CircRNA related to development of age-related cataract and application thereof

Abstract

The invention discloses circRNA (Ribonucleic Acid) related to age-related cataract development and application of the circRNA. The circRNA is circTFRC, the circTFRC is over-expressed to inhibit the proliferation capacity and activity of LECs, and the expression of the circTFRC is interfered to promote the proliferation capacity and activity of the LECs; the cyclic structure and biological functions of human circTFRC are verified, it is found that after circTFRC expression is intervened, the multiplication capacity, activity and ferroptosis related indexes of LECs can be remarkably affected, and a new selection target is provided for molecular regulation and control of ARC occurrence and development.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a circRNA related to the development of age-related cataracts and an application thereof. Background Art

[0002] Age-related cataract (ARC) is the leading cause of blindness worldwide.

[0003] Currently, surgery is still the main treatment for cataracts, but complications caused by surgery can affect patients' postoperative visual function and quality of life. Given that the etiology and pathogenesis of ARC have not been fully elucidated, there is no effective drug to prevent or delay its development in clinical practice. Therefore, studying the pathogenesis of ARC and discovering molecular targets that can be used for clinical intervention is a key breakthrough in the development of clinical drugs for the prevention and treatment of ARC. The occurrence and development of ARC is inseparable from the proliferation and differentiation of lens epithelial cells. In addition to being regulated by genes, signaling pathways, transcription factors, and miRNAs, it is also regulated by circRNAs.

[0004] circRNA is a special type of non-coding RNA. It is produced by a non-canonical splicing event called backsplicing. It lacks a 5' cap and a 3' poly(A) tail. It is a closed ring formed by covalent bonds and is not easily degraded by exonucleases. Compared with linear RNA, it is more stable. Studies have found that circRNA participates in biological processes such as growth, development, and disease development, and plays an important role in cell proliferation and differentiation, cell cycle, cell metabolism, apoptosis, and maintenance of pluripotency. To this end, we proposed a circRNA related to the development of age-related cataracts and its application. Summary of the invention

[0005] The purpose of the present invention is to provide a circRNA related to the development of age-related cataracts and its application, so as to overcome the technical problems existing in the prior art.

[0006] In order to achieve the above technical objectives and the above technical effects, the present invention provides the following technical solutions:

[0007] A circRNA associated with the development of age-related cataracts, wherein the circRNA is circTFRC, overexpression of circTFRC inhibits the proliferation ability and activity of LECs, and interference with circTFRC expression promotes the proliferation ability and activity of LECs.

[0008] Preferably, the use of a circRNA associated with the development of age-related cataracts utilizes a PCR method to amplify and determine the circTFRC and its nucleotide sequence.

[0009] Preferably, the use of a circRNA associated with the development of age-related cataracts utilizes qPCR and actinomycin D half-life method to demonstrate the circTFRC ring structure.

[0010] Preferably, a circRNA associated with the development of age-related cataracts is used to overexpress or interfere with the effect of the circTFRC on the proliferation ability and vitality of LECs.

[0011] Preferably, a circRNA associated with the development of age-related cataracts is used to overexpress or interfere with the effect of the circTFRC on the ferroptosis of SRA01 / 04 cells.

[0012] The beneficial effects of the present invention are:

[0013] In the present invention, circTFRC verified the ring structure and biological function of human circTFRC, and found that after intervening in circTFRC expression, it could significantly affect the proliferation ability, activity and ferroptosis-related indicators of LECs, providing a new selective target for the molecular regulation of the occurrence and development of ARC. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the technical solution of the present invention, the drawings required for use in the description of the specific implementation methods will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0015] Figure 1 Identification of the circTFRC ring structure in the embodiments of the present invention;

[0016] Figure 2 After overexpression of circTFRC in the embodiment of the present invention, the expression efficiency is detected;

[0017] Figure 3 After interfering with circTFRC in the embodiment of the present invention, interference efficiency detection;

[0018] Figure 4 The CCK-8 method was used to detect the effect of circTFRC on the viability of SRA01 / 04 cells in the examples of the present invention;

[0019] Figure 5 The effect of circTFRC on the proliferation of SRA01 / 04 cells was detected by EdU in the present invention;

