA

[0769] Serial No. 61: No. 20-F

[0770] TAGGGTCTCGGTCAAAGAGGTCACGCAGA

[0771] Serial No. 62: 20-R

[0772] TAGGGTCTCCTTGGTTGTCCTGATTTCCTCTTC

[0773] Serial No. 63: No. 21-F

[0774] TAGCACCTGCATGCCCAATCCCGTGGCTAC

[0775] Serial No. 64: 21-R

[0776] TAGCACCTGCGCATGCATATGATACACTTGATGTACTGC

[0777] Serial No. 65: No. 22-F

[0778] TAGGGTCTCGATGCCAAGTACGCCCCCT

[0779] Serial No. 66: 22-R

[0780] TAGGGTCTCCCTCCCGGGCTGTAGT

[0781] Serial number 67: Fragment 1

[0782] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTTCAAGAATTCTCATGTTTGACAGCTTATCATCGATAAGCTTGCCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTATCGATATCAAGCTTTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCC CAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGGATCGCAGGTGATAGAGGTCTTTCTTCCAACCAGTA

[0783] Serial number 68: Fragment 2

[0784] TAGAGGCAAGGGTTGTTTTTATTGACTAGAAGACGAGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGGATATCGTATACGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGGAGTCTTCATAGAGGTCTTTCTTCCAACCAGTA

[0785] Sequence number 69: Fragment 3

[0786] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCCAAGTAAGTATACCGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTTCCCGTATGGCTTTCATTTTCTCCTCCTTGTATAAATCCTGGTTGCTGTCTCTTTATGAGGAGTTGTGGCCCGTTGTCAGGCAACGTGGCGTGGTGTGCACTGTGTTTGCTGACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGGAAGCTGACGTCCTTTCCATGGCTGCTCGCCTGTGTTGCCACCTGGATTCTGCGCGGGACGTCCTTCTGCTACGTCCCTTCGGCCCTCAATCCAGCGGACCTTCCTTCCCGCGGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCATCGGTTAATTAAACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGATCGCAGGTGATAGAGGTCTTTCTTCCAACCAGTA

[0787] Sequence number 70: Fragment 4

[0788] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAATCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTTATCGA TAGATCTAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGCAGATCCCCTCGAGGGGTACCCAACTCCATGCTTAACAGTCCCCAGGTACAGCCCACCCTGCGTCGCAACCAGGAACAGCTCTACAGCTTCCTGGAGCGCCACTCGCCCTACTTCCGCAGCCACAGTGCGCAGATTAGGAGCGCCACTTCTTTTTGTCACTTGAAAAACATGTAAAAATAATGTACTAGGAGACACTTTCAATAAAGGCAAATGTTTTTATTTGTACACTCTCGGGTGATTATTTACCCCCCACCCTTGCCGTCTGCGCCGTTTAAAAATCAAAGGGGTTCTGCCGCGCATCGCTATGCGCCACTGGCAGGGACACGTTGCGATACTGGTGGATCGCAGGTGATAGAGGTCTTTCTTCCAACCAGTA

[0789] Sequence number 71: Fragment 5

[0790] TAGAGGCAAGGGTTGTTTTTATTGACTAGAAGACGAGGTGTTTAGTGCTCCACTTAAACTCAGGCACAACCATCCGCGGCAGCTCGGTGAAGTTTTCACTCCACAGGCTGCGCACCATCACCAACGCGTTTAGCAGGTCGGGCGCCGATATCTTGAAGTCGCAGTTGGGGCCTCCGCCCTGCGCGCGCGAGTTGCGATACACAGGGTTGCAGCACTGGAACACTATCAGCGCCGGGTGGTGCACGCTGGCCAGCACGCTCTTGTCGGAGATCAGATCCGCGTCCAGGTCCTCCGCGTTGCTCAGGGCGAACGGAGTCAACTTTGGTAGCTGCCTTCCCAAAAAGGGTGCATGCCCAGGCTTTGAGTTGCACTCGCACCGTAGTGGCATCAGAAGGTGACCGTGCCCGGTCTGGGCGTTAGGATACAGCGCCTGCATGAAAGCCTTGATCTGCTTAAAAGCCACCTGAGCCTTTGCGCCTTCAGAGAAGAACATGCCGCAAGACTTGCCGGAAAACTGATTGGCCGGACAGGCCGCGTCATGCACGCAGCACCTTGCGTCGGTGTTGGAGATCTGCACCACATTTCGGCCCCACCGGTTCTTCACGATCTTGGCCTTGCTAGACTGCTCCTTCAGCGCGCGCTGCCCGTTTTCGCTCGTCACATCCATTTCAATCACGTGCTCCTTATTTATCATAATGCTCCCGTGTAGACACTTAAGCTCGCCTTCGATCTCAGCGCAGCGGTGCAGCCACAACGCGCAGCCCGTGGGCTCGTGGTGCTTGTAGGTTACCTCTGCAAACGACTGCAGGTACGCCTGCAGGAATCGCCCCATCGAGTCTTCATAGAGGTCTTTCTTCCAACCAGTA

[0791] Serial number 72: Fragment 6

[0792] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCCATCATCGTCACAAAGGTCTTGTTGCTGGTGAAGGTCAGCTGCAACCCGCGGTGCTCCTCGTTTAGCCAGGTCTTGCATACGGCCGCCAGAGCTTCCACTTGGTCAGGCAGTAGCTTGAAGTTTGCCTTTAGATCGTTATCCACGTGGTACTTGTCCATCAACGCGCGCGCAGCCTCCATGCCCTTCTCCCACGCAGACACGATCGGCAGGCTCAGCGGGTTTATCACCGTGCTTTCACTTTCCGCTTCACTGGACTCTTCCTTTTCCTCTTGCGTCCGCATACCCCGCGCCACTGGGTCGTCTTCATTCAGCCGCCGCACCGTGCGCTTACCTCCCTTGCCGTGCTTGATTAGCACCGGTGGGTTGCTGAAACCCACCATTTGTAGCGCCACATCTTCTCTTTCTTCCTCGCTGTCCACGATCACCTCTGGGGATGGCGGGCGCTCGGGCTTGGGAGAGGGGCGCTTCTTTTTCTTTTTGGACGCAATGGCCAAATCCGCCGTCGAGGTCGATGGCCGCGGGCTGGGTGTGCGCGGCACCAGCGCATCTTGTGACGAGTCTTCTTCGTCCTCGGACTCGAGACGCCGCCTCAGCCGCTTTTTTGGGGGCGCGCGGGGAGGCGGCGGCGACGGCGACGGGGACGACACGTCCTCCATGGTTGGTGGACGTCGCGCCGCACCGCGTCCGCGCTCGGGGGTGGTTTCGCGCTGCTCCTCTTCCCGACTGGCCATTTCCTTCTCCTATAGGCAGAAAAAGATCATGGAGTCAGTCGAGAAGGAGGACAGCCTAGATCGCAGGTGATAGAGGTCTTTCTTCCAACCAGTA

[0793] Sequence number 73: Fragment 7

[0794] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCCCTAACCGCCCCCTTTGAGTTCGCCACCACCGCCTCCACCGATGCC GCCAACGCGCCTACCACCTTCCCCGTCGAGGCACCCCCGCTTGAGGAGGAGGAAGTGATTATCGAGCAGGACCCAGGTTTTGTAAGCGAAGACGACGAGGATCGCTCAGTACCAACAGAGGATAAAAAGCAAGACCAGGACGACGCAGAGGCAAACGAGGAACAAGTCGGGCGGGGGGACCAAAGGCATGGCGACTACCTAGATGTGGGAGACGACGTGCTGTTGAAGCATCTGCAGCGCCAGTGCGCCATTATCTGCGACGCGTTGCAAGAGCGCAGCGATGTGCCCCTCGCCATAGCGGATGTCAGCCTTGCCTACGAACGCCACCTGTTCTCACCGCGCGTACCCCCCAAACGCCAAGAAAACGGCACATGCGAGCCCAACCCGCGCCTCAACTTCTACCCCGTATTTGCCGTGCCAGAGGTGCTTGCCACCTATCACATCTTTTTCCAAAACTGCAAGATACCCCTATCCTGCCGTGCCAACCGCAGCCGAGCGGACAAGCAGCTGGCCTTGCGGCAGGGCGCTGTCATACCTGATATCGCCTCGCTCGACGAAGTGCCAAAAATCTTTGAGGGTCTTGGACGCGACGAGAAACGCGCGGCAAACGCTCTGCAACAAGAAAACAGCGAAAATGAAAGTCACTGTGGAGTGCTGGTGGAACTTGAGGGTGACAACGCGCGCCTAGCCGTGCTGAAACGCAGCATCGAGGTCACCCACTTTGCCTACCCGGCACTTAACCTACCCCCCAAGATCGCAGGTGATAGAGGTCTTTCTTCCAACCAGTA

[0795] Sequence number 74: Fragment 8

[0796] TAGAGGCAAGGGTTGTTTTTATTGACTAGAAGACGACCAAGGTTATGAGCACAGTCATGAGCGAGCTGATCGTGCGCCGTGCACGACCCCTGGAGAGGGATGCAAACTTGCAAGAACAAACCGAGGAGGGCCTACCCGCAGTTGGCGATGAGCAGCTGGCGCGCTGGCTTGAGACGCGCGAGCCTGCCGACTTGGAGGAGCGACGCAAGCTAATGATGGCCGCAGTGCTTGTTACCGTGGAGCTTGAGTGCATGCAGCGGTTCTTTGCTGACCCGGAGATGCAGCGCAAGCTAGAGGAAACGTTGCACTACACCTTTCGCCAGGGCTACGTGCGCCAGGCCTGCAAAATTTCCAACGTGGAGCTCTGCAACCTGGTCTCCTACCTTG GAATTTTGCACGAAAACCGCCTCGGGCAAAACGTGCTTCATTCCACGCTCAAGGGCGAGGCGCGCCGCGACTACGTCCGCGACTGCGTTTACTTATTTCTGTGCTACACCTGGCAAACGGCCATGGGCGTGTGGCAGCAATGCCTGGAGGAGCGCAACCTAAAGGAGCTGCAGAAGCTGCTAAAGCAAAACTTGAAGGACCTATGGACGGCCTTCAACGAGCGCTCCGTGGCCGCGCACCTGGCGGACATTATCTTCCCCGAACGCCTGCTTAAAACCCTGCAACAGGGTCTGCCAGACTTCACCAGTCAAAGCATGTTGCAAAACTTTAGGAACTTTATCCTAGAGCGTTCAGGAATTCTGCCCGCCACCTGCTGTGCGCTTCCTAGCGACTTTGTGCCCATTAAGTACCGTGAATGCCCTCCGCCGCTTTGGGGTCACTGCTACCTTCGAGTCTTCATAGAGGTCTTTCTTCCAACCAGTA

