Trichoderma asperellum TAZ19, biocontrol inoculant and application of Trichoderma asperellum TAZ19

Abstract

The invention provides a Trichoderma asperellum TAZ19, a biocontrol inoculant and application of the Trichoderma asperellum TAZ19, the Trichoderma asperellum TAZ19 is preserved in the China Center for Type Culture Collection on October 25, 2024, and the preservation number of the Trichoderma asperellum TAZ19 is CCTCC M 20242341. The active ingredients of the biocontrol inoculant comprise the trichoderma asperellum TAZ19 strain, and the trichoderma asperellum TAZ19 strain is one or more of conidia, hypha, fermentation filtrate or active extracts of the trichoderma asperellum TAZ19 strain of the trichoderma asperellum TAZ19 strain. The trichoderma asperellum TAZ19 has an excellent antagonistic effect on a plurality of plant disease pathogenic bacteria such as dispora pinnatifida, a plurality of fusarium oxysporum, apple black beancurd skin fungi and botryosphaeria dothidea, has broad-spectrum antibacterial activity, is high in growth speed, high in antibacterial activity and high in hyperparasitism ability, has better saline-alkaline tolerance, also has a growth promoting effect on plants, and can be widely applied to the field of plant diseases. The strain can be used as an active component of a biocontrol inoculant to be widely applied to prevention and treatment of various plant diseases such as pine tree branch rot, wheat stem rot and tomato fusarium wilt, and has a wide application prospect.

Description

Technical Field

[0001] The invention relates to the technical field of microorganisms, and in particular to a strain of Trichoderma acanthosporium TAZ19, a biocontrol agent and applications thereof. Background Art

[0002] During the growth process, crops are easily infected by pathogens and develop various diseases, causing huge losses to agricultural production. As the global climate continues to warm, various crop diseases and insect pests have more frequent outbreaks and epidemics. Effective prevention and control of crop diseases has become an important limiting factor for stable and high crop yields.

[0003] In order to reduce the losses caused by pests and diseases to agricultural production and forestry, many plant pest and disease control technologies and systematic methods have been established. However, in actual prevention and control, the application of chemical pesticides still dominates the market, accounting for 80% due to low cost, quick effect and convenience of use. However, the excessive use of chemical pesticides has caused many negative effects, such as ecological damage, environmental pollution, excessive residues, resistance of pathogens, etc., and even threatens human health. In agricultural production, the research and development and application promotion of technologies to reduce the use of chemical pesticides and chemical fertilizers have begun. In order to promote the green development of agricultural production and reduce the use of chemical pesticides, it is urgent to develop and promote green plant pest and disease control technologies.

[0004] Biological control is an important measure for the prevention and control of green plant diseases. Biocontrol bacteria can control the number of harmful organisms by inhibiting diseases, inducing plant resistance, competition for nutrition and ecological niches, parasitism or bacteriolysis, thereby achieving the purpose of effectively preventing and controlling plant diseases and insect pests. In addition, based on the fact that biocontrol agents are environmentally friendly, ecologically safe, and harmless to natural enemies, biocontrol agents prepared using antagonistic bacteria are the best alternative to chemical agents. At present, there are many commercialized biocontrol agents on the market, which have been widely used in the prevention and control of plant diseases such as plant fungal diseases, plant nematode diseases, and plant oomycete diseases.

[0005] However, the existing biocontrol agents have relatively single functions, insufficient lysis spectrum, different lysis specificity, different application ranges, and poor salt-alkali resistance, which limits their practical application. There are few reports on excellent strain resources that have the functions of disease prevention and control, salt-alkali resistance, and plant growth promotion.

[0006] Therefore, the prior art needs to be further improved. Summary of the invention

[0007] In view of the above problems, the present invention provides a strain of Trichoderma aspergillus TAZ19, a biocontrol agent and an application thereof. The Trichoderma aspergillus TAZ19 has a wide antibacterial spectrum and strong antibacterial activity, and has good salt-alkali resistance. It also has a growth-promoting effect on plants. It can be widely used as a biocontrol agent in the prevention and control of various plant disease pathogens and plant growth promotion.

