Application of epidermal protein gene SlituCP26 in prevention and treatment of cotton bollworm

By inhibiting the expression of the cuticular protein gene SlituCP26 of Spodoptera litura and silencing its expression using RNAi technology, the problem of Spodoptera litura's penetrating resistance to indoxacarb was solved, the effectiveness of the insecticide was improved, and a method for resistance detection was provided.

CN119410649BActive Publication Date: 2025-10-10HUNAN AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411633436.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-15
Publication Date
2025-10-10
Estimated Expiration
2044-11-15

AI Technical Summary

Technical Problem

The Spodoptera litura moth has developed resistance to insecticides such as indoxacarb, and existing technologies have failed to effectively address the problem of its cuticle resistance to insecticide penetration.

Method used

RNAi technology was used to inhibit the expression of the cuticular protein gene SlituCP26 of Spodoptera litura, reducing its penetrating resistance to indoxacarb. dsRNA was injected into the larvae of Spodoptera litura to silence the expression of the SlituCP26 gene.

Benefits of technology

The method significantly improves the penetration effect of indoxacarb, increases the insecticidal efficiency, reduces the mortality rate of Spodoptera litura larvae, and provides a method for detecting the insecticide resistance of Spodoptera litura.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119410649B_ABST
    Figure CN119410649B_ABST
Patent Text Reader

Abstract

The application discloses application of an epidermal protein gene SlituCP26 in prevention and treatment of Spodoptera litura, and relates to the technical field of biotechnology.The nucleotide sequence of the SlituCP26 gene is shown as SEQ ID NO:1, the gene is highly expressed in indoxacarb-resistant strains, the dsRNA of the gene is prepared, and the dsRNA is microinjected into the bodies of Spodoptera litura larvae; after the injection, the expression level of the SlituCP26 gene is significantly reduced, the body size of the larvae is obviously reduced, the epidermal thickness is significantly thinned, and the sensitivity to indoxacarb is significantly improved.The application further provides a SlituCP26 gene promoter, and the difference on the sequence amplified through the promoter can be used for detecting the drug resistance of Spodoptera litura.The application confirms that the epidermal protein SlituCP26 gene is involved in the action of Spodoptera litura to insecticides and the formation process of the resistance mechanism, and has theoretical significance for development of new insecticides.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and more specifically, relates to application of a cuticle protein gene SlituCP26 in preventing and controlling Spodoptera litura. Background Art

[0002] The fall armyworm (Spodoptera litura) is a voracious, intermittently rampant, and significant agricultural pest, causing severe damage to numerous commercial crops in my country. Due to extensive use of insecticides for chemical control, field populations of S. litura have developed significant resistance to multiple insecticides. Indoxacarb, a new oxadiazine insecticide, possesses a unique mechanism of action and highly effective insecticidal activity. However, the long-term, extensive use of indoxacarb for control of S. litura has inevitably led to the development of resistance.

[0003] To date, various mechanisms of insecticide resistance have been proposed, primarily including penetration resistance, metabolic resistance, target resistance, and behavioral resistance. Penetration resistance refers to reduced insecticide penetration by altering cuticle composition or increasing cuticle thickness. The insect cuticle is the first major defense barrier against insecticide penetration and is primarily composed of chitin and cuticular proteins.

[0004] Cuticular proteins are important structural proteins in the insect cuticle. They possess chitin-binding domains and can bind to chitin to form a lamellar structure within the insect cuticle. Numerous cuticular protein genes have been identified in insects, and numerous studies have confirmed that cuticular proteins participate in multiple physiological processes, including insect growth and development and stress adaptation, primarily by regulating the cuticle or influencing cuticular synthesis. Recent studies have shown that high expression of different cuticular protein genes in various insect-resistant strains is closely associated with penetrating resistance to insecticides. Currently, 287 cuticular protein genes from nine CP families have been identified in the Spodoptera litura genome. However, the molecular functions of these cuticular protein genes and their mechanisms of action in insecticide resistance remain unclear and require further investigation. Summary of the Invention

[0005] Based on the above technical problems existing in the prior art, the purpose of the present invention is to provide an application of the cuticular protein gene SlituCP26 in controlling Spodoptera litura, reducing the resistance of Spodoptera litura to insecticides by inhibiting the expression of SlituCP26, and detecting the resistance of Spodoptera litura to insecticides.

[0006] In order to achieve the above object, the technical solution of the present invention is as follows:

[0007] The SlituCP26 gene is used as a target in controlling Spodoptera litura. The nucleotide sequence of the SlituCP26 gene is shown in SEQ ID NO: 1.

