Trichoderma and its application in degrading straw cellulose

Abstract

The application belongs to the technical field of microbial fermentation, and particularly relates to a Trichoderma sp. and application thereof in degrading straw cellulose. The Trichoderma sp. has a preservation number of CGMCC No. 40954. The enzyme liquid obtained by fermentation of the Trichoderma sp. has a high capacity of producing effective fiber-decomposing enzymes for decomposing crop straw or feed such as wheat bran, and is helpful to meet the demand of fiber-decomposing enzymes in the production of animal husbandry, and promote the effective utilization of fiber materials in the feed.

Description

Technical Field

[0001] This invention belongs to the field of microbial fermentation technology, specifically relating to a Trichoderma and its application in degrading straw cellulose. Background Technology

[0002] In animal husbandry, feed digestibility plays a crucial role in the growth and health of livestock and poultry. Although the rumen of ruminants contains various microorganisms capable of breaking down plant fibers, the complex fibrous structure of straw often limits the effective degradation by these microorganisms, resulting in a rumen digestibility that is typically less than 50%. This low digestibility not only wastes resources but also increases breeding costs.

[0003] To address this challenge, the livestock and feed industries have adopted various strategies to improve animal utilization efficiency of straw plant fiber, one of which is the use of cellulase preparations for pre-digestion of roughage. These enzyme preparations mainly include cellulase and hemicellulase, which act as adjuvants to promote the degradation of plant fiber and further assist the digestive tract in digesting feed after animal consumption. This helps improve feed digestibility and utilization, thus producing a positive impact. However, the application of cellulase and hemicellulase in livestock farming still faces some challenges, including enzyme activity, stability, substrate specificity, and production and application costs. In particular, whether the selected cellulase can effectively degrade straw is a key factor worthy of in-depth consideration. Therefore, these factors need to be comprehensively considered to ensure that the application of enzyme preparations achieves the expected results and brings practical economic and environmental benefits to livestock farming.

[0004] Trichoderma is a ubiquitous fungus in the natural environment with a significant ability to degrade fibrous materials, thus being considered an ideal strain for producing highly efficient cellulase. Although several strains capable of producing cellulase have been discovered, these strains still have some limitations in terms of production efficiency, stability, and operating conditions. Therefore, the search for a novel Trichoderma strain that can not only produce cellulase efficiently but also exhibit superior performance in livestock applications, possessing extremely high scientific research and practical application value. Summary of the Invention

[0005] This invention provides a novel Trichoderma strain, named zt06, which possesses the ability to efficiently decompose fiber-degrading enzymes in feeds such as crop straw and wheat bran. The research and application of this strain will help meet the demand for fiber-degrading enzymes in livestock production and promote the effective utilization of fiber in feed.

[0006] To achieve the above objectives, the present invention can adopt the following technical solutions:

[0007] In one aspect, this invention provides a Trichoderma sp., with accession number CGMCC No. 40954.

[0008] Another aspect of the present invention provides an enzyme solution obtained by fermentation of Trichoderma according to the present invention.

[0009] Another aspect of the present invention provides a straw cellulose degradation system, which includes the enzyme solution, the cellulose to be degraded, and the citrate-disodium hydrogen phosphate buffer solution.

[0010] Another aspect of the present invention provides a method for degrading straw cellulose, wherein the degradation system of the present invention is incubated in a shaking water bath.

[0011] In another aspect, the present invention provides the application of the Trichoderma of the present invention, or the enzyme solution of the present invention, or the degradation system of the present invention in the preparation of ruminant animal feed.

[0012] The Trichoderma sp. in this invention has the accession number CGMCC No.40954, is deposited at the China General Microbiological Culture Collection Center, located at Institute of Microbiology, Chinese Academy of Sciences, No.3, No.1 Beichen West Road, Chaoyang District, Beijing, and the deposit date is December 12, 2023.