[0008] To solve the above problems, this application provides the following technical solutions:

[0009] In a first aspect, the present application provides a strain of Trichoderma asperellum TAZ19, whose accession number is CCTCC M 20242341.

[0010] This strain was isolated from the rhizosphere soil of grapes at the internship base of Qingdao Agricultural University in 2022. Its morphological characteristics are: the colonies formed on the PDA plate are first white and round, and as the culture time increases, the colonies gradually turn green (producing conidia); under an electron microscope, it was observed that its spore-producing cells were flask-shaped, and the conidia were nearly circular or elliptical; the morphological identification results and molecular biological identification results of the strain both indicate that this strain is a new strain of Trichoderma, which was named TAZ19.

[0011] The strain was deposited in the China Type Culture Collection of Wuhan University on October 25, 2024, located in Wuhan, China, and its deposit number is CCTCC NO: M 20242341.

[0012] Experiments have shown that the Trichoderma aculeatus TAZ19 has good antibacterial properties against a variety of plant disease pathogens such as tobacco oxysporum, tomato oxysporum, solanum fusarium, grape anthracnose, potato root rot Fusarium, false graminearum, Sclerotium uniformis, Verticillium dahliae, Diplodia pine, and grape root rot Fusarium, and exhibits a wide lysis spectrum, and can be widely used in the prevention and control of diseases of a variety of economic crops; in addition, the fungus also has good salt-alkali resistance and growth promotion and other multifunctional effects, enriching the multifunctional strain resources of biocontrol bacteria and laying the foundation for the research and development of antagonistic bacterial agents.

[0013] In a second aspect, the present application also provides a biocontrol agent, which includes the aforementioned Trichoderma aspergillus TAZ19.

[0014] Based on the broad-spectrum antibacterial and growth-promoting properties of Trichoderma aspergillus TAZ19, the bacterial liquid, secretions or spores can be used as active ingredients to prepare biocontrol agents for the prevention and control of various plant diseases.

[0015] In addition, in order to further optimize and improve the bactericidal effect or growth-promoting effect of the biocontrol agent, the biocontrol agent also includes other bactericidal active ingredients used in combination (such as other biocontrol bacteria with complementary effects in the bactericidal spectrum, antibacterial active substances, etc.) or existing growth-promoting active ingredients, etc.

[0016] Preferably, in the biocontrol agent, the active ingredient is one or more of the conidia, mycelium, fermentation filtrate or active extracts thereof of Trichoderma aspergillus TAZ19. Experiments have shown that its spores, secretions, etc. have significant inhibitory activity against pathogens.

[0017] In a third aspect, the present application also provides the use of the above-mentioned Trichoderma aspergillus TAZ19 and the aforementioned biocontrol agent in preventing and controlling plant diseases.

[0018] Optionally, the plant diseases include: pine trunk rot, wheat stem base rot, tomato wilt, cucumber wilt, grape anthracnose, tobacco root rot, tobacco black stem disease, Solanaceae crop verticillium wilt, crop white rot and crop sheath blight.

[0019] 1. In a fourth aspect, the present application also provides the use of the above-mentioned Trichoderma aculeatus TAZ19 and the above-mentioned biocontrol agent in the inhibition of pathogens, wherein the pathogens include: tobacco oxysporum Fusarium (FON), tomato oxysporum Fusarium (FOL), solanum Fusarium solani (F. solani), gloeosporioides (C. gloeosporioides), potato oxysporum Fusarium (FOT), pseudograminearum (F. pseudograminearum), S. rolfsii (S. rolfsii), Verticillium dahliae (V. dahliae), D. sapinea (D. sapinea) and peanut oxysporum (F. oxysporum).

[0020] Experiments have shown that Trichoderma aspergillus TAZ19 has a good antibacterial effect on the above-mentioned pathogens. This result also shows that Trichoderma aspergillus TAZ19 has a wide lysis spectrum and has a wide range of applications in actual field disease prevention and control.

[0021] In a fifth aspect, the present application also provides the use of the above-mentioned Trichoderma aspergillus TAZ19 and the above-mentioned biocontrol agent in a saline-alkali environment, or in improving the tolerance of plants to a saline-alkali environment.