[0797] Sequence number 75: Fragment 9

[0798] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCCTTCTGCAGCTAGCCAACTACCTTGCCTACCACTCCGACATCATGGAAGACGTGAGCGGTGACGGCCTACTGGAGTGTCACTGTCGCTGCAACCTATGCACCCCGCACCGCTCCCTGGTCTGCAATTCGCAACTGCTTAGCGAAAGTCAAATTATCGGTACCTTTGAGCTGCAGGGTCCCTCGCCTGACGAAAAGTCCGCGGCTCCGGGGTTGAAACTCACTCCGGGGCTGTGGACGTCGGCTTACCTTCGCAAATTTGTACCTGAGGACTACCACGCCCACGAGATTAGGTTCTACGAAGACCAATCCCGCCCGCCAAATGCGGAGCTTACCGCCTGCGTCATTACCCAGGGCCACATCCTTGGCCAATTGCAAGCCATCAACAAAGCCCGCCAAGAGTTTCTGCTACGAAAGGGACGGGGGGTTTACCTGGACCCCCAGTCCGGCGAGGAGCTCAACCCAATCCCCCCGCCGCCGCAGCCCTATCAGCAGCCGCGGGCCCTTGCTTCCCAGGATGGCACCCAAAAAGAAGCTGCAGCTGCCGCCGCCGCCACCCACGGACGAGGAGGAATACTGGGACAGTCAGGCAGAGGAGGTTTTGGACGAGGAGGAGGAGATGATGGAAGACTGGGACAGCCTAGACGAAGCTTCCGAGGCCGAAGAGGTGTCAGACGAAACACCGTCACCCTCGGTCGCATTCCCCTCGCCGGCGCCCCAGAAATTGGCAACCGTTCCCAGCATCGCTACAACCTCCGCTCCTCAGGCGCCGCCGGCACTGCCTGTTCGCCGACCGATCGCAGGTGATAGAGGTCTTTCTTCCAACCAGTA

[0799] Sequence number 76: Fragment 10

[0800] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCGACCCAACCGTAGATGGGACACCACTGGAACCAGGGCCGGTAAGTCTAAGCAGCCGCCGCCGTTAGCCCAAGAGCAACAACAGCGCCAAGGCTACCGCTCGTGGCGCGGGCACAAGAACGCCATAGTTGCTTGCTTGCAAGACTGTGGGGGCAACATCTCCTTCGCCCGCCGCTTTCTTCTCTACCATCACGGCGTGGCCTTCCCCCGTAACATCCTGCATTACTACCGTCATCTCTACAGCCCCTACTGCACCGGCGGCAGCGGCAGCGGCAGCAACAGCAGCGGTCACACAGAAGCAAAGGCGACCGGATAGCAAGACTCTGACAAAGCCCAAGAAATCCACAGCGGCGGCAGCAGCAGGAGGAGGAGCGCTGCGTCTGGCGCCCAACGAACCCGTATCGACCCGCGAGCTTAGAAATAGGATTTTTCCCACTCTGTATGCTATATTTCAACAAAGCAGGGGCCAAGAACAAGAGCTGAAAATAAAAAACAGGTCTCTGCGCTCCCTCACCCGCAGCTGCCTGTATCACAAAAGCGAAGATCAGCTTCGGCGCACGCTGGAAGACGCGGAGGCTCTCTTCAGCAAATACTGCGCGCTGACTCTTAAGGACTAGTTTCGCGCCCTTTCTCAAATTTAAGCGCGAAAACTACGTCATCTCCAGCGGCCACACCCGGCGCCAGCACCTGTCGTCAGCGCCATTATGAGCAAGGAAATTCCCACGCCCTACATGTGGAGTTACCAGCCACAAATGGGACTTGCGGCTGGAGCTGCCCAAGACTACTCAACCCGAATAAACTACGATCGCAGGTGATAGAGGTCTTTCTTCCAACCAGTA

[0801] Sequence number 77: Fragment 11

[0802] TAGAGGCAAGGGTTGTTTTTATTGACTAGAAGACGACTACATGAGCGCGGGACCCCACATGATATCCCGGGTCAACGGAATCCG CGCCCACCGAAACCGAATTCTCCTCGAACAGGCGGCTATTACCACCACACCTCGTAATAACCTTAATCCCCGTAGTTGGCCCGCTGCCCTGGTGTACCAGGAAAGTCCCGCTCCCACCACTGTGGTACTTCCCAGAGACGCCCAGGCCGAAGTTCAGATGACTAACTCAGGGGCGCAGCTTGCGGGCGGCTTTCGTCACAGGGTGCGGTCGCCCGGGCGTTTTAGGGCGGAGTAACTTGCATGTATTGGGAATTGTAGTTTTTTTAAAATGGGAAGTGACGTATCGTGGGAAAACGGAAGTGAAGATTTGAGGAAGTTGTGGGTTTTTTGGCTTTCGTTTCTGGGCGTAGGTTCGCGTGCGGTTTTCTGGGTGTTTTTTGTGGACTTTAACCGTTACGTCATTTTTTAGTCCTATATATACTCGCTCTGTACTTGGCCCTTTTTACACTGTGACTGATTGAGCTGGTGCCGTGTCGAGTGGTGTTTTTTAATAGGTTTTTTTACTGGTAAGGCTGACTGTTATGGCTGCCGCTGTGGAAGCGCTGTATGTTGTTCTGGAGCGGGAGGGTGCTATTTTGCCTAGGCAGGAGGGTTTTTCAGGTGTTTATGTGTTTTTCTCTCCTATTAATTTTGTTATACCTCCTATGGGGGCTGTAATGTTGTCTCTACGCCTGCGGGTATGTATTCCCCCGGGCTATTTCGGTCGCTTTTTAGCACTGACCGATGTTAACCAACCTGGAGTCTTCATAGAGGTCTTTCTTCCAACCAGTA

[0803] Sequence number 78: Fragment 12

[0804] TAGAGGCAAGGGTTGTTTTTATTGACTAGAAGACGACCTGATGTGTTTACCGAGTCTTACATTATGACTCCGGACATGACCGAGGAACTGTCGGTGGTGCTTTTTAATCACGGTGACCAGTTTTTTTACGGTCACGCCGGCATGGCCGTAGTCCGTCTTATGCTTATAAGGGTTGTTTTTCCTGTTGTAAGACAGGCTTCTAATGTTTAAATGTTTTTTTTTTTGTTATTTTATTTTGTGTTTAATGCAGGAACCCGCAGACATGTTTGAGAGAAAAATGGTGTCTTTTTCTGTGGTGGTTCCGGAACTTACCTGCCTTTATCTGCATGAGCATGACTACGATGTGCTTGCTTTTTTGCGCGAGGCTTTGCCTGATTTTTTGAGCAGCACCTTGCATTTTATATCGCCGCCCATGCAACAAGCTTACATAGGGGCTACGCTG GTTAGCATAGCTCCGAGTATGCGTGTCATAATCAGTGTGGGTTCTTTTGTCATGGTTCCTGGCGGGGAAGTGGCCGCGCTGGTCCGTGCAGACCTGCACGATTATGTTCAGCTGGCCCTGCGAAGGGACCTACGGGATCGCGGTATTTTTGTTAATGTTCCGCTTTTGAATCTTATACAGGTCTGTGAGGAACCTGAATTTTTGCAATCATGATTCGCTGCTTGAGGCTGAAGGTGGAGGGCGCTCTGGAGCAGATTTTTACAATGGCCGGACTTAATATTCGGGATTTGCTTAGAGACATATTGATAAGGTGGCGAGATGAAAATTATTTGGGCATGGTTGAAGGTGCTGGAATGTTTATAGAGGAGATTCACCCTGAAGGGTTTAGCCTTTACGTCCGAGTCTTCATAGAGGTCTTTCTTCCAACCAGTA

[0805] Serial number 79: Fragment 13

[0806] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCGTCCACTTGGACGTGAGGGCAGTTTGCCTTTTGGAAGCCATTGTGCAACATCTTACAAATGCCATTATCTGTTCTTTGGCTGTAGAGTTTGACCACGCCACCGGAGGGGAGCGCGTTCACTTAATAGATCTTCATTTTGAGGTTTTGGATAATCTTTTGGAATAAAAAAAAAAAAACATGGTTCTTCCAGCTCTTCCCGCTCCTCCCGTGTGTGACTCGCAGAACGAATGTGTAGGTTGGCTGGGTGTGGCTTATTCTGCGGTGGTGGATGTTATCAGGGCAGCGGCGCATGAAGGAGTTTACATAGAACCCGAAGCCAGGGGGCGCCTGGATGCTTTGAGAGAGTGGATATACTACAACTACTACACAGAGCGAGCTAAGCGACGAGACCGGAGACGCAGATCTGTTTGTCACGCCCGCACCTGGTTTTGCTTCAGGAAATATGACTACGTCCGGCGTTCCATTTGGCATGACACTACGACCAACACGATCTCGGTTGTCTCGGCGCACTCCGTACAGTAGGGATCGCCTACCTCCTTTTGAGACAGAGACCCGCGCTACCATACTGGAGGATCATCCGCTGCTGCCCGAATGTAACACTTTGACAATGCACAACGTGAGTTACGTGCGAGGTCTTCCCTGCAGTGTGGGATTTACGCTGATTCAGGAATGGGTTGTTCCCTGGGATATGGTTCTGACGCGGGAGGAGCTTGTAATCCTGAGGAAGTGTATGCACGTGTGCCTGTGT TGTGCCAACATTGATATCATGACGAGCATGATGATCCATGGTTACGGATCGCAGGTGATAGAGGTCTTTCTTCCAACCAGTA