[0008] Furthermore, RNAi technology was used to inhibit the expression of the cuticular protein gene SlituCP26 of Spodoptera litura, thereby reducing the penetration resistance of Spodoptera litura to indoxacarb.

[0009] Furthermore, the RNAi technology includes: using the cloned partial sequence of the SlituCP26 gene as a template, then performing PCR amplification using primers containing a T7 polymerase promoter sequence, recovering the amplified product by gel, synthesizing dsRNA in vitro, and purifying the target dsRNA using a dsRNA purification kit.

[0010] Furthermore, the nucleotide sequence of the partial sequence of the SlituCP26 gene is shown in SEQ ID NO: 14.

[0011] Furthermore, the primers containing the T7 polymerase promoter sequence include: an upstream primer as shown in SEQ ID NO: 5, and a downstream primer as shown in SEQ ID NO: 7.

[0012] A SlituCP26 gene promoter related to insecticide resistance of Spodoptera litura, the nucleotide sequences of which are shown in SEQ ID NO: 2 and SEQ ID NO: 3.

[0013] A pair of primers for amplifying the SlituCP26 gene promoter have the following nucleotide sequences: the upstream primer is shown in SEQ ID NO: 4, and the downstream primer is shown in SEQ ID NO: 6.

[0014] A method for detecting insecticide resistance in Spodoptera litura, comprising: using Spodoptera litura population DNA as a template, cloning the corresponding promoter fragment sequence by PCR, and comparing the fluorescence activity and sequence length of the SlituCP26 gene promoter; wherein, the fluorescence activity of the sensitive population is lower than that of the resistant population; and the sequence length of the resistant population is 74bp longer than that of the sensitive population.

[0015] Furthermore, the nucleotide sequences of the PCR primers are as follows: the upstream primer is shown in SEQ ID NO: 8, and the downstream primer is shown in SEQ ID NO: 9.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention verifies the role of the cuticle protein gene SlituCP26 in controlling Spodoptera litura. By inhibiting its expression, the penetration effect of indoxacarb can be enhanced, thereby improving the insecticidal efficiency. The present invention also provides a dsRNA capable of interfering with the expression of SlituCP26 in Spodoptera litura. After injecting the corresponding dsRNA of the SlituCP26 gene into the larvae of Spodoptera litura, the expression level of the SlituCP26 gene was significantly reduced, the larvae were significantly smaller, the cuticle thickness was significantly thinner, and after treatment with indoxacarb, the larval mortality rate was significantly increased. It can be seen that this dsRNA can significantly inhibit or silence the expression of SlituCP26, reducing the penetration resistance of Spodoptera litura to indoxacarb, indicating that the SlituCP26 gene is involved in the function of Spodoptera litura to resist insecticides and can serve as a potential target for the control of resistant pests.

[0018] The present invention provides a method for detecting insecticide resistance of Spodoptera litura. The SlituCP26 promoter sequence differs between sensitive and resistant populations, and dual-luciferase reporter analysis finds that the activity of the resistant promoter is significantly higher than that of the sensitive population. Research on the promoter region upstream of this gene will help to gain a deeper understanding of the formation process of the resistance mechanism of Spodoptera litura, and can also be used to detect whether Spodoptera litura has developed resistance to indoxacarb.

[0019] The present invention provides a theoretical basis for monitoring and controlling insecticide resistance and developing new insecticides. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 is the expression level of SlituCP26 gene in different strains of Spodoptera litura;

[0021] Note: The results are shown as the mean and standard error of three biological replicates; asterisks on the error bars indicate significant differences (P < 0.05).

[0022] Figure 2 To test the silencing efficiency of Spodoptera litura SlituCP26 gene;

[0023] Note: The results are shown as the mean and standard error of three biological replicates; asterisks on the error bars indicate significant differences (P < 0.05).

[0024] Figure 3 Morphological observation of Spodoptera litura larvae after silencing the SlituCP26 gene.

[0025] Figure 4 Detection of cuticle thickness of Spodoptera litura larvae after silencing the SlituCP26 gene;

[0026] Note: The results are shown as the mean and standard error of three biological replicates; asterisks on the error bars indicate significant differences (P < 0.05).

[0027] Figure 5 Sensitivity test of Spodoptera litura larvae to indoxacarb after silencing the SlituCP26 gene;

[0028] Note: The results are shown as the mean and standard error of three biological replicates; asterisks on the error bars indicate significant differences (P < 0.05).

[0029] Figure 6 Schematic diagram of the differential analysis of the SlituCP26 gene promoter sequence in sensitive and resistant populations.