[0022] Experiments have shown that Trichoderma aculeatus TAZ19 can grow normally in a culture environment of pH 5-10, with almost no difference in growth rate. This result shows that the fungus has good alkali resistance. Experiments have also shown that Trichoderma aculeatus TAZ19 grows fast on PDA with 1-2% NaCl, exceeding the growth rate of most soil-borne pathogens. This result shows that the TAZ19 strain has strong salt and acid-base resistance, has good adaptability to saline-alkali environments, and can be used in saline-alkali environments to improve the tolerance of crops to saline-alkali environments.

[0023] Optionally, the application method is: when transplanting at the seedling stage, the conidia liquid of Trichoderma aspergillus TAZ19 is used to irrigate the roots of the plants or TAZ19 is made into a biological fertilizer for application.

[0024] Preferably, the spore concentration of the conidia liquid is above 105 conidia / mL.

[0025] The present invention has the following beneficial effects:

[0026] 1. The present invention provides a self-isolated strain of Trichoderma aculeatus TAZ19, which has a broad-spectrum antibacterial property, fast growth rate, high antibacterial activity, and strong parasitic ability. The strain has excellent antagonistic effects on a variety of plant disease pathogens such as tobacco oxysporum Fusarium, tomato oxysporum Fusarium, solanum Fusarium, gloeosporium, potato oxysporum Fusarium, pseudograminearum Fusarium, uniform microspore, dahliae Verticillium, pine chromophore and peanut root rot Fusarium, and can be used as a biocontrol agent for pine trees. Prevention and control of pathogens of various plant diseases such as branch rot, pine branch rot, apple rot, apple ring rot, apple anthracnose, wheat stem base rot, tomato wilt, cucumber wilt, tobacco root rot, tobacco black shank, Verticillium wilt of Solanaceae crops, white rot of crops, sheath blight of crops, etc. Prevention and control of pathogens of various plant diseases such as wheat stem base rot, tomato wilt, cucumber wilt, tobacco root rot, tobacco black shank, Verticillium wilt of Solanaceae crops, white rot of crops, and sheath blight of crops.

[0027] 2. The TAZ19 strain of Trichoderma aspergillus has a wide adaptability to acids, alkalis and salts, and can improve the tolerance of crops to saline-alkali environments; the secretions of the TAZ19 strain of Trichoderma aspergillus also have strong inhibitory activity against pathogens, greatly expanding the types and application methods of its products; therefore, the TAZ19 strain of Trichoderma aspergillus has good market application prospects in agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The morphological photos of the TAZ19 strain; A is the colony formed by the strain on the PDA medium, B is the electron microscopic image of the spore-forming cells of the strain; C is the electron microscopic image of the conidia of the strain;

[0029] Figure 2 Multi-gene phylogenetic relationship analysis for TAZ19 strains;

[0030] Figure 3 is the tolerance of TAZ19 strain to acid, alkali and salt; A is the tolerance result of TAZ19 strain to different pH, and B is the tolerance result of TAZ19 strain to salt;

[0031] Figure 4 is the inhibitory effect of TAZ19 strain on different pathogens; among them, A is tobacco oxysporum Fusarium, B is tomato oxysporum Fusarium, C is solanum Fusarium, D is gloeosporium, E is potato root rot Fusarium, F is false graminearum Fusarium, G is uniform microspore, H is dahliae Verticillium, I is pinus spore, and J is peanut oxysporum Fusarium;

[0032] Figure 5 The TAZ19 strain has a parasitic effect on pathogens; A is a photo of the TAZ19 strain cultured against tomato Fusarium and tobacco Fusarium; B is a photo of the tomato Fusarium and tobacco Fusarium colonies on PDA being completely parasitized by the TAZ19 strain;

[0033] Figure 6 The results are the inhibitory effects of the secretions of the TAZ19 strain on pathogenic bacteria; A is the inhibition of the secretions of the TAZ19 strain on Sclerotium sclerotiorum, and B is the inhibition of the secretions of the TAZ19 strain on Diplodia pine;

[0034] Figure 7 The TAZ19 strain is used to prevent and control wheat stem rot; A: wheat inoculated with Fusarium graminearum treated with TAZ19 strain, B: wheat inoculated with Fusarium graminearum. DETAILED DESCRIPTION

[0035] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention. In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in the art. The methods in the following embodiments are conventional methods in the art unless otherwise specified.