[0807] Sequence number 80: Fragment 14

[0808] TAGAGGCAAGGGTTGTTTTTATTGACTAGAAGACGATACGAGTCCTGGGCTCTCCACTGTCATTGTTCCAGTCCCGGTTCCCTGCAGTGCATAGCCGGCGGGCAGGTTTTGGCCAGCTGGTTTAGGATGGTGGTGGATGGCGCCATGTTTAATCAGAGGTTTATATGGTACCGGGAGGTGGTGAATTACAACATGCCAAAAGAGGTAATGTTTATGTCCAGCGTGTTTATGAGGGGTCGCCACTTAATCTACCTGCGCTTGTGGTATGATGGCCACGTGGGTTCTGTGGTCCCCGCCATGAGCTTTGGATACAGCGCCTTGCACTGTGGGATTTTGAACAATATTGTGGTGCTGTGCTGCAGTTACTGTGCTGATTTAAGTGAGATCAGGGTGCGCTGCTGTGCCCGGAGGACAAGGCGTCTCATGCTGCGGGCGGTGCGAATCATCGCTGAGGAGACCACTGCCATGTTGTATTCCTGCAGGACGGAGCGGCGGCGGCAGCAGTTTATTCGCGCGCTGCTGCAGCACCACCGCCCTATCCTGATGCACGATTATGACTCTACCCCCATGTAGGCGTGGACTTCCCCTTCGCCGCCCGTTGAGCAACCGCAAGTTGGACAGCAGCCTGTGGCTCAGCAGCTGGACAGCGACATGAACTTAAGCGAGCTGCCCGGGGAGTTTATTAATATCACTGATGAGCGTTTGGCTCGACAGGAAACCGTGTGGAATATAACACCTAAGAATATGTCTGTTACCCATGATATGATGCTTTTTAAGGCCAGCCGGGGAGAAAGGACTGTGTACTCTGTGTGTTGGGAGGGAGGTGGCAGGAGTCTTCATAGAGGTCTTTCTTCCAACCAGTA

[0809] Serial number 81: Fragment 15

[0810] TAGAGGCAAGGGTTGTTTTTATTGACTAGAAGACGAGCAGGTTGAATACTAGGGTTCTGTGAGTTTGATTAAGGTACGGTGATCAATATAAGCTATGTGGTGGTGGGGCTATACTACTGAATGAAAAATGACTTGAAATTTTCTGCAATTGAAAAATAAACACGTTGAAACATAACATGCAACAGGTTCACGATTCTTTATTCCTGGGCAATGTA GGAGAAGGTGTAAGAGTTGGTAGCAAAAGTTTCAGTGGTGTATTTTCCACTTTCCCAGGACCATGTAAAAGACATAGAGTAAGTGCTTACCTCGCTAGTTTCTGTGGATTCACTAGAATCGATGTAGGATGTTGCCCCTCCTGACGCGGTAGGAGAAGGGGAGGGTGCCCTGCATGTCTGCCGCTGCTCTTGCTCTTGCCGCTGCTGAGGAGGGGGGCGCATCTGCCGCAGCACCGGATGCATCTGGGAAAAGCAAAAAAGGGGCTCGTCCCTGTTTCCGGAGGAATTTGCAAGCGGGGTCTTGCATGACGGGGAGGCAAACCCCCGTTCGCCGCAGTCCGGCCGGCCCGAGACTCGAACCGGGGGTCCTGCGACTCAACCCTTGGAAAATAACCCTCCGGCTACAGGGAGCGAGCCACTTAATGCTTTCGCTTTCCAGCCTAACCGCTTACGCCGCGCGCGGCCAGTGGCCAAAAAAGCTAGCGCAGCAGCCGCCGCGCCTGGAAGGAAGCCAAAAGGAGCGCTCCCCCGTTGTCTGACGTCGCACACCTGGGTTCGACACGCGGGCGGTAACCGCATGGATCACGGCGGACGGCCGGATCCGGGGTTCGAACGAGTCTTCATAGAGGTCTTTCTTCCAACCAGTA

[0811] Sequence number 82: Fragment 16

[0812] TAGAGGCAAGGGTTGTTTTTATTGACTAGAAGACGAGAACCCCGGTCGTCCGCCATGATACCCTTGCGAATTTATCCACCAGACCACGGAAGAGTGCCCGCTTACAGGCTCTCCTTTTGCACGGTCTAGAGCGTCAACGACTGCGCACGCCTCACCGGCCAGAGCGTCCCGACCATGGAGCACTTTTTGCCGCTGCGCAACATCTGGAACCGCGTCCGCGACTTTCCGCGCGCCTCCACCACCGCCGCCGGCATCACCTGGATGTCCAGGTACATCTACGGATTACGTCGACGTTTAAACCATATGAGCGGCCGCTCTAGAACTAGTGGATCCCCCGGAAGATCAGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCTGATCTGCGCAGCCGCCATGCCGGGGTTTTACGAGATTGTGATTAAGGTCCCCAGCGACCTTGACGAGCATCTGCCCGGCATTTCTGACAGCTTTGTGAACTGGGTGGCCGAGAAGGAATGGGAGTTGCCGCCAGATTCTGACATGGATCTGAATCTGATTGAGCAGGCACC CCTGACCGTGGCCGAGAAGCTGCAGCGCGACTTTCTGACGGAATGGCGCCGTGTGAGTAAGGCCCCGGAGGCCCTTTTCTTTGTGCAATTTGAGAAGGGAGAGAGCTACTTCCACATGCACGTGCTCGTGGAAACCACCGGGGTGAAATCCATGGTTTTGGGACGTTTCCTGAGTCAGATTCGCGAAAAACTGATTCAGAGAATTTACCGCGGGATCGAGCCGACTTTGCCAAACTGGTTCGCGGTCACAAAGACCAGAAATGGCGCCGGAGGAGTCTTCATAGAGGTCTTTCTTCCAACCAGTA

[0813] Serial number 83: Fragment 17

[0814] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCGGAGGCGGGAACAAGGTGGTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGCTCCAGTGGGCGTGGACTAATATGGAACAGTATTTAAGCGCCTGTTTGAATCTCACGGAGCGTAAACGGTTGGTGGCGCAGCATCTGACGCACGTGTCGCAGACGCAGGAGCAGAACAAAGAGAATCAGAATCCCAATTCTGATGCGCCGGTGATCAGATCAAAAACTTCAGCCAGGTACATGGAGCTGGTCGGGTGGCTCGTGGACAAGGGGATTACCTCGGAGAAGCAGTGGATCCAGGAGGACCAGGCCTCATACATCTCCTTCAATGCGGCCTCCAACTCGCGGTCCCAAATCAAGGCTGCCTTGGACAATGCGGGAAAGATTATGAGCCTGACTAAAACCGCCCCCGACTACCTGGTGGGCCAGCAGCCCGTGGAGGACATTTCCAGCAATCGGATTTATAAAATTTTGGAACTAAACGGGTACGATCCCCAATATGCGGCTTCCGTCTTTCTGGGATGGGCCACGAAAAAGTTCGGCAAGAGGAACACCATCTGGCTGTTTGGGCCTGCAACTACCGGGAAGACCAACATCGCGGAGGCCATAGCCCACACTGTGCCCTTCTACGGGTGCGTAAACTGGACCAATGAGAACTTTCCCTTCAACGACTGTGTCGACAAGATGGTGATCTGGTGGGAGGAGGGGAAGATGACCGCCAAGGTCGTGGAGTCGGCCAAAGCCATTCTCGGAGGAAGCAAGGTGCGCGTGGACCAGAAATGCAAGTCCTCGATCGCAGGTGATAGAGGTCTTTCTTCCAACCAGTA

[0815] Serial number 84: Fragment 18

[0816] TAGAGGCAAGGGTTGTTTTTATTGACTAGAAGACGACCTCGGCCCAGATAGACCCGACTCCCGTGATCGTCACCTCCAACACCAACATGTGCGCCGTGATTGACGGGAACTCAACGACCTTCGAACACCAGCAGCCGTTGCAAGACCGGATGTTCAAATTTGAACTCACCCGCCGTCTGGATCATGACTTTGGGAAGGTCACCAAGCAGGAAGTCAAAGACTTTTTCCGGTGGGCAAAGGATCACGTGGTTGAGGTGGAGCATGAATTCTACGTCAAAAAGGGTGGAGCCAAGAAAAGACCCGCCCCCAGTGACGCAGATATAAGTGAGCCCAAACGGGTGCGCGAGTCAGTTGCGCAGCCATCGACGTCAGACGCGGAAGCTTCGATCAACTACGCAGACAGGTACCAAAACAAATGTTCTCGTCACGTGGGCATGAATCTGATGCTGTTTCCCTGCAGACAATGCGAGAGAATGAATCAGAATTCAAATATCTGCTTCACTCACGGACAGAAAGACTGTTTAGAGTGCTTTCCCGTGTCAGAATCTCAACCCGTTTCTGTCGTCAAAAAGGCGTATCAGAAACTGTGCTACATTCATCATATCATGGGAAAGGTGCCAGACGCTTGCACTGCCTGCGATCTGGTCAATGTGGATTTGGATGACTGCATCTTTGAACAATAAATGATTTAAATCAGGTATGGCTGCCGATGGTTATCTTCCAGATTGGCTCGAGGACACTCTCTCTGAAGGAATAAGACAGTGGTGGAAGCTCAAACCTGGCCCACCACCACCAAAGCCCGCAGAGCGGCATAAGGACGACAGCGAGTCTTCATAGAGGTCTTTCTTCCAACCAGTA

