Application of ribose-5 phosphate in preparation of medicine for treating inflammatory diseases

Abstract

The invention belongs to the technical field of biological medicines, and particularly discloses application of ribose-5-phosphate in preparation of a medicine for treating inflammatory diseases, and the inflammatory diseases are osteoarthritis. The invention proves that the ribose-5 phosphate can obviously increase the activity of SW1353 cells, inhibit the transcriptional expression of SW1353 cell inflammatory factors IL-6 and IL-8, inhibit the protein expression of SW1353 cell inflammatory factors IL-6 and I-8, inhibit the transcription and protein expression of SW1353 matrix metalloproteinase 13 and treat osteoarthritis, so that the ribose-5 phosphate has the potential of preparing anti-inflammatory drugs.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine, and in particular relates to an application of ribose-5-phosphate in the preparation of a drug for treating inflammatory diseases. Background Art

[0002] Osteoarthritis (OA) is a common chronic inflammatory disease of the bones and joints that often leads to a significant decline in patients' limb function, quality of life, and exercise level. OA is one of the main causes of disability in the elderly. Currently, there is a lack of recognized drugs to improve the condition of OA. Clinical treatment mainly focuses on alleviating clinical symptoms and relieving pain in patients. Joint replacement is still the only effective treatment for patients with end-stage OA. However, the pathogenesis of OA is complex and research is extremely challenging, making it a key area of ​​research for researchers.

[0003] The main pathological changes of OA include articular cartilage degeneration, synovial inflammation and abnormal bone remodeling. At present, the pathological process and mechanism of OA have not been fully elucidated. It is generally accepted that the occurrence and development of OA are closely related to the degeneration of articular cartilage, chondrocyte apoptosis and degradation of extracellular matrix caused by inflammation and immune factors. As a physiological structure for bone-to-bone contact, cartilage plays the role of load-bearing, stress transduction, and bony structure buffering. Because of its important physiological position and function, cartilage damage and degeneration are the main reasons for the weakening or loss of joint function, and are also the core pathological characteristics of the occurrence and development of OA. Unlike most tissues, articular cartilage has no blood vessels, nerves and lymphatic vessels, and is mainly composed of extracellular matrix (ECM) and chondrocytes. As the only cell type present in articular cartilage, chondrocytes have the main function of regulating the extracellular matrix through their own synthesis and catabolism, thereby maintaining the homeostasis of cartilage. Therefore, the function and fate of chondrocytes determine the health of cartilage.

[0004] When OA occurs, chondrocyte metabolism is disordered, and a series of inflammatory factors and matrix metalloproteinases, such as IL-1β, IL-8 and MMPs, are expressed and secreted. These damaging factors are directly involved in the process of articular cartilage degeneration. SW1353 cells have a good cartilage phenotype and are suitable for the study of chondrocyte structure and function. IL-1β can cause a variety of pathological changes in chondrocyte inflammatory factors and matrix metalloproteinases, oxidative stress and cell apoptosis, and is widely used as an inflammatory stimulus to construct OA chondrocyte models. Therefore, studying the changes in the structure and function of SW1353 cells under IL-1β stimulation and reducing the expression of inflammatory factors and matrix metalloproteinases may reverse or delay OA cartilage degeneration.

[0005] Ribose-5-phosphate (Ribose-5p, R-5p) is one of the products of the oxidation reaction stage of the pentose phosphate pathway. It reacts with ATP under the catalysis of a specific ribose phosphate pyrophosphokinase to generate 5-phosphoribosyl pyrophosphate, which is used for the de novo synthesis of nucleotides. It is necessary to develop the use of ribose-5-phosphate to prepare OA drugs. Summary of the invention

[0006] In order to solve the above technical problems, the present invention provides an application of R-5p in the preparation of a drug for treating inflammatory diseases. The research of the present invention found that R-5p can treat OA.

[0007] The purpose of the present invention is to provide an application of R-5p in preparing a drug for treating inflammatory diseases, wherein the inflammatory disease is osteoarthritis.