[0030] Figure 7 Comparison of the differences in promoter activity of the sensitive and resistant SlituCP26 genes;

[0031] Note: The results are shown as the mean and standard error of three biological replicates; different letters on the error bars indicate significant differences (P<0.05). DETAILED DESCRIPTION

[0032] To make the purpose, technical solutions and advantages of the present invention clearer, the present invention will be described in further detail below in conjunction with embodiment, but embodiments of the present invention are not limited thereto. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present invention. The terms used herein in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. It should be noted that, unless otherwise specified, reagents used in the present embodiment, etc., are all common commercially available products.

[0033] In the examples herein, the susceptible Spodoptera litura strain (SS) was obtained from the Institute of Zoology, Chinese Academy of Sciences, and was raised indoors without exposure to any pesticides. The indoor indoxacarb-resistant strain (InRS) of Spodoptera litura was developed by the Pesticide Laboratory of Hunan Agricultural University through long-term screening of the SS strain with indoxacarb. Its resistance to indoxacarb was 58.39-fold. Both strains were maintained in separate, indoor incubators on an artificial diet, following strict maintenance standards: temperature of 25±2°C, relative humidity of 65±5%, and a 14:10 h light-dark cycle.

[0034] Example 1: Acquisition of the Spodoptera litura SlituCP26 gene

[0035] Total RNA was extracted from SS larvae using an RNA extraction kit from Acryl (formerly Acryl). Reverse transcription was performed using a cDNA synthesis kit with gDNA Clean for cloning the SlituCP26 gene. The full-length cloning primers for SlituCP26 were: F: AATTCTCAATCTATCGC (SEQ ID NO: 10), R: CTATCCCGATCTTAATTCCAA (SEQ ID NO: 11). The PCR amplification product was subjected to 1% agarose gel electrophoresis and the target gene was recovered using the FastPure Gel DNA Extraction Mini Kit from Novagen Biotech. SlituCP26 was sequenced by Beijing Qingke Biotechnology Co., Ltd., and the sequence is:

[0036] ATGGCCGCTAAGTTCGTCGTAGTTCTCGCCCTCGTGGCTGCAG

[0037] CTCACTGCTCCGTGGTGCCAGTGGCGCGAGTAGACGCCGACTA

[0038] CACCAGCTTCGCATACGACGTGGCCGACCCCAACACCGGCGAC

[0039] TTCAAAAGCCAGGTGGAGACCCGCGTGGGCGGCAACGTGGCC

[0040] GGCCAGTACTCGCTGCTTGACGCTGACGGCACCAAGCGCACCG

[0041] TGGACTACACCGCTGACGATGTCAATGGATTCAATGCTGTAGT

[0042] GCGCAAGGACCCCGCTGTAGTGGCTGCTGCTCCTGCTGTAGTA

[0043] GCTGCCGCTCCCGCGGTAGTGGCTGCCCGTACTGTGGCTGCCC

[0044] CAGCAGCTGTCGTCGCTGCATCACCTGCAGTTGTTGCTGCTCGC

[0045] ACTGTCGCTGGTCCCGCAGTAGTCACACGTACTTATGCCGCAG

[0046] CCCCCGCATACTATGCAGCCCGCTCTTACGCCGCTCCTGCCGTC

[0047] TATGCTGCCAGTGCTCCCGTTGTAGCCGCGCGCACCGTTGCTG

[0048] CTCCTGTTGCATACACCGCTGGTGCCCGCCTTGCCTATACCGCT

[0049] GGTGCTCCAGTTGCCTACACAGCTAGTGCTCCAGTAGCCTACG

[0050] CTGCCGGTGCGCGTTTCATCGCTCCCTCTGTGTACGCCGCCCGC

[0051] GTGGCTGCCGCCCCCGCCGTGTACTCTGGTGCCGCCTACTACG

[0052] GATCTCCTCTGACCTATGCCGCCTACTCCGCTCCAATCTCGTAT

[0053] TGCTCGATGTCTAAAAAGAAAAGATGTCTGCAAAGACATAGA

[0054] GGATCAGCAATGGCAGCCAAGTTCGTAGTTCTCGCCGCCCTAG

[0055] TGGCCATGGCTCACTGCTCCGTGGTGCCAGTGGCGCGAGTAGA

[0056] CGCCGACTACACCAGCTTCGCATACGACGTGGCCGACCCCAAC

[0057] ACCGGCGACTTCAAGAGCCAGGTGGAGACCCGCGTGGGCGGC

[0058] AACGTGGCCGGCCAGTACTCGCTGCTTGACGCTGACGGCACCA

[0059] AGCGCACCGTGGACTACACCGCTGACGATGTCAATGGATTTAA

[0060] CGCTGTGGTGCGCAAGGACCCCGCTGTAGTAGCTTCCGTGGTG

[0061] GCCGCGCCCGTGGTGGCTGCCCCCGCTGTGGCCGCGCCCGCTG

[0062] TTATCGCTGCCCGCACTGTGGCCCGCTCCCGCTGTCTACGCCGCT

[0063] CACGCCGCTCCCGCTGTCTACGCCGCTCACGCCGCCCCCGCCG

[0064] TGTACGCCGCTCACTCCGCTCCCGTCTACGCCGCTCCCTCTTTC

[0065] TACTCGTACGGTGCTCCCGCCCTATACTCCGCTCCCCTCACTTACGCCGCTAAGTGGTAA (SEQ ID NO: 1).

[0066] Example 2: Detection of expression levels of Spodoptera litura SlituCP26 in different strains

[0067] Total RNA was extracted from SS and InRS larvae using an RNA extraction kit from Acrocell and reverse transcribed using the Evo M-MLVRT kit with gDNAClean for qPCR. qPCR primers for SlituCP26 were designed using Primer 3.0 (http: / / frodo.wi.mit.edu / ): F: CACACGTACTTATGCCGCAG (SEQ ID NO: 12) and R: ACACAGAGGGAGCGATGAAA (SEQ ID NO: 13). qPCR reactions were performed on an ABI-7500 Fast Real-Time PCR System using a 2×T5 Fast qPCR Mix kit. -ΔΔCt The results are shown in Figure 2. Figure 1 As shown in the figure, the expression level of SlituCP26 in the InRS indoxacarb-resistant line was significantly upregulated by 155.3 times.

[0068] Example 3: In vitro synthesis of SlituCP26 gene dsRNA

[0069] The cloned full-length sequence of SlituCP26 gene was used as a template, and a partial sequence (SEQ ID NO: 14) was selected to design dsRNA synthesis primers (F: CAGCAATGGCAGCCAAGT (SEQ ID NO: 4); F+T7: GGATCCTAATACGACTCAC TATAGG CAGCAATGGCAGCCAAGT (SEQ ID NO: 5); R: TAGCGGCGTAAGTGAGGG (SEQ ID NO: 6); R+T7:

[0070] GGATCCTAATACGACTCACTATAGG TAGCGGCGTAAGTGAGGG (SEQ ID NO: 7)) was amplified by PCR, and the product was subjected to 1% agarose gel electrophoresis, and the target gene was recovered using the FastPure GelDNA Extraction Mini Kit of Novagen Biotech. A plasmid containing GFP was used as a template as a control group.

[0071] Promega's T7 RiboMAX TM The Express RNAi System synthesizes and purifies dsRNA.

[0072] The dsRNA corresponding to the gene fragment of SlituCP26 was named dsSlituCP26, and the dsRNA obtained from the plasmid containing GFP was named dsGFP.

[0073] (SEQ ID NO: 14)

[0074] Example 4: Functional Analysis of the SlituCP26 Gene in Insecticide Resistance in Spodoptera litura

[0075] The dsRNA was injected into the third-instar larvae of Spodoptera litura using the injection method. Three biological replicates were set up in each group, and 30 to 40 larvae were injected in each replicate. Each larva was injected with 6 μg of dsRNA. After 24 hours of normal culture in a light incubator, the surviving larvae were collected, and total RNA was extracted from some of them to detect the expression level of the target gene; some larvae were treated with indoxacarb (LC) by feed immersion method. 50: 37.37 mg / L) sensitivity assay; epidermis of selected larvae was immediately fixed in a 1.5 mL centrifuge tube containing 2.5% glutaraldehyde, placed in a 4°C refrigerator, and fixed with 1% osmium phosphate solution for 1-2 hours. The osmium phosphate waste solution was carefully removed and rinsed three times with 0.1 M phosphate buffer (PBS, pH 7.4) for 15 minutes each. The samples were then dehydrated in 30%-100% acetone for 10 minutes each, infiltrated, embedded, and cut into 70-90 nm ultrathin sections using an ultramicrotome. The sections were then fished out using a copper mesh and stained with uranyl acetate for 8-15 minutes and lead citrate for 8-10 minutes. The epidermal structure and thickness were then observed using a Hitachi H-7650 transmission electron microscope.