[0817] Sequence number 85: Fragment 19

[0818] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCCAGCAGGGGTCTTGTGCTTCCTGGGTACAAGTACCTCGGACCCTTCAACGGACTCGACAAGGGAGAGCCGGTCAACGAGGCAGACGCCGCGGCCCTCGAGCACGACAAAGCCTACGACCGGCAGCTCGACAGCGGAGACAACCCGTACCTCAAGTACAACCACGCCGACGCGGAGTTTCAGGAGCGCCTTAAAGAAGATACGTCTTTTGGGGGCAACC TCGGACGAGCAGTCTTCCAGGCGAAAAAGAGGGTTCTTGAACCTCTGGGCCTGGTTGAGGAACCTGTTAAGACGGCTCCGGGAAAAAAGAGGCCGGTAGAGCACTCTCCTGTGGAGCCAGACTCCTCCTCGGGAACCGGAAAGGCGGGCCAGCAGCCTGCAAGAAAAAGATTGAATTTTGGTCAGACTGGAGACGCAGACTCAGTACCTGACCCCCAGCCTCTCGGACAGCCACCAGCAGCCCCCTCTGGTCTGGGAACTAATACGATGGCTACAGGCAGTGGCGCACCAATGGCAGACAATAACGAGGGCGCCGACGGAGTGGGTAATTCCTCGGGAAATTGGCATTGCGATTCCACATGGATGGGCGACAGAGTCATCACCACCAGCACCCGAACCTGGGCCCTGCCCACCTACAACAACCACCTCTACAAACAAATTTCCAGCCAATCAGGAGCCTCGAACGACAATCACTACTTTGGCTACAGCACCCCTTGGGGGTATTTTGACTTCAACAGATTCCACTGCCACTTTTCACCACGTGACTGGCAAAGACTCATCAACAACAACTGGGGATTCCGACGATCGCAGGTGATAGAGGTCTTTCTTCCAACCAGTA

[0819] Sequence number 86: Fragment 20

[0820] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCCGACCCAAGAGACTCAACTTCAAGCTCTTTAACATTCAAGTCAAAGAGGTCACGCAGAATGACGGTACGACGACGATTGCCAATAACCTTACCAGCACGGTTCAGGTGTTTACTGACTCGGAGTACCAGCTCCCGTACGTCCTCGGCTCGGCGCATCAAGGATGCCTCCCGCCGTTCCCAGCAGACGTCTTCATGGTGCCACAGTATGGATACCTCACCCTGAACAACGGGAGTCAGGCAGTAGGACGCTCTTCATTTTACTGCCTGGAGTACTTTCCTTCTCAGATGCTGCGTACCGGAAACAACTTTACCTTCAGCTACACTTTTGAGGACGTTCCTTTCCACAGCAGCTACGCTCACAGCCAGAGTCTGGACCGTCTCATGAATCCTCTCATCGACCAGTACCTGTATTACTTGAGCAGAACAAACACTCCAAGTGGAACCACCACGCAGTCAAGGCTTCAGTTTTCTCAGGCCGGAGCGAGTGACATTCGGGACCAGTCTAGGAACTGGCTTCCTGGACCCTGT TACCGCCAGCAGCGAGTATCAAAGACATCTGCGGATAACAACAACAGTGAATACTCGTGGACTGGAGCTACCAAGTACCACCTCAATGGCAGAGACTCTCTGGTGAATCCGGGCCCGGCCATGGCAAGCCACAAGGACGATGAAGAAAAGTTTTTTCCTCAGAGCGGGGTTCTCATCTTTGGGAAGCAAGGCTCAGAGAAAACAAATGTGGACATTGAAAAGGTCATGATTACAGACGAAGAGGAAATCAGGACAACCAATCCCGTGGGATCGCAGGTGATAGAGGTCTTTCTTCCAACCAGTA

[0821] Sequence number 87: Fragment 21

[0822] TAGAGGCAAGGGTTGTTTTTATTGACTAGAAGACGAGTGGCTACGGAGCAGTATGGTTCTGTATCTACCAACCTCCAGAGAGGCAACAGACAAGCAGCTACCGCAGATGTCAACACACAAGGCGTTCTTCCAGGCATGGTCTGGCAGGACAGAGATGTGTACCTTCAGGGGCCCATCTGGGCAAAGATTCCACACACGGACGGACATTTTCACCCCTCTCCCCTCATGGGTGGATTCGGACTTAAACACCCTCCTCCACAGATTCTCATCAAGAACACCCCGGTACCTGCGAATCCTTCGACCACCTTCAGTGCGGCAAAGTTTGCTTCCTTCATCACACAGTACTCCACGGGACAGGTCAGCGTGGAGATCGAGTGGGAGCTGCAGAAGGAAAACAGCAAACGCTGGAATCCCGAAATTCAGTACACTTCCAACTACAACAAGTCTGTTAATGTGGACTTTACTGTGGACACTAATGGCGTGTATTCAGAGCCTCGCCCCATTGGCACCAGATACCTGACTCGTAATCTGTAATTGCTTGTTAATCAATAAACCGTTTAATTCGTTTCAGTTGAACTTTGGTCTCTGCGTATTTCTTTCTTATCTAGTTTCCATGGCTACTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGGAGTCTTCATAGAGGTCTTTCTTCCAACCAGTA

[0823] Sequence number 88: Fragment 22

[0824] TAGAGGCAAGGGTTGTTTTTATTGACTAGAAGACGACTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGGATCCTGCCATTGCATCCTTCTCTGCAGACTAAGATGGAGTTCCTGAACCAAGACCGCTTGCTGGCCAACCTGTGAAACTGGGCTCAAGGTGAGGGGTGCTATCTGTGATTGAGGGACATGGTTAATGGAATTGTCTCACACAGAAATCGCACCCGTCACCTTGGCCTACTTATCACCACCCCAAACAGAGGAACACGCCTTCTCCAGCCACAGCCTATGGAAGGGCCTTCAGCTGCTGTGGCCCCGAGGTAAGCTTGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGTGTTGGGTCGTTGTAGATAAGTAGCATGGCGGGTTAATCATTAACTACAGCCCGGGGTTTAAACAGCGGGCGGAGGGGTGGAGTCGTGACGTGAATTACGTCATAGGGTTAGGGAGGTCCTGTATTAGAGGTCACGTGAGTGTTTTGCGAGTCTTCATAGAGGTCTTTCTTCCAACCAGTA

[0825] Sequence number 89: Fragment 23

[0826] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCTTGCGACATTTTGCGACACCATGTGGTCTCGCTGGGGGGGGGGGCCCGAGTGAGCACGCAGGGTCTCCATTTTGAAGCGGGAGGTTTGAACGAGCGCTGGCGCGCTCCGTCGACGAGCTTTAATGCGGTAGTTTATCACAGTTAAATTGCTAACGCAGTCAGGCACCGTGTATGAAATCTAACAATGCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGG CGTGCTGCTAGCGCTATATGCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCGCTTCGCTACTTGGAGCCACTATCGACTACGCGATCATGGCGACCACACCCGTCCTGTGGATCCTCTACGCCGGACGCATCGTGGCCGGCATCACCGGCGCCACAGGTGCGGTTGCTGGCGCCTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACTACTGGGCTGCTTCCTAATGCAGGAGTCGCATAAGGGAGAGCGTCGACCGATGCCCTTGAGAGCCTTCAACCCAGTCAGCTCCTTCCGGTGGGCGCGGGGCATGACGATCGCAGGTGATAGAGGTCTTTCTTCCAACCAGTA

[0827] Serial number 90: Fragment 24

[0828] TAGAGGCAAGGGTTGTTTTTATTGACTAGAAGACGATGACTAGATCCACCTGCACGTAAAAGGCCTTCTTGGCCGCCCTTCCCGGTCGATATGAACAGCTTATTTACATAATTCACGTTATTGGTAGTTATAAATGAAATTCCTAATATCGGTTATGAAGTGAAATTGAATTTCTACTTGATCTTTCTCTCTATTTTTGTAAAATAAAATTAAGAATATTTAAATATTCAATGATTCATTTTTGCAGAAATCGGAGGAAGAAGAATATATGAAAACATTTAACATTTCTCAACAAGATCCCCCCATATTGTTGTATAAGTGATGAAATACTGAATTTAAAACTTAGTTTATATGTGGTAAAATGTTTTAATCAAGTTTAGGAGGAATTAATTATGAAGTGTAATGAATAATGAATGTAACAGGGTTCAATTAAAAGAGGGAAGCGTATCATTAACCCTATAAACTACGTCTGCCCTCATTATTGGAGGGTGAAATGTGAATACATCCTATTCACAATCGAATTTACGACACAACCAAATTTTAATTTGGCTTTGCATTTTATCTTTTTTTAGCGTATTAAATGAAATGGTTTTGAACGTCTCATTACCTGATATTGCAAATGATTTTAATAAACCACCAGCGAGTACAAACTGGGTG AACACAGCCTTTATGTTAACCTTTTCCATTGGAACAGCTGTATATGGAAAGCTATCTGATCAATTAGGCATCAAAAGGTTACTCCTATTTGGAATTATAATAAATTGTTTCGGGTCGGTAATTGGGTTTGTTGGCCATTCTTTCTTTTCCTTACTTATTATGGCTCGAGTCTTCATAGAGGTCTTTCTTCCAACCAGTA