[0013] The beneficial effects of this invention include at least the following: the enzyme solution obtained by fermenting Trichoderma through fermentation substrate provided by this invention has the ability to decompose the fiber-decomposing enzymes of feed such as crop straw or wheat bran in a high-yield and effective manner, which helps to meet the demand for fiber-decomposing enzymes in livestock production and promotes the effective utilization of fiber substances in feed. Attached Figure Description

[0014] Figure 1 The effect of different fermentation substrates on enzyme production by Trichodermasp.zt06;

[0015] Figure 2 The effect of corn straw concentration on enzyme production by Trichodermasp.zt06;

[0016] Figure 3 The effect of pH on enzyme production by Trichodermasp.zt06;

[0017] Figure 4 The effect of nitrogen source on enzyme production by Trichodermasp.zt06;

[0018] Figure 5 The effect of adding sugars from different sources on enzyme production in Trichodermasp.zt06;

[0019] Figure 6The effect of fermentation time on enzyme production in Trichodermasp.zt06;

[0020] Figure 7 The effect of inoculum size on enzyme production by Trichodermasp.zt06;

[0021] Figure 8 The xylose standard curve;

[0022] Figure 9 This is the standard curve for glucose.

[0023] Figure 10 The crude enzyme solution of Trichodermasp.zt06 strain exhibits degradative enzyme activity against different substrates;

[0024] Figure 11 pH dependence of Trichodermasp.zt06 cellulase;

[0025] Figure 12 The temperature dependence of Trichodermasp.zt06 cellulase;

[0026] Figure 13 pH tolerance of Trichodermasp.zt06 cellulase;

[0027] Figure 14 The degradation of rice straw by Trichodermasp.zt06 cellulase. Detailed Implementation

[0028] The embodiments described are provided to better illustrate the present invention, but are not intended to limit the scope of the invention to the embodiments described. Therefore, non-essential improvements and adjustments made to the embodiments by those skilled in the art based on the above description are still within the scope of protection of the present invention.

[0029] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit this disclosure. Singular expressions include plural expressions unless they have a distinct meaning in the context. As used herein, it should be understood that terms such as “comprising,” “having,” “including,” are intended to indicate the presence of features, numbers, operations, components, parts, elements, materials, or combinations thereof. The terminology of the invention is disclosed in the specification and is not intended to exclude the possibility that one or more other features, numbers, operations, components, parts, elements, materials, or combinations thereof may be present or added. As used herein, “ / ” may be interpreted as “and” or “or,” depending on the context.

[0030] To better understand the present invention, specific examples are provided below to further illustrate the content of the present invention, but the content of the present invention is not limited to the examples below.

[0031] To achieve the above objectives, the present invention can adopt the following technical solutions:

[0032] This embodiment provides a Trichoderma sp., with accession number CGMCC No. 40954.

[0033] This invention also provides an enzyme solution prepared by fermentation of Trichoderma according to the present invention.

[0034] In some specific examples, the preparation method of the above enzyme solution includes: culturing the fermentation substrate in a fermentation medium, then inoculating it with Trichoderma for fermentation, and centrifuging to obtain the enzyme solution.

[0035] In some specific examples, the above preparation method may include one or more combinations of the following conditions: (a) the fermentation substrate includes one or more combinations of rice straw, wheat straw, wheat bran, soybean straw, or corn straw; (b) the fermentation medium includes a nitrogen source, yeast powder, MgSO4·7H2O, KH2PO4, and NaCl, wherein the nitrogen source is selected from one or more combinations of peptone, ammonium sulfate, ammonium chloride, urea, or ammonium nitrate; (c) the concentration of the fermentation substrate is 9%-12%; (d) the pH of the fermentation medium is 5.5-7.5; (e) the fermentation time is 6-7 days; and (f) the inoculation concentration of Trichoderma is 3 × 10⁻⁶. 5 spores per milliliter.

[0036] In some specific examples, the fermentation substrate in condition (a) is corn stalks; the nitrogen source in condition (b) is peptone; the concentration of the fermentation substrate in condition (c) is 10%; and the pH of the fermentation medium in condition (d) is 6.

