Application of a GSW8 gene in regulating high temperature tolerance in rice
Through GSW8 gene editing, rice materials with different expression types were constructed, which solved the problem of rice sensitivity to high temperature, enhanced or reduced the high temperature tolerance of rice, and provided new genetic resources for the breeding of high temperature-resistant rice.
Patent Information
- Application Number
- CN202411481365.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-23
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2044-10-23
AI Technical Summary
Rice is sensitive to high temperatures, which leads to reduced yield and quality impacts. Existing technologies lack effective high-temperature-resistant genetic resources.
The GSW8 gene was used for gene editing to regulate the high temperature tolerance of rice by knocking out or overexpressing it, and GSW8-KO1, GSW8-KO2, GSW8-OE1 and GSW8-OE2 mutants and overexpression materials were constructed to enhance or reduce the high temperature tolerance of rice.
It significantly improves or reduces the high temperature tolerance of rice, provides new genetic resources and genetic materials, and provides breeding application value for cultivating new high temperature resistant rice varieties.
Smart Images

Figure CN119410653B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and in particular to an application of a GSW8 gene in regulating high temperature tolerance of rice. Background Art
[0002] Rice (Oryza sativa L.) is one of the world's major staple crops. In recent years, global warming and frequent high temperatures in summer have significantly reduced crop yields. Rice is highly sensitive to high temperatures. Studies have found that for every 1°C increase in average daily temperature, rice yield decreases by 3.2%. This is because high temperature stress accelerates rice plant growth, shortens the growth cycle, and reduces the number of effective tillers and panicles, thereby affecting rice yield and quality. High temperatures can also reduce rice leaves and leaf area, thereby impacting photosynthetic efficiency and growth. Furthermore, high temperature stress can alter flowering time, impair pollination efficiency, reduce seed set, and alter panicle shape, such as shortened panicle length and fewer grains per panicle. These factors all affect rice yield. Damage to chloroplast membranes caused by high temperature stress can impair chloroplast structure and hinder leaf photosynthesis, resulting in yellowing or whitening of rice leaves. In addition, high temperature stress will also change the morphology and density of rice root hairs, causing the root system to become shorter and the root mass to decrease, affecting the absorption of water and nutrients by the rice roots.
[0003] Exposure to high temperatures during the seedling stage can stunt rice growth and development, leading to albinism and even seedling death. High temperatures during the heading stage can directly reduce seed set, leading to reduced or even total rice yield. Therefore, discovering heat-tolerant genes in rice is crucial for developing new heat-tolerant rice varieties. Summary of the Invention
[0004] In order to address the above-mentioned deficiencies in the prior art, the present invention aims to provide an application of the GSW8 gene in regulating high temperature tolerance of rice, so as to enhance the high temperature tolerance of rice.
[0005] The technical solution of the present invention to solve the above technical problems is as follows: providing an application of a GSW8 gene in regulating high temperature tolerance of rice, wherein the nucleotide sequence of the GSW8 gene is shown in SEQ NO.1.
[0006] Furthermore, knocking out the GSW8 gene enhances rice's high temperature tolerance.
[0007] Furthermore, overexpression of the GSW8 gene reduced the high temperature tolerance of rice.
[0008] The present invention provides a preparation for regulating high temperature tolerance of rice, which comprises a GSW8 gene.
[0009] Furthermore, the formulation includes an agent capable of inhibiting the expression of the GSW8 gene.
[0010] Furthermore, the preparation also includes an agent capable of overexpressing the GSW8 gene.
[0011] The present invention also provides a method for preparing a high-temperature resistant rice variety, wherein the high-temperature resistant rice variety is prepared by knocking out the GSW8 gene.