[0008] Preferably, the above R-5p is used in the preparation of a drug for treating inflammatory diseases, wherein the drug for treating inflammatory diseases contains R-5p as the only active ingredient.

[0009] It should be noted that although the experiment of the present invention uses R-5p as the only active ingredient, in actual application, R-5p can also be compounded with other anti-inflammatory drugs. For example, R-5p can be compounded with drugs for treating osteoarthritis such as aspirin, and can also be compounded with drugs such as acetaminophen.

[0010] Preferably, the above R-5p is used in the preparation of a drug for treating inflammatory diseases, wherein the drug for treating inflammatory diseases is an injection or an oral preparation.

[0011] Preferably, in the use of the above R-5p in the preparation of a drug for treating inflammatory diseases, the injection is an aqueous solution of ribose-5-phosphate or a physiological saline solution of ribose-5-phosphate.

[0012] Preferably, in the use of the above R-5p in the preparation of a drug for treating inflammatory diseases, the oral preparation is an ointment, a powder, an aqueous solution or an enteric-coated sustained-release preparation.

[0013] Preferably, the auxiliary materials used in the powder are starch, dextrin, sucrose and / or microcrystalline cellulose.

[0014] The excipients used in ointments are oils, surfactants and / or emulsifiers.

[0015] The enteric-coated sustained-release preparation is a capsule or a tablet containing a skeleton-type sustained-release material. In addition to R-5p, the enteric-coated sustained-release preparation may also be formulated with one or more pharmaceutically acceptable excipients selected from starch, dextrin, sucrose, microcrystalline cellulose, povidone, methylcellulose, hydroxypropyl methylcellulose, hydroxyethyl cellulose, xanthan gum, chitosan and sodium alginate.

[0016] Preferably, in the use of the above R-5p in the preparation of a drug for treating inflammatory diseases, the aqueous solution is an aqueous solution of ribose-5-phosphate and the solvent is deionized water.

[0017] It should be noted that in the specific forms of the above-mentioned drugs, there is no strict requirement for the mass percentage of the active ingredient R-5p in the drug. For example, each tablet of the drug contains 0.1 mg R-5p. In the actual treatment process, the dosage is calculated based on the effective content of R-5p.

[0018] Preferably, the above R-5p is used in the preparation of a drug for treating inflammatory diseases, and the ribose-5-phosphate is used to increase the cell viability of chondroma cells SW1353.

[0019] Preferably, the use of the above R-5p in the preparation of a drug for treating inflammatory diseases includes any one or more of the following:

[0020] (1) The ribose-5-phosphate is used to prepare an inhibitor of the transcriptional expression of inflammatory factors IL-6 and / or IL-8 in SW1353 cells;

[0021] (2) The ribose-5-phosphate is used to prepare a protein expression inhibitor of SW1353 cell inflammatory factors IL-6 and / or IL-8;

[0022] (3) The ribose-5-phosphate is used to prepare SW1353 matrix metalloproteinase 13 MMP13 inhibitor.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The present invention finds that R-5p has an inhibitory effect on the expression of inflammatory factors IL-6 and IL-8 in SW1353 cells; R-5p inhibits the expression of matrix metalloproteinase MMP13 in SW1353 cells when stimulated by IL-1β; inflammatory factors and matrix metalloproteinases are directly involved in the process of osteoarthritis cartilage degeneration, so R-5p can alleviate OA cartilage degeneration, R-5p has an application in preparing drugs for treating inflammatory diseases, and when the drug for treating inflammatory diseases uses ribose-5-phosphate as the only active ingredient, the therapeutic effect on OA is still obvious. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 CCK-8 was used to detect the effect of R-5p on the viability of SW1353 cells.

[0026] Figure 2 qPCR was used to detect the effect of R-5p on the transcriptional expression of IL-6 in SW1353 cells.