[0020] Figure 6In the present invention, the cell fluorescence was used to detect the effect of circTFRC on Fe 2+ The influence of content;

[0021] Figure 7 The effect of circTFRC on the ROS content in SRA01 / 04 cells was detected by cell fluorescence in the examples of the present invention;

[0022] Figure 8 Western blot was used to detect the effect of circTFRC on the expression of GPX4, a marker of ferroptosis in SRA01 / 04 cells in the present invention;

[0023] Fig. 9 The effect of circTFRC on the mitochondrial morphology in SRA01 / 04 cells was observed by transmission electron microscopy in the examples of the present invention;

[0024] Fig.10 In the example of the present invention, Western blot was used to detect the effect of circTFRC on the p62 / Keap1 / Nrf2 signaling pathway. DETAILED DESCRIPTION

[0025] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0026] Experimental materials and their sources:

[0027] 1. RNA extraction and RT-qPCR

[0028] (1) TRIzol RNA extraction reagent (Invitrogen, USA)

[0029] (2) Chloroform (MCE, USA)

[0030] (3) Isopropyl alcohol (MCE, USA)

[0031] (4) Anhydrous ethanol (MCE, USA)

[0032] (5) DEPC water (MCE, USA)

[0033] (6) Primers (Genepharma, China)

[0034] (7) HiScript III RT SuperMix for qPCR (+gDNAwiper) (Novozymes, China)

[0035] (8) ChamQ Universal SYBR qPCR MasterMix (High ROX Premixed) (Novozymes, China)

[0036] 2. Protein extraction and protein concentration determination

[0037] (1) RIPA lysis buffer (strong, without inhibitors) (Beyotime, China)

[0038] (2) Protease inhibitors (Beyotime, China)

[0039] (3) Phosphatase inhibitors (Solarbio, China)

[0040] (3) 5× loading buffer (Beyotime, China)

[0041] (4) BCA protein assay kit (Invitrogen, USA)

[0042] 3. Reagents required for Western blot

[0043] (1) SDS-PAGE gel rapid preparation kit (Yazyme, China)

[0044] (2)Marker (Biyuntian, USA)

[0045] (3) Tris (Solarbio, China)

[0046] (4) Glycine (Solarbio, China)

[0047] (5) Methanol (Sigma, USA)

[0048] (6) PVDF / NC membrane (Millipore, USA)

[0049] (7) Tween-20 (Solarbio, China)

[0050] (8) NaCl (Sangon Biotech, China)

[0051] (9) Skimmed milk powder (Yili, China)

[0052] (10) Universal antibody diluent (Beyotime, China)

[0053] (11) Rabbit anti-FLAG antibody (Abcam, UK)

[0054] (12) Rabbit anti-GPX4 antibody (Abcam, UK)

[0055] (13) Rabbit anti-ACSL4 antibody (Abcam, UK)

[0056] (14) Rabbit anti-TUBLIN antibody (Abcam, UK)

[0057] (15) Rabbit anti-β-Actin antibody (Abcam, UK)

[0058] (16) Rabbit anti-GADPH antibody (Abcam, UK)

[0059] (17) Rabbit anti-p62 antibody (Abcam, UK)

[0060] (18) Rabbit anti-Keap1 antibody (Abcam, UK)

[0061] (19) Rabbit anti-Nrf2 antibody (Abcam, UK)

[0062] (20) Goat anti-rabbit IgG (HRP) (ABclonal, China)

[0063] (21)SuperKine TM Ultra-sensitive ECL luminescent liquid (Abbkine, China)

[0064] 4. Cell culture reagents

[0065] (1) PBS buffer (Beyotime, China)

[0066] (2) DMEM (Keygene, China)

[0067] (USA)

[0068] (4) 0.25% trypsin solution (Gibco, USA)

[0069] (5) Penicillin-streptomycin-amphotericin antibiotic solution (HyClone, USA)

[0070] (6) Cell culture flasks / dishes / plates (NEST, China)

[0071] (7) 2 mL cryotube (Corning, USA)

[0072] (8) Centrifuge tube (Corning, USA)

[0073] (9) Serum-free cell freezing medium (Beyotime, China)

[0074] 5. Cell transfection reagents

[0075] (1) Small interfering siRNA (Jisai, China)