[0037] This invention also provides a straw cellulose degradation system, which includes the enzyme solution, the cellulose to be degraded, and the citrate-disodium hydrogen phosphate buffer solution.

[0038] It should be noted that in the degradation system of the present invention, 1 mL of the degradation system includes 300 μL of enzyme solution + 5% (i.e. 0.05 g) of straw cellulose to be degraded (such as rice straw).

[0039] In some specific examples, the degradation system described above includes one or more of the following features: (a) the cellulose to be degraded includes one or more of xylan, sodium carboxymethyl cellulose and microcrystalline cellulose; (b) the pH of the citrate-disodium hydrogen phosphate buffer is 3-8.

[0040] In some specific examples, the pH of the citrate-disodium hydrogen phosphate buffer in the above degradation system is 4-5, such as 4 or 5.

[0041] Another aspect of the present invention provides a method for degrading cellulose from straw, comprising incubating the degradation system of the present invention in a shaking water bath.

[0042] In some specific examples, the above methods include one or more of the following features: (a) an incubation temperature of 30°C-70°C, such as 40°C, 50°C or 60°C; (b) cellulose derived from rice straw.

[0043] This invention also provides a method for improving rumen fermentation of rice straw, including pretreatment of rice straw using the cellulose degradation method of this invention.

[0044] This invention also provides an application of the Trichoderma of this invention, the enzyme solution of this invention, or the degradation system of this invention in the preparation of ruminant animal feed.

[0045] In the following examples, enzyme activity was determined as follows: 700 μL of citrate-disodium hydrogen phosphate buffer (pH 6.0) and 0.05 g of substrate (straw) were added to a 2 mL centrifuge tube, followed by 300 μL of enzyme solution, and incubated at 40 °C for 2 h. After the experiment, the reducing sugar content in the reaction solution was determined using alkaline 3,5-dinitrosalicylic acid (DNS) reagent, and the reducing sugar concentration was calculated with reference to the glucose standard curve. One unit of enzyme activity (IU) is defined as the amount of enzyme required to release 1 μmol of reducing sugar within 1 min under specific conditions.

[0046] I. Isolation and Identification of Trichoderma sp. zt06

[0047] Example 1: Source of Trichoderma sp. zt06

[0048] The Trichoderma in this invention is derived from decaying branches and leaves in a grove on the campus of Jiangxi Agricultural University in Nanchang City, Jiangxi Province.

[0049] Take a small portion of the rotten branches and leaves and place it on a PDA medium plate (200g of peeled potato chunks are placed in a pot, 1000ml of water is added, and the mixture is heated to boiling and maintained for 20-30 minutes. While still hot, the mixture is filtered through two layers of gauze, and the residue is discarded; the filtrate is replenished with water to 1000ml; 20g of glucose and 15g of agar are added, dissolved, and then autoclaved). After mycelia grow, pick the mycelia from the edges or those that are obviously abnormal and inoculate them into a new PDA medium plate. Repeat this process multiple times (at least 5 times) for preliminary purification. Then, pick the mycelia into a liquid medium (10g of peptone, 0.5g of yeast extract, 1g of KHPO4, 0.2g of MgSO4·7H2O, 10g of NaCl, and distilled water to 1000mL, pH 6.5) for culture and perform enzyme activity assays. Select strains with enzyme activity. Finally, the mycelium was inoculated onto a potato broth plate, and the mycelium was repeatedly picked and purified to obtain Trichoderma sp. zt06.

[0050] The ITS sequence amplified using the universal fungal primers ITS4 and ITS5 is as follows:

[0051] AACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCC

[0052] AAACCCAATGTGAACGTTACCAAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGT

[0053] CGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTTTTGTATACCCC

[0054] CTCGCGGGTTTTTTATAATCTGAGCCTTCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGA

[0055] ATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAAT

[0056] GCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGC

[0057] GCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTC

[0058] CGGGGGGTCGGCGTTGGGGATCGGCCCTGCCTCTTGGCGGTGGCCGTCTCCGAAATACA

[0059] GTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGC

[0060] GGCGCGTCCACAGCCGTTAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGG

[0061] AATACCCGCTGAACTTAAGCATAT.