[0027] Figure 3qPCR was used to detect the effect of R-5p on the transcriptional expression of IL-8 in SW1353 cells.

[0028] Figure 4 ELISA was used to detect the effect of R-5p on the expression of IL-6 protein in SW1353 cells.

[0029] Figure 5 ELISA was used to detect the effect of R-5p on the expression of IL-8 protein in SW1353 cells.

[0030] Figure 6 qPCR was used to detect the effect of R-5p on the transcriptional expression of matrix metalloproteinase 13 in SW1353 cells.

[0031] Figure 7 ELISA was used to detect the effect of R-5p on the expression of matrix metalloproteinase 13 protein in SW1353 cells.

[0032] Figure 8 This is an animal experiment to detect the effect of R-5p on cartilage degeneration in rats with knee osteoarthritis.

[0033] Figure 8 In the figure, A is an introduction to the treatment time; B is a photo of the degree of injury of the rat knee articular cartilage surface, Control represents the control group, MIA represents the model group, R-5p (0.1 mg / mL) represents the first medication group, and R-5p (1 mg / mL) represents the second medication group. DETAILED DESCRIPTION

[0034] In order to enable those skilled in the art to better understand and implement the technical solution of the present invention, the present invention is further described below in conjunction with specific embodiments and drawings.

[0035] In the description of the present invention, unless otherwise specified, all reagents used are commercially available and all methods used are conventional techniques in the art.

[0036] In the examples and experiments of the present invention, R-5p was D-ribose-5-phosphate disodium salt hydrate, S26725-250 mg, purchased from Shanghai Yuanye Biotechnology Co., Ltd.

[0037] Example 1

[0038] Ribose-5-phosphate is used in the preparation of drugs for treating inflammatory diseases. Ribose-5-phosphate is D-ribose-5-phosphate disodium salt hydrate, and the drug has D-ribose-5-phosphate disodium salt hydrate as the only active ingredient.

[0039] In order to verify the efficacy of ribose-5-phosphate in treating osteoarthritis, the present invention conducted the following experiments.

[0040] Experiment 1: Effect of R-5p on the viability of chondroma cells SW1353

[0041] Prepare cells at a concentration of 5 × 10 4 The SW1353 cell fluid of cells / mL was plated in a 96-well plate, with a volume of 100 μL added to each well, and cultured at 37°C and 5% carbon dioxide for 36 h.

[0042] Then, a control group and a treatment group were set up. A new 100 μL DMEM medium containing 10% serum by volume was added to the blank group; 100 μL R-5p liquids of 2.5 mM, 5 mM, 10 mM, 20 mM, 30 mM and 40 mM were added to the treatment groups, respectively, wherein the preparation method of the R-5p liquid was: a certain mass of R-5p was dissolved in the DMEM medium to obtain an R-5p solution, and then serum was added to make the final volume concentration of the serum 10%, and the R-5p liquid of the corresponding concentration of the treatment group was obtained.

[0043] After the treatment, the control group and the treatment group were cultured at 37°C and 5% carbon dioxide for 24 h, and the viability of SW1353 cells was detected by CCK8.

[0044] The results are as follows Figure 1 As shown, it was found that when the concentration of R-5p liquid was lower than 30 mM, the OD 450 As the concentration of R-5p liquid increases, the cell viability increases. When the concentration of R-5p liquid is 40mM, the cell viability is lower than when 30mM is added, but it is still higher than the control group. This shows that R-5p can increase the cell viability of SW1353. There are significant differences between each treatment group and the control group, P < 0.05.