[0076] (2) Overexpression plasmid (Jisai, China)

[0077] (3) Opti-MEM (Gibco, USA)

[0078] (4) Lipofectamine 3000 (Invitrogen, USA)

[0079] 6. Reagents required for cell proliferation, activity and ferroptosis detection

[0080] (1) CCK-8 kit (DOJINDO, Japan)

[0081] (2) EdU kit (RiboBio, China)

[0082] (3)ROS Assay Kit (DOJINDO, Japan)

[0083] (4) FerroOrange kit (DOJINDO, Japan)

[0084] (5) 4% paraformaldehyde solution (Sangon, China)

[0085] (6) Triton X-100 (Solarbio, China)

[0086] (7) Glycine (Solarbio, China)

[0087] (8) Flow cytometry tube (Beyotime, China)

[0088] (9) Hoechst 33342 (Beyotime, China)

[0089] 7. Reagents required for electron microscopy

[0090] (1) Electron microscopy fixative (Sevier, USA)

[0091] (2) Acetone (Sinopharm Chemical Company, China)

[0092] (3) 812 embedding medium (SPI, USA)

[0093] (4) Osmium acid (Ted Pella Inc, USA)

[0094] 8. Reagents required for sucrose density gradient analysis

[0095] (1) Polysome profiling sucrose buffer: 25mM Tris-HCl, pH 7.4, 150mM NaCl, 5mM MgCl 2 ,1mM DTT,1×protease inhibitor cocktail[EDTA free],40U of RNaseinhibitor,and 100μg / mL CHX.

[0096] (2) Polysome profiling cell lysis buffer: 25mM Tris-HCl, pH 7.4, 150mM NaCl, 5mM MgCl 2 , 1mM DTT, 1×protease inhibitor cocktail [EDTA free], 40U of RNaseinhibitor, 1% sodium deoxycholate, 0.5% NP40.

[0097] Example 1: Cell culture and construction of oxidative damage cell model

[0098] The process strictly controls aseptic operation, and the specific steps are as follows:

[0099] 1. Cell recovery

[0100] (1) Take the frozen cells out of the -80°C freezer and immediately place them in a 37°C constant temperature water bath to completely thaw;

[0101] (2) The cells were aspirated and placed in a 15 mL centrifuge tube. Complete culture medium (prepared in a volume ratio of DMEM: FBS: penicillin-streptomycin-amphotericin antibiotics = 90:10:1, hereinafter referred to as complete culture medium) was added at a ratio of 1:3, and centrifuged at room temperature and 1,500 rpm for 5 minutes.

[0102] (3) Discard the supernatant, add the culture medium, and gently pipette to evenly disperse the cells;

[0103] (4) These cells were inoculated into culture flasks and placed in a sterile incubator at 37°C for further culture.

[0104] 2. Cell passaging

[0105] (1) When the cells grow to 80% to 90%, wash the cells 2 to 3 times with PBS;

[0106] (2) Add an appropriate amount of trypsin to digest the cells. When the cell bodies become brighter and the gaps between cells increase significantly under the microscope, quickly add the complete culture to terminate the cell digestion process.

[0107] (3) Transfer the cells to a 15 mL centrifuge tube and centrifuge at 1,500 rpm for 5 minutes at room temperature;

[0108] (4) Discard the supernatant, add the culture medium, and gently pipette to evenly disperse the cells;

[0109] (5) These cells were inoculated into culture flasks and placed in a sterile incubator at 37°C for further culture.

[0110] 3. Cell cryopreservation

[0111] (1) The digested cells were centrifuged, the supernatant was removed, and 1 mL of serum-free cell freezing solution was added. The cells were blown evenly and transferred into a cryopreservation tube.

[0112] (2) Label the freezing time, cell name and generation number and store in a -80℃ freezer.

[0113] 4. Construction of oxidative damage cell model

[0114] (1) When the cells in the culture dish have grown to 80%, wash the cells 2-3 times with PBS and add an appropriate amount of complete culture and 5% H 2 O 2 Prepared to 100 μM HO 2 O 2 The mixture was added to the culture dish;

[0115] (2) Place in a 37°C cell culture incubator and continue culturing.