[0036] Example 1 Isolation and identification of Trichoderma aspergillus strain TAZ19

[0037] 1. Experimental methods

[0038] (1) Isolation of Trichoderma aspergillus strain TAZ19

[0039] In August 2022, grape rhizosphere soil was dug from the internship base of Qingdao Agricultural University. 10 g of soil was added to 90 mL of sterile water and vortexed. After standing for 30 min, the supernatant was diluted 1000 times and spread on a PDA (containing streptomycin sulfate) plate and cultured at 25°C. Single colonies were picked for subsequent experiments.

[0040] (2) Identification of Trichoderma aspergillus strain TAZ19

[0041] A. Morphological identification: Inoculate a single colony of the isolated strain onto a PDA plate and culture at 25°C to observe the morphology and color of the colonies formed, as well as the morphology of the conidia and spore-forming cells produced by the strain.

[0042] B. Molecular identification: The mycelial genomic DNA was extracted and used as a template to amplify the ITS gene of the strain using primers ITS5 and ITS4; the RBP2 gene was amplified using primers RBP2-5F and RBP2-7cR; the TEF gene was amplified using primers EF1-728F and TEF1LLErev. Finally, the amplified fragments were sequenced and compared by BLAST, followed by multi-gene phylogenetic analysis using MEGA(X).

[0043] The amplification primer sequences of the above three genes are as follows:

[0044] ITS5: GGAAGTAAAAGTCGTAACAAGG (sequence as shown in SEQ ID NO. 1);

[0045] ITS4:TCCTCCGCTTATTGATATGC (sequence as shown in SEQ ID NO. 2);

[0046] RBP2-5F: GAYGAYMGWGATCAYTTYGG (sequence as shown in SEQ ID NO.3); RBP2-7cR: CCCATRGCTTGYTTRCCCAT (sequence as shown in SEQ ID NO.4);

[0047] EF1-728F: CATCGAGAAGTTCGAGAAGG (the sequence is shown in SEQ ID NO.5); TEF1LLErev: AACTTGCAGGCAATGTGG (the sequence is shown in SEQ ID NO.6).

[0048] 2. Experimental methods and analysis

[0049] (1) After observation, Figure 1 As shown in Figure 2, the isolated strain first formed white circular colonies on the PDA plate. As the culture time increased, the colonies gradually turned green, indicating the production of conidia (such as Figure 1A), electron microscope further observed that the spore-forming cells were phialoid (e.g. Figure 1 B), conidia are nearly round or oval (e.g. Figure 1 C); The morphological observation results show that the strain is a Trichoderma strain.

[0050] (2) The ITS, RBP2 and TEF gene sequences of the strain are shown in SEQ ID NOs. 7 to 9, respectively. BLAST comparison results showed that the sequence identity of the three gene sequences with Trichoderma asperellum was higher than 99%. Multi-gene phylogenetic analysis showed that the strain and Trichoderma asperellum were clustered in the same branch (e.g. Figure 2 ). The results also proved that this strain was Trichoderma aspergillus, and the strain was named Trichoderma aspergillus TAZ19.

[0051] Example 2 Salt and alkali resistance test of strain TAZ19

[0052] 1. Experimental methods

[0053] The strain TAZ19 was inoculated on PDA plates with pH 5, pH 6, pH 7, pH 8, pH 9 and pH 10 for culture; in addition, the strain TAZ19 was inoculated on PDA plates with NaCl concentrations of 0%, 1%, 2%, 5%, 7.5% and 10%, cultured at 25°C, and the growth of the colonies was observed.

[0054] 2. Experimental results and analysis

[0055] like Figure 3 As shown in A, the TAZ19 strain grew normally on PDA medium with pH 5-10, with almost no difference in growth rate.