[0062] II. Optimization of enzyme production conditions for Trichoderma sp.zt06

[0063] (I) Effects of different fermentation substrates on enzyme production by Trichoderma sp. zt06

[0064] Rice straw, wheat straw, wheat bran, soybean straw, and corn straw, each with a mass fraction of 2% (2% of the fermentation medium), were used as the basic substrates for fermentation. 50 mL of fermentation medium (containing 1.0 g peptone, 0.5 g yeast extract, 0.2 g MgSO4·7H2O, 1 g KH2PO4, 10 g NaCl, pH 6.5 per liter) was added to a 250 mL Erlenmeyer flask and autoclaved at 108 °C for 30 min. PDA medium blocks containing Trichoderma sp. zt06 mycelia were inoculated and cultured in a shaking incubator at 30 °C for 5 days. Crude enzyme solutions were obtained by centrifugation, and the enzyme activity was analyzed using rice straw as the degradation substrate. Three biological replicates were set up for each group.

[0065] The results are as follows Figure 1 As shown, when corn stalks are used as liquid fermentation substrates, the Trichoderma sp.zt06 strain has the strongest enzyme production capacity, followed by wheat bran, wheat straw, rice straw and soybean straw.

[0066] (II) Effect of substrate concentration on enzyme production

[0067] Corn stalks were selected as the substrate, and the composition of the culture medium remained unchanged. The substrate concentration was set at 1%-12% (the mass percentage of corn stalks in the liquid culture medium (containing 1.0 g peptone, 0.5 g yeast extract, 0.2 g MgSO4·7H2O, 1 g KH2PO4, 10 g NaCl, pH 6.5 per liter). The pH was adjusted to 6.5, and the culture was carried out at 30℃ and 100 rpm for 5 days. After the culture was completed, the crude enzyme solution was obtained by centrifugation. Three biological replicates were set up for each group. The cellulase activity of the crude enzyme solution was determined according to the above method.

[0068] The results are as follows Figure 2 As shown, the results indicate that in the two concentration ranges of 1%-5% and 5%-9%, the enzyme activity of the crude enzyme solution of Trichoderma sp.zt06 increased with the increase of corn straw concentration; however, at the corn straw fermentation concentration of 9%-12%, the enzyme activity of Trichoderma sp.zt06 did not increase with concentration, with the highest enzyme activity at 10%, and a significant decrease in enzyme activity at 11%-12%, and the difference in enzyme activity was not significant.

[0069] (III) Optimization of initial pH value during fermentation

[0070] Corn stalks were selected as the basic substrate for fermentation, with a substrate concentration of 10%. The composition of the fermentation medium remained unchanged, and the pH of the medium was adjusted to 5.5, 6.0, 6.5, 7.0, and 7.5. The medium was cultured at 30℃ and 100 rpm for 5 days. After the culture was completed, the crude enzyme solution was obtained by centrifugation, and the activity of cellulase in the crude enzyme solution was determined according to the above method.

[0071] The results are as follows Figure 3 As shown, the crude enzyme solution exhibited the strongest enzyme activity at pH 6.0, while other pH conditions also showed strong enzyme activity, all reaching more than 80% of that at pH 6.0.

[0072] (iv) Nitrogen source optimization

[0073] Ammonium sulfate, ammonium chloride, urea, and ammonium nitrate were selected as backup inorganic nitrogen sources, and their nitrogen content was determined. Based on the optimal culture conditions determined in the above experiment (corn straw was selected as the substrate, substrate concentration was 10%, pH was 6.0), the peptone in the fermentation medium was replaced with these four inorganic nitrogen sources according to isonitrogen balance. The medium was cultured at 30℃ and 100rpm for 5 days. After the culture was completed, the crude enzyme solution was obtained by centrifugation, and the cellulase activity of the crude enzyme solution was determined according to the above method.