[0829] Sequence number 91: Fragment 25

[0830] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCGCTCGTTTTATTCAAGGGGCTGGTGCAGCTGCATTTCCAGCACTCGTAATGGTTGTAGTTGCGCGCTATATTCCAAAGGAAAATAGGGGTAAAGCATTTGGTCTTATTGGATCGATAGTAGCCATGGGAGAAGGAGTCGGTCCAGCGATTGGTGGAATGATAGCCCATTATATTCATTGGTCCTATCTTCTACTCATTCCTATGATAACAATTATCACTGTTCCGTTTCTTATGAAATTATTAAAGAAAGAAGTAAGGATAAAAGGTCATTTTGATATCAAAGGAATTATACTAATGTCTGTAGGCATTGTATTTTTTATGTTGTTTACAACATCATATAGCATTTCTTTTCTTATCGTTAGCGTGCTGTCATTCCTGATATTTGTAAAACATATCAGGAAAGTAACAGATCCTTTTGTTGATCCCGGATTAGGGAAAAATATACCTTTTATGATTGGAGTTCTTTGTGGGGGAATTATATTTGGAACAGTAGCAGGGTTTGTCTCTATGGTTCCTTATATGATGAAAGATGTTCACCAGCTAAGTACTGCCGAAATCGGAAGTGTAATTATTTTCCCTGGAACAATGAGTGTCATTATTTTCGGCTACATTGGTGGGATACTTGTTGATAGAAGAGGTCCTTTATACGTGTTAAACATCGGAGTTACATTTCTTTCTGTTAGCTTTTTAACTGCTTCCTTTCTTTTAGAAACAACATCATGGTTCATGACAATTATAATCGTATTTGTTTTAGGTGGGCTTTCGTTCACCAAAACAGTTATATCAACAATTGTTTCAAGTAGCTTGATCGCAGGTGATAGAGGTCTTTCTTCCAACCAGTA

[0831] Sequence number 92: Fragment 26

[0832] TAGAGGCAAGGGTTGTTTTTATTGACTAGAAGACGAGCTTG AAACAGCAGGAAGCTGGTGCTGGAATGAGTTTGCTTAACTTTACCAGCTTTTTATCAGAGGGAACAGGTATTGCAATTGTAGGTGGTTTATTATCCATACCCTTACTTGATCAAAGGTTGTTACCTATGGAAGTTGATCAGTCAACTTATCTGTATAGTAATTTGTTATTACTTTTTTCAGGAATCATTGTCATTAGTTGGCTGGTTACCTTGAATGTATATAAACATTCTCAAAGGGATTTCTAAATCGTTAAGGGATCAACTTTGGGAGAGAGTTCAAAATTGATCCTTTTTTTATAACAGGAATTGGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTCCTGTCGTCATATCTACAATTCTACACAGCCCAGTCCAGACTATTGAATTGTATCACGTTTTTGATATCCTACCAATAACAAATTGATTGGAGGAATGCAAAGTGAATAATGAACCAGTAAAACGTGGTAAGAAGAACAGATGGGAATTAAACCTACCTATAATGACTTATGTAGTAGCTGATGATTGGATTGATAAACTAGGACACGAAACGTTTACTTTATGGTTGAGGTTCCATACTTGGGTAGAGTCTTCATAGAGGTCTTTCTTCCAACCAGTA

[0833] Serial number 93: Fragment 27

[0834] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCGGTAGATAGAGAAGATGAACTCCGAGATTATGATCGCATACCTAGAAGTTTTGAGAACATATATAAAAAGACACTAGGAATCTCAAAAAGTAAGTTTTATAGATTGATAAAACCTTTATGGGAATATGGATTAATAGACATCATAGAATACGAAGAATCTAACCGTAATTCTACTAAACCTAAAAATATAATTGTTTATGAGTATCCTTTACACGAAATAGAAAGAAAGTATAAACCACTAGAAAAATTAAGAGATTGGGATAAAGACTATAATTCCGTTTCTAAAGAATTAGGTAAAACAGGTGGTAGACCAAGGAAAAAAGATAGTGAAGAAGAACCCGAAAAGAAA CCCGAAGAAGTAACTAAAAAGAAACGTAAATATAAGTTAAAAAGAGTTATCCACAACGGTTTCAAAAATGAAACGGTGGAGGGTTTCAAAAATGAAACGGTGGAGGGTTTCAAAAATGAAACGGTGACCGTTTCAAAAATAAAACCCAATAATTATTCAAATATCTTTAATAACTTATCAAATATTTCTACTAATGTTTCAAATAATTTATTAATTGATGATGATGAGGAAATCGAAAATGAACCAACTGGTCGTACAATAAATAGGTCATTACTTTTTTCACAAGAAGATATTAAACAGGCCTATCAATTTATTAATAGATTTTCAGTTATACAGTTACGTGAAAACTTTAGCTTTGATAAACACTTTGAAGAACGGTTGGTATGTTATTTATGGAAAGCAGGGATTTCTACTTTTTACACGCACGAAATCAGTAAAATGATAAAAAAAATAGCGATCGCAGGTGATAGAGGTCTTTCTTCCAACCAGTA

[0835] Sequence number 94: Fragment 28

[0836] TAGAGGCAAGGGTTGTTTTTATTGACTAGAAGACGATAGCAGACTATGAAAAATCTAAAAAAGGTAGATTAAACCCAATACGTGACCGAGCCTTATATATGGTAAATGGTCTTGTAATGAATAGAGCTTCTTCCCAAAGTGAACATGCTACTTATAAACTAAACCAATATAAAAAACAGAAGGAACAGGAAAAACAACAACAGGAGCAACAAAGATCAAGAGTACCGTTCTATAATTGGTTGGAGGAAAGAGAAGAACAAACCGAAGGTCAACTACCCACCACTTAAGCGGCCGCAAGCTTGAAGAGCTCTTCTTTCAGAACGCTCGGTTGCCGCCGGGCGTTTTTTATGAGACGTCTCGGCCTGTTTGGCCATTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAG CATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCGAGTCTTCATAGAGGTCTTTCTTCCAACCAGTA

[0837] Serial number 95: Fragment 29

[0838] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGGATCGCAGGTGATAGAGGTCTTTCTTCCAACCAGTA

[0839] Sequence number 96: Fragment 30

[0840] TAGAGGCAAGGGTTGTTTTTATTGACTAGAAGACGACGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATA GTTTGCGCAACGTTGTTGCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGGCGATCGCCACATTTCCCCGAAAAGAGTCTTCATAGAGGTCTTTCTTCCAACCAGTA

[0841] Sequence number 97: Fragment 2 - Construction primer 1

[0842] TAGAGGCAAGGGGTTGTTTTTATTGACTAGAAGACGAGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATAAGCAGAGCTGGTTTAGTGGATATCGTATACGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGA

[0843] SEQ ID NO: 98: Fragment 2 - Construction Primer 2

[0844] TGGTCACGAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGCTTGCCGTAGGTGGCATCGCCCTCGCCCTCGCCGGACACGCTGAACTTGTGGCCGTTTACGTCGCCGTCCAGCTCGACCAGGATGGGCACCACCCCGGTGA

[0845] SEQ ID NO: 99: Fragment 2 - Construction Primer 3

[0846] CCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGG CGTGCAGTGCTTCAGCCGCTACCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGC

[0847] SEQ ID NO: 100: Fragment 2 - Construction Primer 4

[0848] TTGTCGGCCATGATATAGACGTTGTGGCTGTTGTAGTTGTACTCCAGCTTGTTGCCCCAGGATGTTGCCGTCCTCCTTGAAGTCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTGTCGCCCTCGAACTTCACCTCGGCGCGGGTCTTGTAGTTGCCGTCGTCCTTG

[0849] SEQ ID NO: 101: fragment 2 - construction primer 5

[0850] GCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCA

[0851] SEQ ID NO: 102: fragment 2 - construction primer 6

[0852] TACTGGTTGGAAGAAAGACCTCTATGAAGACTCCTTGTACAGCTCGTCCATGCCGAGAGTGATCCCGGCGGCGGTCACGAACTCCAGCAGGACCATGTGATCGCGCTTCTCGTTGGGGTCTTTGCTCAGGGCGGACTGGGTGCTCAGGTAGTGGTTGTCGGGCAGCAG

[0853] SEQ ID NO: 103: Fragment 3 - Construction Primer 1

[0854] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCCAAGTAAGTATACCGATAATCAACCTCTGGATTACAAAATTTGTGAAAGATTGACTGGTATTCTTAACTATGTTGCTCCTTTTACGCTATGTGGATACGCTGCTTTAATGCCTTTGTATCATGCTATTGCTT

[0855] SEQ ID NO: 104: Fragment 3 - Construction Primer 2

[0856] TGGCAATGCCCCAACCAGTGGGGGTTGCGTCAGCAAACACAGTGCACACCACGCCACGTTGCCTGACAACGGGCCACAACTCCTCATAAAGAGACAGCAACCAGGATTTATACAAGGAGGAGAAAATGAAAGCCATACGGGAAGCAATAGCATGATACAAAGGCATTAAAG

[0857] SEQ ID NO: 105: Fragment 3 - Construction Primer 3

[0858] ACGCAACCCCCACTGGTTGGGGCATTGCCACCACCTGTCAGCTCCTTTCCGGGACTTTCGCTTTCCCCCTCCCTATTGCCACGGCGGAACTCATCGCCGCCTGCCTTGCCCGCTGCTGGACAGGGGCTCGGCTGTTGGGCACTGACAATTCCGTGGTGTTGTCGGGG

[0859] Sequence number 106: Fragment 3 - Construction primer 4

[0860] CGGAAGAGGCCGCAGAGCCGGCAGCAGGCCGCGGGAAGGAAGGTCCGCTGGATTGAGGGCCGAAGGGACGTAGCAGAAGGACGTCCCGCGCAGAATCCAGGTGGCAACACAGGCGAGCAGCCATGGAAAGGACGTCAGCTTCCCCGACAACACCACGGAATTGTCAGTGCC