[0116] Example 2: Cell transfection

[0117] 1. siRNA transfection

[0118] (1) Inoculate an appropriate amount of cells onto a 6-well plate and transfect when the cells reach 70% to 80% confluency;

[0119] (2) Dilute Lipofectamine 3000 and siRNA in tube 1 and tube 2 respectively with Opti-MEM;

[0120] (3) Mix the diluted Lipofectamine 3000 and siRNA in equal proportions and react for 15 minutes;

[0121] (4) Replace the cells with fresh DMEM. Add 1.25 mL of DMEM to each well of a 6-well plate and add the transfection mixture to the culture plate. Replace the culture medium (without antibiotics) after 6 hours and incubate the cells in a cell culture incubator for 24 to 48 hours.

[0122] (5) siRNA sequence (purchased from China Jisai Company):

[0123] si-circTFRC-001: 5'-CTGCAACAGTTACTGTTCT-3'

[0124] si-circTFRC-002:5'-CAACAGTTACTGTTCTTCT-3'

[0125] si-circTFRC-003: 5'-ACAGTTACTGTTCTTCTGT-3'

[0126] 2. Overexpression plasmid transfection

[0127] (1) Inoculate an appropriate amount of cells in a 6-well plate and transfect when the cells reach 80% to 90% confluency;

[0128] (2) Dilute 7.5 μL of lipofectamine 3000 with 125 μL of Opti-MEM in tube 1 and mix gently;

[0129] (3) Dilute 2.5 μg DNA (purchased from China Gisai Co., Ltd.) and 15 μL P3000 in tube 2 with 125 μL Opti-MEM and mix gently;

[0130] (4) Mix the reagents in steps (2) and (3) and incubate at room temperature for 15 minutes;

[0131] (5) Replace the cells with fresh DMEM, add 1.25 mL DMEM to each well, and add the transfection mixture to a 6-well plate. Replace the medium (without antibiotics) after 6 hours and incubate in a cell culture incubator for 24 to 48 hours.

[0132] Example 3: Amplification and determination of circTFRC and its nucleotide sequence using PCR

[0133] (1) Sample processing:

[0134] 1) SRA01 / 04 cells: Wash the cells three times with PBS, add 1 mL of Trizol, and transfer the cells to a 1.5 mL centrifuge tube;

[0135] 2) Human lens anterior capsule: Take out the anterior capsule immersed in Trizol from a -80°C refrigerator;

[0136] (2) Add 200 μL of chloroform and shake vigorously for 30 seconds to fully mix the chloroform and the sample. Let it stand for 2 minutes to allow the components to separate. Centrifuge at 12,000 rpm for 20 minutes at 4°C. After centrifugation, carefully remove the supernatant.

[0137] (3) Add 500 μL of isopropanol, mix well and let stand for 10 minutes. Centrifuge at 12,000 rpm for 20 minutes at 4°C. After centrifugation, carefully remove the supernatant.

[0138] (4) Add 1 mL of 75% ethanol and centrifuge at 7,500 rpm for 5 minutes at 4°C. After centrifugation, carefully remove the supernatant.

[0139] (5) The sample was left to stand at room temperature for 10 minutes to ensure that it was fully dried, and then an appropriate amount of DEPC water was added to dissolve it.

[0140] 2. Preparation of cDNA

[0141] (1) Before reverse transcription, the concentration and purity of RNA were measured using a Nanodrop 2000 spectrophotometer;

[0142] (2) Prepare cDNA according to the instructions of the reverse transcription kit;

[0143] (3) After reverse transcription, store in a -80℃ refrigerator.

[0144] 3. Real-time quantitative PCR

[0145] (1) Place cDNA on ice and prepare the reaction system as shown in Table 1:

[0146] Table 1 qRT-PCR reaction system

[0147]

[0148] (2) Carry out PCR experiment according to the reaction conditions in Table 2:

[0149] Table 2 PCR reaction conditions

[0150]

[0151] (3) Record the Ct value and use 2 -△△Ct Analyze the expression of target molecules.