[0074] The results are as follows Figure 4As shown, the enzyme activity was highest when peptone was used as the nitrogen source. After replacing it with ammonium nitrate, the enzyme activity was only about 70% of that of peptone. The other three were the worst, with enzyme activities all below 60% compared to the peptone group, namely 53.44%, 50.69%, and 52.04%, respectively.

[0075] (V) The impact of sugar from different sources

[0076] Based on the optimal culture conditions determined in the above experiment (using corn stalks as substrate, substrate concentration of 10%, pH of 6.0), five high-quality sugar sources, namely glucose, fructose, sucrose, maltose and galactose, were added separately at 1% each. Other conditions remained unchanged. The mixture was cultured at 30℃ and 100rpm for 5 days. After the culture was completed, the crude enzyme solution was obtained by centrifugation. The cellulase activity of the crude enzyme solution was determined according to the above method.

[0077] The results are as follows Figure 5 As shown, compared with the unadded group, none of the five sugars from different sources could increase the enzyme production level of Trichodermasp.zt06 strain; on the contrary, they inhibited it. Sucrose and galactose had a smaller impact, with enzyme activity at about 80% of that in the unadded group. However, wine, fructose, and galactose all had a very strong inhibitory effect, with enzyme activity reaching only about 20% of that in the unadded group.

[0078] (vi) Fermentation time optimization

[0079] Based on the optimal culture conditions determined in the above experiment (corn straw was selected as the substrate, substrate concentration was 10%, pH was 6.0), all culture components were kept unchanged, only the culture time was changed, and the culture was carried out at 30℃ and 100rpm for 3d, 4d, 5d, 6d and 7d respectively. After the culture was completed, the crude enzyme solution was obtained by centrifugation, and the cellulase activity of the crude enzyme solution was determined according to the above method.

[0080] The results are as follows Figure 6 As shown, during these five time periods, enzyme activity generally showed an increasing trend with the increase of the number of days. Among them, the enzyme activity was relatively weak during the period of 3-5 days. However, when the fermentation time was extended to more than 6 days, the enzyme activity tended to level off, and the enzyme activity was strongest on the 6th and 7th days.

[0081] (vii) Optimization of vaccination volume

[0082] Based on the optimal culture conditions determined in the above experiment (using corn straw as the substrate, substrate concentration of 10%, pH 6.0), the culture conditions were kept unchanged for 6 days. Spore suspensions (spore concentration of 1.5 × 10⁻⁶) were then inoculated at volumes of 0.2%, 0.4%, 0.6%, 0.8%, and 1.0% (volume ratio of suspension to liquid culture medium (containing 1.0 g peptone, 0.5 g yeast extract, 0.2 g MgSO₄·7H₂O, 1 g KH₂PO₄, 10 g NaCl, pH 6.5 per liter) respectively. 8 (number / mL); after the culture is completed, the crude enzyme solution is obtained by centrifugation, and the cellulase activity of the crude enzyme solution is determined according to the above method.

[0083] The results are as follows Figure 7 As shown, with the increase of inoculum amount, the enzyme activity of crude enzyme solution showed a decreasing trend and gradually leveled off.

[0084] In summary, the culture protocol for enzyme production by Trichoderma sp. zt06 is as follows: Based on the fermentation medium, adjust the initial pH to 6.0, add 10% corn straw as the fermentation substrate, and inoculate to a final concentration of 3 × 10⁻⁶. 5 Spores per milliliter, fermented for 6–7 days. III. Enzymatic characteristics analysis of Trichoderma sp. zt06 cellulase.

[0085] (I) Substrate specificity

[0086] The reaction system consisted of 1 mL of 1% (0.01 g) xylan, 1% (0.01 g) sodium carboxymethyl cellulose (CMC-Na), 1% (0.01 g) microcrystalline cellulose, and 1% (0.01 g) chitosan, respectively. 50 μL of crude enzyme solution was added to each of these substrates, and the remainder was made up with citrate-disodium hydrogen phosphate buffer at pH 6.0. The system was placed in a shaking water bath at 40 °C and incubated for 30 min. After the reaction, the released reducing sugars were measured. Except for xylan, the xylan substrate was determined according to the xylose standard curve (see...). Figure 8 Except for calculating the reducing sugar concentration, the other three methods are based on the glucose standard curve (see...). Figure 9 Calculate the reducing sugar concentration.