[0861] Sequence number 107: Fragment 3 - Construction primer 5

[0862] GGCCTGCTGCCGGCTCTGCGGCCTCTTCCGCGTCTTCGCCTTCGCCCTCAGACGAGTCGGATCTCCCTTTGGGCCGCCTCCCCGCATCGGTTAATTAAACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAG

[0863] Sequence number 108: Fragment 3 - Construction primer 6

[0864] TACTGGTTGGAAGAAAGACCTCTATCACCTGCGATCTTCCCAACTTGCCCCTTGCTCCATACCACCCCCCTCCACCCCATAATATTATAGAAGGACACCTAGTCAGACAAAATGATGCAACTTAATTTTATTAGGACAAGGCTGGTGGGCACTGGAGTGGCAACTTCCAGG

[0865] Sequence number 109: Fragment 4 - Construction primer 1

[0866] TAGAGGCAAGGGTTGTTTTTATTGACTACACCTGCGATCGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGG

[0867] SEQ ID NO: 110: Fragment 4 - Construction Primer 2

[0868] GTAATCCCAGCAATTTGGGAGGCCAAGGTGGGTAGATCACCTGAGATTAGGAGTTGGAGACCAGCCTGGCCAATATGGTGAAA CCCCGTCTCTACCAAAAAAACAAAAATTAGCTGAGCCTGGTCATGCATGCCTGGAATCCCAACAACTCGGGAGGCTGAGGCAGGAGAA

[0869] SEQ ID NO: 111: Fragment 4 - Construction Primer 3

[0870] CACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTTATCGATAGATCTAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTT

[0871] SEQ ID NO: 112: Fragment 4 - Construction Primer 4

[0872] CCAGGAAGCTGTAGAGCTGTTCCTGGTTGCGACGCAGGTGGGCTGTACCTGGGGACTGTTAAGCATGGAGTTGGGTACCCCTCGAGGGGATCTGCCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCG

[0873] SEQ ID NO: 113: Fragment 4 - Construction Primer 5

[0874] GCAACCAGGAACAGCTCTACAGCTTCCTGGAGCGCCACTCGCCCTACTTCCGCAGCCACAGTGCGCAGATTAGGAGCGCCACTTCTTTTTGTCACTTGAAAAACATGTAAAAATAATGTACTAGGAGACACTTTCAATAAAGGCAAATGTTTTTATTTGTACACTCTCGGG

[0875] SEQ ID NO: 114: Fragment 4 - Construction Primer 6

[0876] TACTGGTTGGAAGAAAGACCTCTATCACCTGCGATCCACCAGTATCGCAACGTGTCCCTGCCAGTGGCGCATAGCGATGCGCGGCAGAACCCCTTTGATTTTTAAACGGCGCAGACGGCAAGGGTGGGGGGTAAATAATCACCCGAGAGTGTACAAATAAAAACATTTGCC

[0877] SEQ ID NO: 115: fragment 22-construction primer 1

[0878] TAGAGGCAAGGGTGTTTTTATTGACTAGAAGACGACTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCA

[0879] SEQ ID NO: 116: fragment 22-construction primer 2

[0880] AGACCTCCCACCGTACACGCCTACCGCCCATTTGCGTCAATGGGGCGGAGTTGTTACGACATTTTGGAAAGTCCCGTTGATTTTGGTGCCAAAACAAACTCCCATTGACGTCAATGGGGTGGAGACTTGGAAATCCCCGTGAGTCAAACCGCTATCCACGCCCATTGAT

[0881] SEQ ID NO: 117: fragment 22-construction primer 3

[0882] TGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGGATCCTGCCATTGCATCCTTCTCTGCAGACTAAGATGGAGTTCCTGAACCAAGACCGCTTGCTGGCCAACCTGTGAAACTGGGCTCAAGGTGAGGGGTGCTATCTGTGA

[0883] SEQ ID NO: 118: fragment 22-construction primer 4

[0884] TCGGGGCCACAGCAGCTGAAGGCCCTTCCATAGGCTGTGGCTGGAGAAGGCGTGTTCCTCTGTTTGGGGTGGTGATAAGTAGGCCAAGGTGACGGGTGCGATTTCTGTGTGAGACAATTCCATTAACCATGTCCCTCAATCACAGATAGCACCCCTCACCTTGAGCCCA

[0885] SEQ ID NO: 119: fragment 22-construction primer 5

[0886] TGGAAGGGCCTTCAGCTGCTGTGGCCCCGAGGTAAGCTTGGGGGAGGCTAACTGAAACACGGAAGGAGACAATACCGGAAGGAACCCGCGCTATGACGGCAATAAAAAGACAGAATAAAACGCACGGTGTTGGGTCGTTGTAGATAAGTAGCATGGCGGGTTAATCATT

[0887] SEQ ID NO: 120: fragment 22-construction primer 6

[0888] TACTGGTTGGAAGAAAGACCTCTATGAAGACTCGCAAAACACTCACGTGACCTCTAATACAGGACCTCCCTAACCCTATGACGTAATTCACGTCACGACTCCACCCCTCCGCCCGCTGTTTAAACCCCGGGCTGTAGTTAATGATTAACCCGCCATGCTACTTATCTAC

[0889] SEQ ID NO: 121: fragment 23-construction primer 1

[0890] TAGAGGCAAGGGGTTGTTTTTATTGACTACACCTGCGATCTTGCGACATTTTGCGACACCATGTGGTCTCGCTGGGGGGGGGGGCCCGAGTGAGCACGCAGGGTCTCCATTTTGAAGCGGGAGGTTTGAACGAGCGCTGGCGCGCTCCGTCGACGAGCTTTAATGCGGTAGT

[0891] SEQ ID NO: 122: fragment 23-construction primer 2

[0892] ATCCCGCAAGAGGCCCGGCAGTACCGGCATAACCAAGCCTATGCCTACAGCATCCAGGGTGACGGTGCCGAGGATGACGATGAGCGCATTGTTAGATTTCATACACGGTGCCTGACTGCGTTAGCAATTTAACTGTGATAAACTACCGCATTAAAGCTCGTCGACGGAGCG

[0893] SEQ ID NO: 123: fragment 23-construction primer 3

[0894] ATGCCGGTACTGCCGGGCCTCTTGCGGGATATCGTCCATTCCGACAGCATCGCCAGTCACTATGGCGTGCTGCTAGCGCTATATGCGTTGATGCAATTTCTATGCGCACCCGTTCTCGGAGCACTGTCCGACCGCTTTGGCCGCCGCCCAGTCCTGCTCGCTTCGCTACT

[0895] SEQ ID NO: 124: fragment 23-construction primer 4

[0896] TCTTCCCCATCGGTGATGTCGGCGATATAGGCGCCAGCAACCGCACCTGTGGCGCCGGTGATGCCGGCCACGATGCGTCCGGCGTAGAGGATCCACAGGACGGGTGTGGTCGCCATGATCGCGTAGTCGATAGTGGCTCCAAGTAGCGAAGCGAGCAGGACTGGGCGGCGG

[0897] SEQ ID NO: 125: fragment 23-construction primer 5

[0898] CTATATCGCCGACATCACCGATGGGGAAGATCGGGCTCGCCACTTCGGGCTCATGAGCGCTTGTTTCGGCGTGGGTATGGTGGCAGGCCCCGTGGCCGGGGGACTGTTGGGCGCCATCTCCTTGCATGCACCATTCCTTGCGGCGGCGGTGCTCAACGGCCTCAACCTACT

[0899] SEQ ID NO: 126: fragment 23-construction primer 6

[0900] TACTGGTTGGAAGAAAGACCTCTATCACCTGCGATCGTCATGCCCCGCGCCCACCGGAAGGAGCTGACTGGGTTGAAGGCTCTCAAGGGCATCGGTCGACGCTCTCCCTTATGCGACTCCTGCATTAGGAAGCAGCCCAGTAGTAGGTTGAGGCCGTTGAGCACCGCCGCC

[0901] SEQ ID NO: 127: fragment 28-construction primer 1

[0902] TAGAGGCAAGGGTTGTTTTTATTGACTAGAAGACGATAGCAGACTATGAAAAATCTAAAAAAGGTAGATTAAACCCAATACGTGACCGAGCCTTATATATGGTAAATGGTCTTGTAATGAATAGAGCTTCTTCCCAAAGTGAACATGCTACTTATAAACTAAACCAATAT

[0903] SEQ ID NO: 128: fragment 28-construction primer 2

[0904] GAGCTCTTCAAGCTTGCGGCCGCTTAAGTGGTGGGTAGTTGACCTTCGGTTTGTTCTTCTCTTCTCCAACCAATTATAGAACGGTACTCTTGATCTTTGTTGCTCCTGTTGTTGTTTTTCCTGTTCCTTCTGTTTTTTATATTGGTTTAGTTTATAAGTAGCATGTTC

[0905] SEQ ID NO: 129: fragment 28-construction primer 3

[0906] CACTTAAGCGGCCGCAAGCTTGAAGAGCTCTTCTTTCAGAACGCTCGGTTGCCGCCGGGCGTTTTTTATGAGACGTCTCGGCCTGTTTGGCCATTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCG

[0907] SEQ ID NO: 130: fragment 28-construction primer 4

[0908] CCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATATGGTGCACTCT

[0909] SEQ ID NO: 131: fragment 28-construction primer 5

[0910] GGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGC

[0911] SEQ ID NO: 132: fragment 28-construction primer 6

[0912] TACTGGTTGGAAGAAAGACCTCTATGAAGACTCGAGAAAGCGGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGT

[0913] SEQ ID NO: 133: fragment 30-construction primer 1

[0914] TAGAGGCAAGGGGTTGTTTTTATTGACTAGAAGACGACGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTGCAGGCATCGT

[0915] SEQ ID NO: 134: fragment 30-construction primer 2

[0916] CGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGCAGCAATGGCAACAACGT

[0917] SEQ ID NO: 135: fragment 30-construction primer 3

[0918] CCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCT

[0919] SEQ ID NO: 136: fragment 30-construction primer 4

[0920] GCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTAT

[0921] SEQ ID NO: 137: fragment 30-construction primer 5

[0922] GATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTAT

[0923] SEQ ID NO: 138: fragment 30-construction primer 6

[0924] TACTGGTTGGAAGAAAGACCTCTATGAAGACTCTTTTCGGGGAAATGTGGCGATCGCCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGT

[0925] Serial No. 139: Fragment 1-F

[0926] TAGCACCTGCGATCAAAAGTGCCACCTGACGTCTAA

[0927] Serial No. 140: Fragment 5-F

[0928] TAGGAAGACGAGGTGTTTAGTGCTCCACTTAAACT

[0929] Serial No. 141: Fragment 6-F

[0930] TAGCACCTGCGATCCATCATCGTCACAAAGGTCTTGTT

[0931] Serial No. 142: Fragment 7-F

[0932] TAGCACCTGCGATCCCTAACCGCCCCCTTT

[0933] Serial No. 143: Fragment 8-F

[0934] TAGGAAGACGACCAAGGTTATGAGCACAGTCAT

[0935] Serial No. 144: Fragment 9-F

[0936] TAGCACCTGCGATCCTTCTGCAGCTAGCCAACTA

[0937] Serial No. 145: Fragment 10-F

[0938] TAGCACCTGCGATCGACCCAACCGTAGATGG

[0939] Serial No. 146: Fragment 11-F

[0940] TAGGAAGACGACTACATGAGCGCGGGA

[0941] Serial No. 147: Fragment 12-F

[0942] TAGGAAGACGACCTGATGTGTTTACCGAGTCTTA

[0943] Serial No. 148: Fragment 13-F

[0944] TAGCACCTGCGATCGTCCACTTGGACGTGAG

[0945] Serial No. 149: Fragment 14-F

[0946] TAGGAAGACGATACGAGTCCTGGGCTCT

[0947] Serial No. 150: Fragment 15-F

[0948] TAGGAAGACGAGCAGGTTGAATACTAGGGTTCT

[0949] Serial No. 151: Fragment 16-F

[0950] TAGGAAGACGAGAACCCCGGTCGTC

[0951] Serial No. 152: Fragment 17-F

[0952] TAGCACCTGCGATCGGAGGCGGGAACAAG

[0953] Serial No. 153: Fragment 18-F

[0954] TAGGAAGACGACCTCGGCCCAGATAGA

[0955] Serial No. 154: Fragment 19-F

[0956] TAGCACCTGCGATCCAGCAGGGGTCTTGTG

[0957] Serial No. 155: Fragment 20-F

[0958] TAGCACCTGCGATCCGACCCAAGAGACTCAACTT

[0959] Serial No. 156: Fragment 21-F

[0960] TAGGAAGACGAGTGGCTACGGAGCAGTAT

[0961] Serial No. 157: Fragment 24-F

[0962] TAGGAAGACGATGACTAGATCCACCTGCAC

[0963] Serial No. 158: Fragment 25-F

[0964] TAGCACCTGCGATCGCTCGTTTTATTCAAGGGGCT

[0965] Serial No. 159: Fragment 26-F

[0966] TAGGAAGACGAGCTTGAAACAGCAGGAAGCT

[0967] Serial No. 160: Fragment 27-F

[0968] TAGCACCTGCGATCGGTAGATAGAGAAGATGAACTCC

[0969] Serial No. 161: Fragment 29-F

[0970] TAGCACCTGCGATCTCTCCCTTCGGGAAGC

[0971] Serial No. 162: Fragment 1-R

[0972] TAGCACCTGCGATCCGTCAATGGGGCGGA

[0973] Serial No. 163: Fragment 5-R

[0974] TAGGAAGACTCGATGGGGCGATTCCTG

[0975] Serial No. 164: Fragment 6-R

[0976] TAGCACCTGCGATCTAGGCTGTCCTCCTTCTC

[0977] Serial No. 165: Fragment 7-R

[0978] TAGCACCTGCGATCTTGGGGGGTAGGTTAAGTG

[0979] Serial No. 166: Fragment 8-R

[0980] TAGGAAGACTCGAAGGTAGCAGTGACCC

[0981] Serial No. 167: Fragment 9-R

[0982] TAGCACCTGCGATCGGTCGGCGAACAGG

[0983] Serial No. 168: Fragment 10-R

[0984] TAGCACCTGCGATCGTAGTTTATTCGGGTTGAGTAGTCTT

[0985] Serial No. 169: Fragment 11-R

[0986] TAGGAAGACTCCAGGTTGGTTAACATCGGTCA

[0987] Serial No. 170: Fragment 12-R

[0988] TAGGAAGACTCGGACGTAAAGGCTAAACCCTT

[0989] Serial No. 171: Fragment 13-R

[0990] TAGCACCTGCGATCCGTAACCATGGATCATCATGCT

[0991] Serial No. 172: Fragment 14-R

[0992] TAGGAAGACTCCTGCCACCTCCCTC

[0993] Serial No. 173: Fragment 15-R

[0994] TAGGAAGACTCGTTCGAACCCCGGATC

[0995] Serial No. 174: Fragment 16-R

[0996] TAGGAAGACTCCTCCGGCGCCATTTCT

[0997] Serial No. 175: Fragment 17-R

[0998] TAGCACCTGCGATCGAGGACTTGCATTTCTGGTC

[0999] Serial No. 176: Fragment 18-R

[1000] TAGGAAGACTCGCTGTCGTCCTTATGCC

[1001] Serial No. 177: Fragment 19-R

[1002] TAGCACCTGCGATCGTCGGAATCCCCAGTTGTT

[1003] Serial No. 178: Fragment 20-R

[1004] TAGCACCTGCGATCCCACGGGATTGGTTGTC

[1005] Serial No. 179: Fragment 21-R

[1006] TAGGAAGACTCCCAGGCGGGCCATT

[1007] Serial No. 180: Fragment 24-R

[1008] TAGGAAGACTCGAGCCATAATAAGTAAGGAAAGAAAGAATG

[1009] Serial No. 181: Fragment 25-R

[1010] TAGCACCTGCGATCAAGCTACTTGAAACAATTGTTGATATAACTGTTTTG

[1011] Serial No. 182: Fragment 26-R

[1012] TAGGAAGACTCTACCCAAGTATGGAACCTCAAC

[1013] Serial No. 183: Fragment 27-R

[1014] TAGCACCTGCGATCGCTATTTTTTTATCATTTTACTGATTTCGTGCGT

[1015] Serial No. 184: Fragment 29-R

[1016] TAGCACCTGCGATCCTCGGCCCTTCCG

[1017] SEQ ID NO: 185: Primer 1 for CMV promoter

[1018] CATCAATGGGCGTGGATAGC

[1019] SEQ ID NO: 186: Primer 2 for CMV promoter

[1020] GGAGTTGTTACGACATTTTGGAAA

[1021] SEQ ID NO: 187: Primer 1 for EGFP-WPRE fragment

[1022] GAGCTGGTTTAGTGGATATC

[1023] SEQ ID NO: 188: Primer 2 for EGFP-WPRE fragment

[1024] CAGGGATGCCACCCGTTTAATTA

Claims

1. A method for producing a viral-derived plasmid comprising: i) a step of obtaining a viral-derived constitutive plasmid from a first microbial host cell, wherein the viral-derived constitutive plasmid comprises at least one of the nucleic acid sequences necessary for constituting a viral-derived construct; and ii) A step of introducing the virus-derived constituent plasmid into a second microbial host cell and placing the second microbial host cell under conditions where the virus-derived constituent plasmid is amplified.

2. A method for producing a construct derived from a virus, comprising: i) a step of obtaining a viral-derived constituent plasmid from a first microbial host cell, wherein the viral-derived constituent plasmid comprises at least one of the nucleic acid sequences necessary for constituting a viral-derived construct; ii) a step of introducing the virus-derived constituent plasmid into a second microbial host cell, and placing the second microbial host cell under conditions where the virus-derived constituent plasmid is amplified; and iii) A step of introducing an introduction plasmid based on the virus-derived construct plasmid into production cells to form a virus-derived construct.

3. The method of claim 2, wherein: Between step ii) and step iii), a step of cloning a nucleic acid to prepare the introduction plasmid is included, wherein the nucleic acid includes at least one of the nucleic acid sequences necessary for constituting the virus-derived construct in the virus-derived construct plasmid.

4. The method of claim 2, wherein: The production cells are animal cells.

5. The method of claim 2, wherein: The production cells are human embryonic kidney cells, providing 4×10 3 The above viral vector genome copy number.

6. The method of claim 1, wherein: Step i) comprises obtaining the virus-derived construct plasmid from a plurality of nucleic acid fragments comprising at least two nucleic acid fragments, wherein the at least two nucleic acid fragments comprise a vector partial nucleic acid sequence other than a nucleic acid sequence necessary for constituting the virus-derived construct.

7. The method of claim 6, wherein: The partial nucleic acid sequence of the vector comprises a nucleic acid sequence or a multiple cloning site having at least one function of nucleic acid replication, drug resistance, copy number adjustment, and stability improvement.

8. The method of claim 6, wherein: Prior to step i), the method comprises the step of preparing at least two of the plurality of nucleic acid fragments by chemical synthesis or enzyme reaction.

9. The method of claim 6, wherein: Prior to step i), the process includes preparing all of the plurality of nucleic acid fragments by chemical synthesis or enzyme reaction.