[0152] (4) The primer sequences are as follows:

[0153] circTFRC F: 5'-AAGGCTGCAACAGTTACTGTTCT-3'

[0154] R: 5'-TTATCGCCATCTACTTGCCG-3'

[0155] The obtained PCR product was cut into a band of the same size as the target gene for gel recovery, and the recovered product was sent to BGI for Sanger sequencing. Figure 1 As shown in A, the obtained sequence circTFRC is 710 bp in length, and its nucleotide sequence is as follows:

[0156] >hsa_circ_0068626|NM_003234|TFRC

[0157] GTTCTTCTGTGTGGCAGTTCAGAATGATGGATCAAGCTAGATCAGCATTC

[0158] TCTAACTTGTTTTGGTGGAGAACCATTGTCATATACCCGGTTCAGCCTGGC

[0159] TCGGCAAGTAGATGGCGATAACAGTCATGTGGAGATGAAACTTGCTGTA

[0160] GATGAAGAAGAAAATGCTGACAATAACACAAAGGCCAATGTCACAAAA

[0161] CCAAAAAGGTGTAGTGGAAGTATCTGCTATGGGACTATTGCTGTGATCGT

[0162] CTTTTTCTTGATTGGATTTATGATTGGCTACTTGGGCTATTGTAAAGGGGT

[0163] AGAACCAAAAACTGAGTGTGAGAGACTGGCAGGAACCGAGTCTCCAGT

[0164] GAGGGAGGAGCCAGGAGAGGACTTCCCTGCAGCACGTCGCTTATATTGG

[0165] GATGACCTGAAGAGAAAGTTGTCGGAGAAACTGGACAGCACAGACTTC

[0166] ACCGGCACCATCAAGCTGCTGAATGAAAATTCATATGTCCCTCGTGAGG

[0167] CTGGATCTCAAAAAGATGAAAATCTTGCGTTGTATGTTGAAAATCAATTT

[0168] CGTGAATTTAAACTCAGCAAAGTCTGGCGTGATCAACATTTTGTTAAGAT

[0169] TCAGGTCAAAGACAGCGCTCAAAACTCGGTGATCATAGTTGATAAGAAC

[0170] GGTAGACTTGTTTACCTGGTGGAGAATCCTGGGGGTTATGTGGCGTATAGTAAGGCTGCAACAGTTACT.

[0171] Example 4: Proof of circTFRC ring structure using qPCR and actinomycin D half-life assay

[0172] Cells in the logarithmic growth phase were plated in 6-well plates. After the cells adhered to the wall, actinomycin D (2 μg / mL) was added to inhibit the synthesis of cellular RNA. The cells were cultured in an incubator. The cells to which actinomycin D was added at 0, 4, 8, 12, and 24 hours were collected, and the cellular RNA was extracted to detect the RNA expression of circTFRC and its corresponding linear transcript TFRC. Figure 1 As shown in B. The results showed that the expression of the TFRC gene, which represents the linear transcript, decreased significantly, while the relative expression of the circTFRC transcript increased significantly. This is because actinomycin D effectively inhibited the synthesis of TFRC mRNA but failed to inhibit the circular structure of circTFRC, indicating that circTFRC is more stable and has a longer half-life than the parent gene TFRC in SRA01 / 04 cells.

[0173] Example 5: Detecting the effects of overexpression or interference of circTFRC on the proliferation ability and viability of LECs

[0174] According to different test requirements, the cells in Example 1 were inoculated into different types of cell culture dishes. When the cell density reached 70%, the overexpression plasmid and si-circTFRC (si-NC as a control) were transfected into the cells respectively. After transfection, the cells were cultured continuously until the cell density reached about 80%, and the cells were processed for subsequent tests.

[0175] 1. CCK-8 detection of SRA 01 / 04 cell proliferation

[0176] (1) SRA 01 / 04 cells in the logarithmic phase were inoculated into 96-well plates. When the cell density reached 60%, SRA 01 / 04 cells were transfected with overexpression plasmid and si-circTFRC and continued to be cultured;

[0177] (2) When the density of SRA 01 / 04 cells reaches about 80%, use complete culture medium to prepare CCK8 dilution solution at a ratio of 10%; discard the complete culture medium in the 96-well wells, add 100 μL of CCK8 dilution solution to each well; continue to culture in the incubator for 4 hours;