[0056] like Figure 3 As shown in Figure B, the growth results of the colonies on the PDA plate containing NaCl showed that high concentrations of NaCl had an inhibitory effect on the growth of TAZ19, but the growth rate of TAZ19 on 2% NaCl PDA still exceeded the growth rate of most soil-borne pathogens (Table 1). On 1% NaCl PDA, the growth rate of TAZ19 was even faster (see Table 1). Figure 3 B).

[0057] Table 1 Colony radius of different strains cultured at 25℃ for 60h

[0058]

[0059] The above experimental results show that the TAZ19 strain has strong salt and acid-alkali resistance and has good adaptability to saline-alkali environments. It can be used in saline-alkali environments to improve the tolerance of crops to saline-alkali environments.

[0060] Example 3 Antibacterial activity of strain TAZ19

[0061] 1. Experimental methods

[0062] 1. Ten strains of Fusarium oxysporum, including Fusarium oxysporum of tobacco (FON), Fusarium oxysporum of tomato (FOL), Fusarium solani, Colletotrichum gloeosporioides, Fusarium oxysporum of potato (FOT), Fusarium pseudograminearum, S. rolfsii, V. dahliae, D. sapinea and F. oxysporum, were selected as the pathogens to be tested.

[0063] The above-mentioned pathogens were cultured in confrontation with the TAZ19 strain on PDA culture medium, and each pathogen cultured alone was used as a control; the inhibition rate of TAZ19 against different pathogen strains was detected by measuring the size of the formed colonies.

[0064] 2. Experimental results and analysis

[0065] The results are as follows Figure 4 As shown in the results, TAZ19 has a strong inhibitory effect on the growth of pathogens such as Fusarium oxysporum of tobacco, Fusarium oxysporum of tomato, Fusarium solani, Fusarium solani, Colletotrichum gloeosporioides, Fusarium graminearum, Sclerotium uniformis, Phytophthora nicotianae, Verticillium dahliae, and Diplodia pine. The specific inhibition rates on the growth of different pathogen colonies are shown in Table 2 below.

[0066] From the results in Table 1, it can be seen that the inhibition rate of TAZ19 against Verticillium dahliae was the highest, reaching 98.0%; followed by Phytophthora nicotianae and Colletotrichum vinifera, and the inhibition rates of TAZ19 against these two pathogens were 94.25% and 92.26%, respectively.

[0067] Table 2 Inhibitory efficiency of TAZ19 strain on the growth of different pathogens

[0068]

[0069]

[0070] Example 4: Re-hosting activity of strains

[0071] 1. Experimental methods

[0072] The TAZ19 strain was cultured against tomato oxysporum and tobacco oxysporum on PDA culture medium, and the growth of TAZ19 on the three pathogen colonies and the growth and decline of the pathogen colonies were observed.

[0073] 2. Experimental results and analysis

[0074] The results are as follows Figure 5 As shown in the figure, the distance between the colonies of the three bacteria was far in the early stage, and the colonies all grew normally. When the colonies of TAZ19 were close to the colonies of pathogens, the colonies of each pathogen were obviously inhibited. As time went on, the hyphae of the pathogens were completely parasitized by TAZ19, and the colonies gradually disappeared. The experimental results show that TAZ19 has a strong parasitic effect on the hyphae of pathogens, and can remove pathogens in the environment in a short time, reducing or avoiding the occurrence of diseases.

[0075] Example 5 Inhibitory activity of bacterial secretions against pathogenic bacteria

[0076] 1. Experimental methods

[0077] The TAZ19 strain was inoculated on a PDA plate covered with cellophane and cultured at 25°C. When the colony grew close to the edge of the cellophane, the cellophane and the TAZ19 colony on it were removed. Pathogens (Sclerotium uniformis and Diplodia pinecolor) were inoculated in the center of the PDA plate where the TAZ19 colony was cultured, and pathogens were inoculated in the center of the PDA plate where the TAZ19 colony was not cultured as a control, and the inhibitory activity of the secretions of the TAZ19 strain against Sclerotium uniformis and Diplodia pinecolor was detected.