[0045] Experiment 2: R-5p inhibits the transcriptional expression of inflammatory factors IL-6 and IL-8 in SW1353 cells

[0046] In order to study the effect of R-5p on the transcriptional expression of inflammatory factors IL-6 and IL-8 in SW1353 cells, the cell concentration was 5 × 10 4 SW1353 cell fluid was added to each well of the 6-well plate at a volume of 2 mL. After 36 hours, it was replaced with a complete medium containing 1% serum by volume for serum starvation. After 24 hours of serum starvation, 20 mM and 30 mM R-5p solutions were added for pretreatment for 3 hours as the treatment group; control group 1 and control group 2 did not add R-5p solution, but were placed in the same environment as the treatment group for 3 hours. Then IL-1β was added to both control group 2 and the treatment group to make the final concentration of IL-1β 10 ng / mL. All groups were treated at 37°C and 5% carbon dioxide for 24 hours. The mRNA content of cytokines IL-6 and IL-8 was detected by qPCR.

[0047] The R-5p solution is prepared by combining R-5p and complete culture medium.

[0048] Among them, Trizol was used to extract the mRNA of IL-6 and IL-8 and reverse transcribed into cDNA.

[0049] The qPCR system was: 1 μL cDNA, 3.4 μL ddH2O, 5 μL 2×AceQ Universal SYBRqPCR Master Mix (Vazyme, Q511-02 / 03), 0.3 μL upstream primer and 0.3 μL downstream primer.

[0050] The primer sequences for IL-6 are as follows:

[0051] Upstream primer IL-6F: TACATCCTCGACGGCATCTCA, SEQ ID NO.1.

[0052] Downstream primer IL-6R: CACCAGGCAAGTCTCCTCATTG, SEQ ID NO.2.

[0053] The primer sequences for IL-8 are as follows:

[0054] Upstream primer IL-8F: TCTTGGCAGCCTTCCTGATT, SEQ ID NO.3.

[0055] Downstream primer IL-8R: TGGTCCACTCTCAATCACTCTCAGT, SEQ ID NO.4.

[0056] The primer sequences for the internal reference GAPDH are as follows:

[0057] Upstream primer GAPDH-F: TGCCTCAACGACCACTTTG, SEQ ID NO.5.

[0058] Downstream primer GAPDH-R: TACTCCTTGGAGGCCATGTG, SEQ ID NO.6.

[0059] The results are as follows Figure 2 and Figure 3 As shown, compared with the control group 2 in which only IL-1β was added, there was no difference in the mRNA content of IL-6 when the concentration of R-5p solution was 20 mM. When the concentration of R-5p solution was increased to 30 mM, the mRNA content of IL-6 was significantly reduced, P < 0.05 ( Figure 2). Similarly, when the concentration of R-5p solution was 20 mM, the mRNA content of IL-8 was no different from that of IL-1β alone. When the concentration of R-5p solution was increased to 30 mM, the mRNA content of IL-8 was significantly reduced, P < 0.05 ( Figure 3 ). This indicates that R-5p inhibits the transcriptional expression of inflammatory factors IL-6 and IL-8 in SW1353 cells.

[0060] Experiment 3: R-5p inhibits the protein expression of inflammatory factors IL-6 and IL-8 in SW1353 cells

[0061] In order to study the effect of R-5p on the protein expression of inflammatory factors IL-6 and IL-8 in SW1353 cells, the cell concentration was 6×10 4 SW1353 cell fluid of 500 μL / mL was plated in a 24-well plate, and the volume added to each well was 500 μL. After 36 hours, it was replaced with complete medium containing 1% serum by volume for serum starvation. After 24 hours of serum starvation, 20mM and 30mM R-5p solutions were added for pretreatment for 3 hours as treatment groups; control group 1 and control group 2 did not add R-5p solution, but were placed in the same environment as the treatment group for 3 hours. Then IL-1β was added to both control group 2 and the treatment group to make the final concentration of IL-1β 10 ng / mL. All groups were treated at 37°C and 5% carbon dioxide for 24 hours. Among them, R-5p solution was prepared by R-5p and complete medium. The content of IL-6 and IL-8 in the cell culture medium was detected by ELISA.