[0178] (3) Use an ELISA reader to measure the OD value at a wavelength of 450 nm (the operation should be performed in a dark environment) and perform statistical analysis;

[0179] (4) The calculation formula is: SRA01 / 04 cell proliferation percentage = [(AC) / (BC)] × 100%, A: absorbance value of the experimental group (the absorbance value of the medium, transfected SRA01 / 04 cells and CCK-8 solution) B: absorbance value of the control group (the absorbance value of the medium, transfected SRA 01 / 04 cells and CCK-8 solution) C: absorbance value of the blank group (the absorbance value of the medium and CCK-8 solution). Figure 4 As shown, the viability of SRA01 / 04 cells increased after knocking down circTFRC, and the viability of SRA01 / 04 cells increased after overexpressing circTFRC.

[0180] 2. EdU detection of SRA01 / 04 cell proliferation

[0181] (1) Inoculate cells (10 5 Each well was added with 300 μL of the diluted EdU mixture and incubated in a cell culture incubator at 37°C for 2 hours.

[0182] (2) Add 4% paraformaldehyde fixative to each well and fix for 30 minutes;

[0183] (3) Add 2 mg / mL glycine to each well, decolorize on a shaker for 5 minutes, and wash with PBS for 5 minutes;

[0184] (4) Add 0.5% Triton X-100 to each well, decolorize on a shaker for 10 minutes, and wash with PBS for 5 minutes;

[0185] (5) Prepare Apollo staining reaction solution according to the instructions;

[0186] (6) Add 300 μL of 1× Apollo staining reaction solution to each well and incubate in the dark for 30 minutes to decolorize.

[0187] (7) Add 0.5% Triton X-100 to each well and wash and destain on a shaker for 10 minutes. Repeat this process three times.

[0188] (8) Add Hoechst working solution to each well and incubate in the dark for 30 minutes;

[0189] (9) PBS buffer was added to each well for washing for 10 min, and this process was repeated 3 times;

[0190] (10) Take photos under a fluorescence microscope in a dark environment.

[0191] like Figure 5 As shown in the figure, the effect of circTFRC interference on the proliferation of SRA01 / 04 cells was analyzed by calculating the ratio of Hochest-stained and EdU-stained nuclei. Hochest can stain all cell nuclei, while EdU dye only stains the nuclei of proliferating cells. The cell proliferation rates of the two groups were analyzed by statistically calculating the ratio of EdU-stained nuclei to Hochest-stained nuclei in the circTFRC interference group and the control group. The quantitative analysis results are shown in the figure. Figure 5 As shown in B, the number of newly proliferated SRA01 / 04 cell nuclei in the circTFRC knockdown group was significantly reduced compared with the control group, indicating that circTFRC knockdown significantly inhibited the proliferation of SRA01 / 04 cells; the overexpression result was the opposite.

[0192] Example 6: Detection of the effect of overexpression or interference of circTFRC on ferroptosis of SRA01 / 04 cells

[0193] The SRA01 / 04 cells in Example 1 were seeded into 6-well plates until the cell density reached more than 60%, and the overexpression plasmid and si-circTFRC were transfected into the SRA01 / 04 cells respectively. After transfection, the SRA01 / 04 cells were cultured continuously until the cell density reached about 80% for subsequent experiments.

[0194] 1. Cell fluorescence detection of Fe 2+ concentration

[0195] (1) Cells (105 cells / well) were seeded in a 24-well plate and incubated at 37°C and 5% CO 2 Incubate overnight in an incubator;

[0196] (2) Discard the culture medium and wash the cells three times with PBS;

[0197] (3) Add FerroOrange working solution and incubate for 30 minutes in a dark place;

[0198] (4) Take photos under a fluorescence microscope in a dark environment.

[0199] like Figure 6 As shown, after H 2 O 2After treatment of SRA01 / 04 cells, intracellular Fe 2+ After knocking down circTFRC, the content of F e2+ Content reduced.