[0078] 2. Experimental results and analysis

[0079] The results are as follows Figure 6 As shown, the two tested pathogens could not grow on the plates containing the secretions of the TAZ19 strain, and the secretions of the TAZ19 strain aligned with the whole Sclerotium (see Figure 6 A) and Chromatis bisporus (see Figure 6 B) all showed strong inhibitory activity.

[0080] Example 6 Control effect of strains on wheat stem rot

[0081] 1. Experimental methods

[0082] This example uses a potted plant experiment to test the control effect of the TAZ19 strain on wheat stem rot. The specific method is: water the roots of Jimai 22 wheat seedlings for 10 5The seedlings were inoculated with 20 mL of conidia of F. pseudograminearum at 10 mL / mL and then watered with 20 mL of liquid YEPD medium as an inoculation control. 5 20 mL of conidia suspension of TaZ61 strain with a concentration of 100 / mL was used as treatment. Conidia of F. pseudograminearum and TAZ19 were made into spore suspensions using YEPD. After treatment, wheat seedlings were cultured at RH95% and 25°C, and the disease status of wheat seedlings was investigated after 2 weeks.

[0083] 2. Experimental results and analysis

[0084] The experimental results show that the control effect of TAZ19 on wheat stem rot is as high as 90.22%. Figure 7 The results show that Trichoderma aspergillus TAZ19 has great application potential in the prevention and treatment of wheat stem rot, and can be used as an active ingredient for the prevention and treatment of various diseases such as wheat stem rot.

[0085] In this embodiment, wheat stem rot is used as an example to illustrate the control effect of TAZ19 on plant diseases. In addition to this disease, based on its excellent antibacterial activity and wide lysis spectrum characteristics against various pathogenic bacteria in Examples 3 and 5, technicians in this field can expect that TAZ19 can be applied to the technical effects of controlling various plant diseases caused by the aforementioned pathogens.

[0086] It is understandable that those skilled in the art can make equivalent substitutions or changes based on the technical solution and concept of the present invention, and all these changes or substitutions should fall within the protection scope of the claims attached to the present invention.

Claims

1. A strain of Trichoderma asperellum TAZ19, characterized in that Its accession number is CCTCC M20242341.

2. A biocontrol agent, characterized in that: Including the Trichoderma aspergillus TAZ19 described in claim 1.

3. The biocontrol agent according to claim 2, characterized in that The active ingredient of the biocontrol agent is one or more of the conidia, hyphae, fermentation filtrate or active extracts thereof of the Trichoderma aspergillus TAZ19.

4. Use of the Trichoderma aspergillus TAZ19 as claimed in claim 1 and the biocontrol agent as claimed in claim 2 in preventing and controlling plant diseases.

5. The use according to claim 4, characterized in that: The plant diseases include: pine trunk rot, wheat stem base rot, tomato wilt, cucumber wilt, tobacco root rot, tobacco black stem disease, Solanaceae crop verticillium wilt, crop white rot and crop sheath blight.

6. Use of the Trichoderma aspergillus TAZ19 according to claim 1 and the biocontrol agent according to claim 2 in inhibiting plant disease pathogens, wherein the pathogens include: Tobacco oxysporum Fusarium f.sp.nicotianae, Tomato oxysporum Fusarium f.sp.lycopersici, Apple black rot shell fungus (Valsa mali), Grape seat cavity fungus (Botryosphaeria dothidea), Solanum Fusarium (Fusarium solani), Gloetotrichum gloeosporioides, Potato oxysporum Fusarium (Fusarium oxysporum f.sp.tuberosi), False graminearum Fusarium (Fusarium pseudograminearum), Sclerotium rolfsii, Verticillium dahliae, Diplodiasapinea and Peanut oxysporum Fusarium (Fusarium oxysporum).

7. Use of the Trichoderma aspergillus TAZ19 according to claim 1 and the biocontrol agent according to claim 2 in saline-alkali environment and in improving the tolerance of plants to saline-alkali environment.

8. The use according to claim 6 or 7, characterized in that: The application method is: use the conidia liquid of Trichoderma aspergillus TAZ19 to irrigate the roots of plants or use TAZ19 bacteria to make biological fertilizer for use.

Images