[0087] The results are as follows Figure 10 As shown, the crude enzyme solution of Trichoderma sp. zt06 strain can specifically and efficiently degrade CMC, followed by xylan; it has weak degradation activity on microcrystalline cellulose, but no degradation activity on chitosan.

[0088] (ii) pH dependence

[0089] Based on the above experiments, xylan, sodium carboxymethyl cellulose, and microcrystalline cellulose were selected for characterization. A 1 mL reaction system was used, which included 50 μL of crude enzyme solution, 1% of substrate (xylan, sodium carboxymethyl cellulose, and microcrystalline cellulose), and citrate-disodium hydrogen phosphate buffer at different pH values. The system was placed in a shaking water bath at 40 °C and incubated for 30 min. After the reaction was completed, the amount of reducing sugar released was measured.

[0090] The results are as follows Figure 11 As shown, the optimal pH values ​​for the enzyme systems of Trichoderma sp. zt06 strain that can degrade xylan, sodium carboxymethyl cellulose, and microcrystalline cellulose in crude enzyme solution are 5, 4, and 4, respectively; among them, the xylan enzyme system has a very wide pH adaptation range, and the xylanase activities shown are all above 70%.

[0091] (III) Temperature dependence

[0092] Select the optimal pH buffer solution determined in the above experiment, keeping other reaction components unchanged; set the temperature of the water bath to 30℃, 40℃, 50℃, 60℃, 70℃, and 80℃ respectively, and incubate for 30 min. After the reaction is completed, measure the released reducing sugar.

[0093] The results are as follows Figure 12 As shown, the xylanase system and the microcrystalline cellulase system have the strongest enzyme activity at 50℃, while the optimal temperature for the CMC enzyme system is 60℃; among them, the xylanase system and the CMC enzyme system still retain more than 50% of their activity at 30℃-70℃.

[0094] Based on the optimal pH and optimal temperature, it was calculated that the cellulase produced by Trichoderma sp.zt06 contains 11385 U / L xylanase, 4412 U / L endocellulase and 975 U / L exocellulase.

[0095] (iv) pH tolerance

[0096] First, the obtained crude enzyme solution was added to different citrate-disodium hydrogen phosphate buffer solutions (pH 3-8) and left at room temperature for 1 hour. Then, the optimal reaction component determined in the above experiment was selected and incubated at the optimal reaction temperature for 30 minutes. After the reaction was completed, the amount of reducing sugar released was measured.

[0097] The results are as follows Figure 13 As shown, within the pH range of 3.0-8.0, the enzyme activities of all three enzyme systems remained above 70%. IV. Degradation of Crop Straw by Trichoderma sp. zt06 Cellulose Enzyme

[0098] The reaction system consisted of 1 mL of rice straw containing 1% (1% is 0.01 g of 1% (m / V) in 1 mL of the reaction system). 50 μL-500 μL of crude enzyme solution was added, and the remainder was brought up to 1 mL with citrate-disodium hydrogen phosphate buffer at pH 6.0. The mixture was placed in a shaking water bath at 40 °C and incubated for 6 h. After the reaction was completed, the amount of reducing sugar released was measured.

[0099] The results are as follows Figure 14 As shown, the cellulase produced by Trichoderma sp.zt06 has a significant degradation effect on rice straw, and this effect is dose-dependent with the amount of enzyme added; when the amount added is increased to 200 μL, the degradation efficiency of Trichoderma sp.zt06 cellulase on rice straw reaches its maximum.