[0062] The results are as follows Figure 4 and Figure 5 As shown in the figure, compared with the control group 2 where only IL-1β was added, the IL-6 content gradually decreased with the increase in the concentration of R-5p solution, and there were significant differences between the two groups, P < 0.05 ( Figure 4 ). Similarly, IL-8 gradually decreased with the increase of R-5p concentration ( Figure 5 ), and there were significant differences compared with the control group 2, P < 0.05. This indicates that R-5p inhibits the protein expression of inflammatory factors IL-6 and IL-8 in SW1353 cells.

[0063] Experiment 4: R-5p inhibits the transcription and protein expression of matrix metalloproteinase 13MMP13 in SW1353

[0064] In order to study the effect of R-5p on the expression of matrix metalloproteinase 13 in SW1353 cells, qPCR and ELISA were used to detect the transcriptional expression and protein expression of matrix metalloproteinase 13 after the addition of R-5p. The cell concentration was 5×10 4 / mL of SW1353 cell fluid, the SW1353 cell fluid was plated in a 6-well plate, and the volume added to each well was 2mL. After 36 hours, it was replaced with a complete medium containing 1% serum by volume for serum starvation. After 24 hours of serum starvation, 20mM and 30mM R-5p solutions were added for pretreatment for 3 hours as the treatment group; control group 1 and control group 2 did not add R-5p solution, but were placed in the same environment as the treatment group for 3 hours. Then IL-1β was added to both control group 2 and the treatment group to make the final concentration of IL-1β 10ng / mL. All groups were treated at 37°C and 5% carbon dioxide for 24 hours. Among them, the R-5p solution was prepared by R-5p and complete medium. The MMP13 mRNA content was detected by qPCR.

[0065] The extraction method and qPCR method of MMP13 mRNA were based on Experiment 2, and the detection object was replaced by MMP13 mRNA.

[0066] The primers used to detect the MMP13 mRNA content were:

[0067] MMP13F:ATGCAGTCTTTCTTCGGCTTAG, SEQ ID NO.7.

[0068] MMP13R: ATGCCATCGTGAAGTCTGGT, SEQ ID NO. 8.

[0069] Meanwhile, prepare cells at a concentration of 6 × 10 4 SW1353 cell fluid of 500 μL was plated in a 24-well plate, and the volume added to each well was 500 μL. After 36 hours, it was replaced with complete medium containing 1% serum by volume for serum starvation. After 24 hours of serum starvation, 20 mM and 30 mM R-5p solutions were added for pretreatment for 3 hours as treatment groups; control group 1 and control group 2 did not add R-5p solution, but were placed in the same environment as the treatment group for 3 hours. Then IL-1β was added to both control group 2 and the treatment group to make the final concentration of IL-1β 10 ng / mL. All groups were treated at 37°C and 5% carbon dioxide for 24 hours. Among them, R-5p solution was prepared by R-5p and complete medium. The content of MMP13 in the cell culture medium was detected by ELISA.

[0070] The results are as follows Figure 6 and Figure 7 As shown in the figure, compared with the control group 2 where only IL-1β was added, the mRNA content of MMP13 gradually decreased with the increase of R-5p solution concentration after the addition of R-5p solution, and there were significant differences compared with the control group 2, P < 0.05 ( Figure 6). The content of MMP13 in the cell culture supernatant had no difference when the concentration of R-5p solution was 20mM, but decreased when the concentration increased to 30mM, and was significantly different from the control group 2, P < 0.05 ( Figure 7 ). This indicates that R-5p inhibits the transcription and protein expression of SW1353 matrix metalloproteinase 13.