10. The method of claim 1, wherein: The nucleic acid sequences necessary for constituting the virus-derived construct include: (A) a nucleic acid sequence containing a terminal repeat sequence; (B) a nucleic acid sequence encoding a packaging factor; (C) a nucleic acid sequence encoding a structural protein; and (D) Nucleic acid sequences encoding functional accessory factors.

11. The method of claim 10, wherein: The introduced plasmid contains the nucleic acid sequences (A) to (D).

12. The method according to any one of claims 1 to 11, wherein: The first microbial host cell is Bacillus subtilis.

13. The method according to any one of claims 1 to 11, wherein: The second microbial host cell is Escherichia coli.

14. The method of claim 1, wherein: The step i) comprises forming the virus-derived constituent plasmid from nucleic acid fragments.

15. The method of claim 14, wherein: The nucleic acid fragment is a non-circular nucleic acid fragment having a tandemly repeated nucleic acid sequence.

16. The method according to any one of claims 1 to 11, wherein: The step i) comprises contacting the competent first microbial host cell with a nucleic acid comprising at least one of the nucleic acid sequences necessary for constituting a construct derived from a virus.

17. A viral-derived plasmid prepared by the method of claim 1.

18. A construct derived from a virus, prepared by the method of claim 2.

19. A composition containing a virus-derived construct, prepared by the method according to claim 2.

20. A plasmid operably linked to contain at least a portion of a nucleic acid sequence necessary for constituting a construct derived from a virus, The nucleic acid sequences necessary for constituting the virus-derived construct include: (A) a nucleic acid sequence containing a terminal repeat sequence; (B) a nucleic acid sequence encoding a packaging factor; (C) a nucleic acid sequence encoding a structural protein; and (D) a nucleic acid sequence encoding a functional auxiliary factor, The plasmid contains at least two of the nucleic acid sequences (A) to (D).

21. The plasmid according to claim 20, which is operably linked to contain the nucleic acid sequences of (A) to (D).

22. The plasmid of claim 20, wherein The nucleic acid sequence containing the terminal repeat sequence of (A) contains the desired gene.

23. The plasmid of claim 20, wherein The viral-derived construct is a viral-derived construct originating from an adeno-associated virus or a retrovirus.

24. The plasmid of claim 20, wherein The viral construct is a viral vector originating from an adeno-associated virus.

25. The plasmid of claim 24, wherein (A) The nucleic acid sequence containing a terminal repeat sequence comprises two inverted terminal repeat sequences (ITRs), (B) The nucleic acid sequence encoding the packaging factor comprises rep, (C) The nucleic acid sequence encoding the structural protein comprises cap, The nucleic acid sequence encoding the functional auxiliary factor of (D) comprises at least one of E1A, E1B, E2A, E2B, E3, E4 and VA.

26. The plasmid of claim 24, wherein At least one of the two ITRs is derived from any one of adeno-associated virus serotypes 1 to 12 and modified forms thereof.

27. The plasmid of claim 24, wherein The nucleic acid sequence of (B) comprises a rep derived from any one of adeno-associated virus serotypes 1 to 12 and their modified forms.

28. The plasmid of claim 24, wherein The nucleic acid sequence of (B) comprises a promoter different from the promoter of adeno-associated virus and at least one of rep78, rep76, rep52 and rep40 downstream thereof.

29. The plasmid of claim 28, wherein The promoter is a drug-responsive promoter.

30. The plasmid of claim 24, wherein The terminal repeat sequence of (A) and the nucleic acid sequence of (B) include nucleic acid sequences derived from different serotypes of adeno-associated viruses.

31. The plasmid of claim 24, wherein The nucleic acid sequence of (C) comprises a cap derived from any one of adeno-associated virus serotypes 1 to 12 and modified forms thereof.

32. The plasmid of claim 24, wherein The nucleic acid sequence of (C) includes a promoter different from the promoter of adeno-associated virus and at least one of VP1, VP2 and VP3 downstream thereof.

33. The plasmid of claim 24, wherein The nucleic acid sequence of (D) comprises a nucleic acid sequence encoding a functional auxiliary factor derived from any one of adenovirus, herpes virus, bocavirus, and modified forms thereof.

34. The plasmid of claim 24, wherein The nucleic acid sequence of (D) includes a nucleic acid sequence derived from any one of adenovirus serotypes 1 to 52 and modified forms thereof.

35. The plasmid of claim 24, wherein The nucleic acid sequence of (D) comprises a promoter different from the promoter of adeno-associated virus and at least one of E1A, E1B, E2A, E2B, E3 and E4 downstream thereof.

36. The plasmid of claim 35, wherein The promoter is a drug-responsive promoter.

37. The plasmid of claim 24, wherein The nucleic acid sequence containing the terminal repeat sequence of (A) includes, from the upstream, 5' ITR, a promoter, a desired gene, a terminator, and 3' ITR.

38. The plasmid of claim 20, wherein The viral construct is a viral vector originating from a retrovirus.

39. The plasmid of claim 38, wherein The nucleic acid sequence containing terminal repeats of (A) comprises two long terminal repeats (LTRs), (B) The nucleic acid sequence encoding the packaging factor comprises ψ, (C) the nucleic acid sequence encoding the structural protein comprises at least one of gag, pol, VSV-G and env, (D) The nucleic acid sequence encoding the functional auxiliary factor comprises Rev.

40. The plasmid according to claim 38, which comprises a drug-responsive promoter upstream of at least one of the nucleic acid sequences of (C) to (D).

41. The plasmid of claim 38, wherein The nucleic acid sequence containing the terminal repeat sequence of (A) includes 5'LTR, a promoter, a desired gene, a terminator, and 3'LTR from the upstream.

42. The plasmid of claim 31, wherein The nucleic acid sequence of (B) exists within the nucleic acid sequence of (A), and the nucleic acid sequences of (C) and (D) exist outside the nucleic acid sequence of (A).

43. The plasmid of claim 20, which is operably linked to contain 8 or more genes encoded by the nucleic acid sequences of (A) to (D).

44. The plasmid of claim 20, wherein A drug selection marker nucleic acid sequence is included between any two genes encoded by the nucleic acid sequences of (A) to (D).

45. The plasmid according to any one of claims 20 to 44, wherein The nucleic acid sequence necessary for constituting the virus-derived construct is about 10 kb or more.

46. ​​The plasmid according to any one of claims 20 to 44, wherein The desired number of genes is 2 to 100 genes.

47. A plasmid as claimed in any one of claims 20 to 44, operably linked to comprise: A nucleic acid sequence that promotes replication of the plasmid in a first microbial host cell; and A nucleic acid sequence that promotes replication of the plasmid in a second microbial host cell.

48. The plasmid of claim 47, wherein The first microbial host cell is Bacillus subtilis.

49. The plasmid of claim 47, wherein The second microbial host cell is Escherichia coli.

50. The plasmid according to any one of claims 20 to 44, which, when introduced into human embryonic kidney cells as producer cells, provides 4×10 3 The above viral vector genome copy number.

51. The plasmid according to any one of claims 20 to 44, which, when introduced into human embryonic kidney cells as producer cells, provides 1×10 4 The above viral vector genome copy number.

52. The plasmid according to any one of claims 20 to 44, which, when introduced into human embryonic kidney cells as production cells, provides a viral vector having a viral vector particle number (VP / VG) of 15 or less relative to the viral vector genome copy number.

53. The plasmid according to any one of claims 20 to 44, which, when introduced into human embryonic kidney cells as production cells, provides a viral vector having a viral vector particle number (VP / VG) of 10 or less relative to the viral vector genome copy number.

54. The plasmid according to any one of claims 20 to 44, wherein The plasmid and the production cell together contain the nucleic acid sequences necessary for constructing the virus-derived construct.

55. The plasmid according to any one of claims 20 to 44, which has a CCC (covalently closed circular) purity of 80% or more.

56. The plasmid according to any one of claims 20 to 44, comprising at least two nucleic acid fragments produced by chemical synthesis or enzymatic reaction and containing a vector partial nucleic acid sequence in the nucleic acid fragment.

57. The plasmid according to any one of claims 20 to 44, which is obtained by merely circularizing a plurality of nucleic acid fragments produced by chemical synthesis or enzymatic reaction.

58. The plasmid of claim 56 or 57, wherein The nucleic acid fragments contain more than 3 nucleic acid fragments.

59. The plasmid according to any one of claims 56 to 58, wherein The nucleic acid fragments each have a length of 2 kb or less.

60. The plasmid according to any one of claims 56 to 59, wherein The vector partial nucleic acid sequence accounts for less than 40% of the entire sequence of the viral-derived constituent plasmid.

61. The plasmid according to any one of claims 56 to 60, wherein The partial nucleic acid sequence of the vector contains a nucleic acid sequence having at least one of the functions of nucleic acid replication, drug resistance, copy number adjustment, and stability improvement. The viral-derived construct contains restriction endonuclease recognition sequences upstream and downstream of the partial nucleic acid sequence of the vector, and the sequence identical to the restriction endonuclease recognition sequence is not included in the nucleic acid sequence necessary for the viral-derived construct.

62. A microbial host cell comprising the plasmid of any one of claims 20 to 61.

63. A composition for preparing a virus-derived construct, comprising the plasmid according to any one of claims 20 to 61.

64. A method for producing a viral vector, comprising the step of introducing the plasmid according to any one of claims 20 to 61 into a production cell to form a virus-derived construct.

65. The method of claim 64, wherein: At least a portion of the nucleic acid contained in the plasmid is integrated into the chromosome of the producer cell.

66. A virus-derived construct produced using the method of claim 64.

67. A composition comprising a construct derived from a virus produced by the method of claim 64.

68. The composition containing a virus-derived construct according to claim 67, wherein The number of viral vector particles relative to the number of viral vector genome copies (VP / VG) is 15 or less.

69. A production cell, which is a production cell into which the plasmid according to any one of claims 20 to 61 has been introduced, wherein at least a part of the nucleic acid contained in the plasmid is integrated into the chromosome of the production cell.

Images