[0100] V. Effects of Trichoderma sp. zt06 cellulase pretreatment of crop straw on rumen fermentation

[0101] The artificial saliva was prepared using the following methods in the tests:

[0102] (1) Artificial saliva stock solution: NaHCO3 49.0g / L, Na2HPO4 18.5g / L, NaCl 2.35g / L, KCl 2.85g / L, MgCl2·6H2O 0.6g / L, CaCl2 0.2g / L;

[0103] (2) Artificial saliva: Add 800 mL of distilled water to 200 mL of the artificial saliva stock solution prepared above, and pass CO2 through until the solution is clear. Measure the pH and adjust the pH to 6.5 with hydrochloric acid to obtain artificial saliva.

[0104] 10g of rice straw was pretreated with 200ml of Trichoderma sp. ZT06 crude enzyme solution, and then 0.5g of rice straw was weighed as substrate for in vitro fermentation. The control group was rice straw treated with 200ml of buffer solution (pH 5.0).

[0105] The in vitro fermentation process was as follows: Rumen fluid was collected from three healthy sheep via a gastric tube, filtered through gauze, and mixed with artificial saliva at a 1:2 ratio. The entire operation was carried out in a 39℃ water bath while maintaining CO2 flow. Different fermentation substrates (pretreated rice straw with Trichoderma sp. ZT06 crude enzyme solution for the treatment group; rice straw without Trichoderma sp. ZT06 crude enzyme solution for the control group, replaced with an equal volume of water) and 60mL of buffered rumen fluid (rumen fluid and artificial saliva mixed at a 1:2 volume ratio) were added to a 120mL fermentation flask according to the experimental design. After degassing, the flask was placed in a 39℃ incubator for 48 hours. After fermentation, the reaction was terminated with ice water, filtered through a 400-mesh nylon mesh, and the filtrate was collected for determining pH, ammonia nitrogen, microbial protein, and volatile fatty acids. The results are shown in Table 1.

[0106] Table 1. Effects of Trichoderma sp.zt06 cellulase pretreatment of rice straw on rumen fermentation.

[0107]

[0108] Table 1 shows that pretreatment with Trichoderma sp. ZT06 crude enzyme solution significantly improved the dry matter digestibility, ammonia nitrogen, and microbial protein synthesis during the in vitro rumen fermentation of rice straw, increasing by 3.72%, 2.96 mg / g, and 1.78 mg / g, respectively, compared with the control group. Although the total volatile fatty acid content was not significantly affected, the molar ratio of acetic acid was significantly higher than that of the control group, while the molar ratios of propionic acid and butyric acid were significantly lower than those of the control group. These results indicate that pretreatment of rice straw with Trichoderma sp. ZT06 crude enzyme solution can significantly improve rumen fermentation of rice straw and promote the application of rice straw in ruminant production.

[0109] In summary, the cellulase secreted by Trichoderma sp. zt06 possesses the characteristics of xylanase, endoglucanase, and exoglucanase, and maintains high activity at pH 4.0-5.0 and 50℃-60℃, while exhibiting good stability at pH 3.0-8.0.

[0110] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A type of Trichoderma sp., with accession number CGMCC No.40954.

2. An enzyme solution, characterized in that, It is prepared by fermentation of Trichoderma as described in claim 1.

3. The enzyme solution according to claim 2, characterized in that, The preparation method includes: preparing an enzyme solution from the Trichoderma described in claim 1 using a fermentation substrate.

4. A straw degradation system, characterized in that, It includes the enzyme solution, substrate to be degraded, and citrate-disodium hydrogen phosphate buffer as described in any one of claims 2 to 3; the substrate to be degraded is one or more of xylan, sodium carboxymethyl cellulose, and microcrystalline cellulose.

5. The degradation system according to claim 4, characterized in that, The pH of the citrate-disodium hydrogen phosphate buffer solution is 3-8.

6. The degradation system according to claim 5, characterized in that, The pH of the citrate-disodium hydrogen phosphate buffer solution is 4-5.

7. A method for degrading straw or wheat bran, characterized in that, The degradation system described in any one of claims 4 to 6 is incubated in a shaking water bath, wherein the straw is rice straw, wheat straw, bean straw or corn straw.

8. The method according to claim 7, characterized in that, It includes one or two of the following characteristics: (a) the incubation temperature is 30℃-70℃; (b) the straw is rice straw.

Images