[0200] 2. Detection of ROS by cell fluorescence / flow cytometry

[0201] (1) SRA01 / 04 cells were seeded in 96-well plates or 6-well plates and incubated at 37°C and 5% CO 2 Culture in an incubator overnight;

[0202] (2) Discard the culture medium and wash the cells twice with PBS;

[0203] (3) Add Highly Sensitive DCFH-DADye working solution to each well and incubate at 37°C and 5% CO 2 Incubate in the incubator for 30 minutes;

[0204] (4) Remove the Highly Sensitive DCFH-DA Dye working solution and wash twice with PBS;

[0205] (5) After adding PBS again, the cells were detected using flow cytometry and fluorescence microscopy.

[0206] like Figure 7 As shown, after H 2 O 2 After treatment of SRA01 / 04 cells, the intracellular ROS content increased; while after knocking down circTFRC, the intracellular ROS content of SRA01 / 04 cells decreased.

[0207] 3. Detection of ferroptosis-related gene expression by Western blot assay

[0208] Western blot was used to detect the expression of ferroptosis marker protein GPX4.

[0209] like Figure 8 As shown, after H 2 O 2 After treatment of SRA01 / 04 cells, the expression of GPX4, a marker of cellular ferroptosis, was reduced; however, its expression was increased after knockdown of circTFRC.

[0210] 4. Transmission electron microscopy to observe mitochondrial morphology

[0211] (1) Collect the mung bean-sized cell pellet by centrifugation and discard the culture medium;

[0212] (2) Add an appropriate amount of electron microscopy fixative and resuspend; fix in a 4°C refrigerator for 2 to 4 hours;

[0213] (3) Add an appropriate amount of PBS and mix well, wash for 3 minutes, centrifuge, and encapsulate in agarose;

[0214] (4) Dehydrate in 30%-50%-70%-80%-95%-100%-100% alcohol for 20 minutes respectively, and repeat this process three times;

[0215] (5) Dehydrate in 100% acetone for 15 minutes, and repeat this process three times;

[0216] (6) Pour into the embedding plate and place in an incubator at 37°C overnight;

[0217] (7) Remove the embedding plate and slice it using an ultrathin slicer;

[0218] (8) Stain in 2% uranyl acetate saturated alcohol solution for 8 minutes in the dark;

[0219] (9) Observe and take pictures under a transmission electron microscope.

[0220] like Fig. 9 As shown, after H 2 O 2 In SRA01 / 04 cells, knockdown of circTFRC resulted in an increase in the volume of mitochondria, thickened membranes and increased cristae in SRA01 / 04 cells.

[0221] Example 7: Detection of the effect of circTFRC on the expression of genes related to the p62 / Keap1 / Nrf2 signaling pathway by Western blot assay

[0222] The SRA01 / 04 cells in Example 1 were seeded into 6-well plates until the cell density reached more than 60%, and the SRA01 / 04 cells were transfected with si-circTFRC. After transfection, the SRA01 / 04 cells were cultured continuously until the cell density reached about 80% for subsequent experiments.

[0223] like Fig.10 As shown, we have 2 O 2 In SRA01 / 04 cells treated with circTFRC-236aa, the expression of p62 was downregulated, the expression of Keap1 was upregulated, and the expression of Nrf2 was downregulated. Therefore, we speculate that the protein interaction between circTFRC-236aa and p62 can activate the Keap1-Nrf2 signaling pathway, thereby causing cell ferroptosis.

[0224] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A circRNA associated with the development of age-related cataracts, characterized in that: The circRNA is circTFRC. Overexpression of circTFRC inhibits the proliferation ability and activity of LECs, while interference with circTFRC expression promotes the proliferation ability and activity of LECs.

2. A circRNA associated with the development of age-related cataracts according to claim 1, characterized in that: The circTFRC has multiple ribosome binding sites.

3. The use of a circRNA associated with the development of age-related cataracts according to claim 1, characterized in that: The circTFRC and its nucleotide sequence were amplified and determined using the PCR method.

4. The use of a circRNA associated with the development of age-related cataracts according to claim 1, characterized in that: The circTFRC circular structure was confirmed by qPCR and actinomycin D half-life assay.

5. The use of a circRNA associated with the development of age-related cataracts according to claim 1, characterized in that: Effects of overexpression or interference of circTFRC on the proliferation ability and viability of LECs.

6. The use of a circRNA associated with the development of age-related cataracts according to claim 1, characterized in that: Effects of overexpression or interference of circTFRC on ferroptosis of SRA01 / 04 cells.

Images