[0076] 24 hours after the injection of dsSlituCP26 into Spodoptera litura larvae, the expression level of SlituCP26 in the larvae was detected. Figure 2 As shown in Figure 2, compared with the control group, after injection of dsSlituCP26, the expression level of SlituCP26 decreased significantly by 45.6%, achieving a good silencing efficiency. After the expression of SlituCP26 was successfully silenced in Spodoptera litura larvae, it was observed that the larvae were significantly smaller ( Figure 3 ), the thickness of the epidermis is significantly thinner ( Figure 4 The changes in the sensitivity of the larvae to indoxacarb were further tested. Figure 5 As shown in Figure 2, compared with the control group, after SlituCP26 was silenced, the mortality of Spodoptera litura larvae at 24 h and 48 h after indoxacarb treatment increased significantly by 17.8% and 19.3%, respectively ( Figure 5 The results showed that silencing SlituCP26 could reduce the cuticular penetration resistance of Spodoptera litura to indoxacarb.

[0077] Example 5: Cloning of the SlituCP26 gene promoter and fluorescence activity analysis

[0078] Based on the Spodoptera litura genome database, we searched for the upstream sequence of the SlituCP26 gene and designed primers. We cloned the corresponding promoter fragment sequence by PCR using DNA from susceptible and resistant Spodoptera litura populations as templates. The primers were F: CGCGTGTAGCTATTTAAG (SEQ ID NO: 8) and R: CATTGCGATAGATTGAGA (SEQ ID NO: 9). The cloned sequence was ligated, transformed, and sequenced. Figure 6 As shown, the promoter of the SlituCP26 gene in the resistant population has an additional 74 bp sequence insertion compared to the promoter in the sensitive population. The specific sequences of the sensitive and resistant populations are:

[0079]

[0080] GGTACC CGCGTGTAGCTATTTA (SEQ ID NO: 15), R: CCG CTCGAG CATTGCGATAGATTG (SEQ ID NO: 16) was ligated to the pGL4.10 expression vector. HEK-293T cells were grown in DEME medium (GibcoBRL, USA) containing 10% fetal bovine serum (InnerMongolia Opcel Biotechology, China), streptomycin and penicillin at 37°C and 5% carbon dioxide. The promoters of different strains (1 μg) and the reporter plasmid pGL4.73 (200 ng) were transfected into HEK-293T cells using G4000 Susfectin transfection reagent (Abm, Canada), and the empty PGL4.10 vector was used as a control. 48 hours after transfection, the cells were transfected with Firefly & Renilla detection kit (UElandy, China) was used to measure luciferase activity, and the results were as follows Figure 7 As shown, the promoters of both sensitive and resistant populations have fluorescence activity, but the activity of the resistant promoter is significantly higher than that of the sensitive population.

[0081] The above-described embodiments merely illustrate several implementations of the present invention, and while their descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the patent. It should be noted that a person skilled in the art would be able to make numerous variations and improvements without departing from the spirit of the present invention, all of which fall within the scope of protection of the present invention. Therefore, the scope of protection of the patent for this invention shall be determined by the appended claims.

Claims

1. Inhibit the cuticular protein of Spodoptera litura SlituCP26 Application of gene-expressed dsRNA in controlling Spodoptera litura, the SlituCP26 The nucleotide sequence of the gene is shown in SEQ ID NO: 1; the nucleotide sequence of the dsRNA is shown in SEQ ID NO:

14.

2. The use according to claim 1, characterized in that The preparation steps of the dsRNA include: SlituCP26 The gene was used as a template, and then PCR amplification was performed using primers containing T7 polymerase promoter sequences. The amplified product was recovered by gel and then dsRNA was synthesized in vitro. The target dsRNA was purified using a dsRNA purification kit.

3. The use according to claim 2, characterized in that The primers containing the T7 polymerase promoter sequence are: the upstream primer is shown in SEQ ID NO: 5, and the downstream primer is shown in SEQ ID NO:

7.

4. A method for detecting insecticide resistance of Spodoptera litura, characterized in that: The corresponding promoter fragment sequence was cloned by PCR using DNA of Spodoptera litura population as template and compared. SlituCP26 Gene promoter and sequence length; wherein, the sequence length of the resistant population is 74bp longer than that of the sensitive population, and the drug resistance is resistance to indoxacarb; the nucleotide sequences of the PCR primers are specifically: the upstream primer is shown in SEQ ID NO: 8, and the downstream primer is shown in SEQ ID NO: 9.

Citation Information

Patent Citations

  • Intersegmental membrane epidermis protein gene LmAbd1 of locusta migratoria and application of LmAbd1 in control of locusta migratoria

    CN107699569A

  • Application of ribavirin in prodenia litura prevention and control and method

    CN113100249A