[0071] Experiment 5: R-5p alleviates cartilage degeneration in rat knee osteoarthritis induced by iodoacetic acid

[0072] In order to study the effect of R-5p on OA cartilage degeneration in rats, male 6-week-old SD rats weighing 200±20g were fed adaptively for 3 days and randomly divided into 3 groups, including control group n=4, model group n=4, drug group 1 n=4, and drug group 2 n=4. Figure 8 Figure A: On the first day, the first group was injected with 0.1 mg / mL R-5p saline solution, 100 μL / mouse, into the right knee joint cavity; the second group was injected with 1 mg / mL R-5p saline solution, 100 μL / mouse, into the right knee joint cavity; the model group and the control group were given the same amount of saline. On the second day, the model group and the treatment group were injected with 20 mg / mL iodoacetic acid solution, 100 μL / mouse, respectively, to establish the knee osteoarthritis model, and the control group was injected with the same amount of saline (both treatment groups were injected with iodoacetic acid). On the third, fifth, seventh, ninth, eleventh and thirteenth days, the first group was injected with 0.1 mg / mL R-5p saline solution, 100 μL / mouse, the second group was injected with 1 mg / mL R-5p saline solution, 100 μL / mouse every day, and the control group and the model group (MIA) were injected with the same amount of saline. After the administration, the knee joints of the rats in the control group, model group, administration group 1 and administration group 2 were collected, dissected and the cartilage damage of the knee joints of the rats in each group was observed.

[0073] It should be noted that in Experiment 5, the physiological saline solution is a sodium chloride solution with a mass fraction of 0.9%.

[0074] The results showed that compared with the model group, the extent of articular cartilage damage in the rat knee was significantly reduced after the addition of R-5p saline solution ( Figure 8 This indicates that R-5p can alleviate cartilage degeneration in rat knee osteoarthritis induced by iodoacetic acid.

[0075] It should be noted that when the present invention involves a numerical range, it should be understood that the two endpoints of each numerical range and any value between the two endpoints can be selected. Since the steps and methods used are the same as those in the embodiments, in order to avoid redundancy, the present invention describes a preferred embodiment. Although the preferred embodiments of the present invention have been described, once those skilled in the art know the basic inventive concept, they can make other changes and modifications to these embodiments, and these changes and modifications all fall within the scope of the present invention.

[0076] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. If these modifications and variations of the present invention fall within the scope of the equivalent technology of the present invention, the present invention is also intended to include these modifications and variations.

Claims

1. A use of ribose-5-phosphate in the preparation of a drug for treating inflammatory diseases, characterized in that: The inflammatory disease is osteoarthritis.

2. The use of ribose-5-phosphate according to claim 1 in the preparation of a drug for treating inflammatory diseases, characterized in that: The drug for treating inflammatory diseases uses ribose-5-phosphate as the only active ingredient.

3. The use of ribose-5-phosphate according to claim 2 in the preparation of a drug for treating inflammatory diseases, characterized in that: The drug for treating inflammatory diseases is an injection or an oral agent.

4. The use of ribose-5-phosphate according to claim 3 in the preparation of a drug for treating inflammatory diseases, characterized in that: The injection is an aqueous solution of ribose-5-phosphate or a physiological saline solution of ribose-5-phosphate.

5. The use of ribose-5-phosphate according to claim 3 in the preparation of a drug for treating inflammatory diseases, characterized in that: The oral preparation is a paste, powder, aqueous solution or enteric-coated sustained-release preparation.

6. The use of ribose-5-phosphate according to claim 5 in preparing a drug for treating inflammatory diseases, characterized in that: The aqueous solution is an aqueous solution of ribose-5-phosphate.

7. The use of ribose-5-phosphate in the preparation of a drug for treating inflammatory diseases according to claim 3, characterized in that: The ribose-5-phosphate is used to increase the viability of chondroma cells SW1353.

8. The use of ribose-5-phosphate in the preparation of a drug for treating inflammatory diseases according to claim 1, characterized in that: The applications include any one or more of the following: (1) The ribose-5-phosphate is used to prepare an inhibitor of the transcriptional expression of inflammatory factors IL-6 and / or IL-8 in SW1353 cells; (2) The ribose-5-phosphate is used to prepare a protein expression inhibitor of SW1353 cell inflammatory factors IL-6 and / or IL-8; (3) The ribose-5-phosphate is used to prepare SW1353 matrix metalloproteinase 13 MMP13 inhibitor.

Images