[0012] The present invention has the following beneficial effects: The present invention discovered that the GSW8 gene responds to high temperature stress in rice. By constructing GSW8 knockout mutants (GSW8-KO1 and GSW8-KO2), as well as overexpression materials (GSW8-OE1 and GSW8-OE2), and then subjecting these mutants and overexpression materials to high temperatures at the seedling stage and observing plant survival rates, it was found that GSW8 negatively regulates rice's high temperature tolerance. Knocking out the GSW8 gene enhances rice's high temperature tolerance, while overexpressing the GSW8 gene reduces it. The present invention provides new genetic resources and genetic materials for improving rice's high temperature tolerance and cultivating new high-temperature-resistant varieties. The GSW8 gene disclosed herein has important breeding application value in regulating rice's high temperature tolerance. BRIEF DESCRIPTION OF THE DRAWINGS
[0013] Figure 1 The expression of GSW8 gene in different rice materials before and after high temperature treatment at seedling stage;
[0014] Figure 2 To analyze the expression of GSW8 gene induced by high temperature by quantitative PCR;
[0015] Figure 3 Schematic diagram of the GSW8 knockout target site and knockout plant mutation method;
[0016] Figure 4 Schematic diagram of the structure of the GSW8 knockout vector GSW8-BGK03;
[0017] Figure 5 Schematic diagram of the GSW8 overexpression vector structure;
[0018] Figure 6 This is the quantitative detection result of GSW8 overexpression plants;
[0019] Figure 7 Comparison of phenotypes of wild-type ZH11 and GSW8 knockout mutant before and after high temperature treatment;
[0020] Figure 8 Comparison of the phenotypes of wild-type ZH11 and GSW8 overexpressing materials before and after high temperature treatment. DETAILED DESCRIPTION
[0021] The following examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. In the examples, where specific conditions are not specified, the experiments were performed under conventional conditions or those recommended by the manufacturer. Reagents or instruments used, where the manufacturer is not specified, are commercially available conventional products.
[0022] Example 1 Expression of GSW8 gene in different rice materials before and after high temperature treatment at seedling stage
[0023] Eleven representative rice varieties, including Basmatil, CG14, DG, Kasalath, Lemont, LJ, NAMROO, NIP, R498, TM, and TUMBA, were seedled at normal temperatures for 14 days before being subjected to high-temperature treatment (45°C for 9 hours). RNA was extracted from leaves of each material under normal and high-temperature treatments, and transcriptome sequencing was performed to rapidly screen for differentially expressed genes under high and normal temperatures. Transcriptome data analysis revealed significant differences in the expression levels of the GSW8 gene under normal and high temperatures. Figure 1 As shown in the results, the expression of GSW8 gene was significantly downregulated in 11 representative rice varieties of different types after high temperature induction. Therefore, it is speculated that this gene may be involved in the high temperature stress response of rice.
[0024] Example 2 Expression of GSW8 gene after high temperature induction
[0025] Quantitative PCR was used to confirm the expression changes of the GSW8 gene after high temperature treatment. First, a pair of quantitative PCR primers Y1879-F and Y1880-R were designed on the CDS of the GSW8 gene using PrimerPremier 6 software. The primer sequences are as follows:
[0026] Y1879-F: 5'-GGTGGTTTCATTCTTGGAG-3' (SEQ ID NO. 2);
[0027] Y1880-R: 5'-CACATCTTGGGACCCTTTG-3' (SEQ ID NO. 3).
[0028] The wild-type R498 variety was cultured in a plant growth incubator at 28°C for 14 days and then transferred to a 45°C incubator for high-temperature treatment. After 0h, 0.5h, 1h, 3h, 6h, 12h and 24h of treatment, leaves were taken according to the kit instructions for RNA extraction and reverse transcription using the kit to obtain cDNA. Quantitative PCR kits were then used to analyze the expression of the GSW8 gene after different periods of high-temperature treatment using the above-mentioned quantitative primers. The results are shown in Figure 2. Figure 2As shown in the results, it was found that the expression level of GSW8 gene began to significantly down-regulate after 0.5h of high temperature treatment, and the expression level reached the lowest after 1h and 3h, and then the expression level began to return to normal levels, proving that GSW8 gene is involved in the high temperature stress response of rice.
[0029] Example 3 Construction of GSW8 gene knockout mutant
[0030] (1) CRISPR / Cas9 knockout target site selection
[0031] To obtain a complete loss-of-function mutant, we designed a knockout target site near the ATG in exon 1 of GSW8 (see Figure 3 , where the underline represents the PAM sequence; “.” represents the base deletion at that position; WT is the wild-type medium flower 11), and the target site sequence is: 5'-CCAACTAAGCAATGGCCTTT-3' (SEQ ID NO. 4).
[0032] (2) Construction of CRISPR / Cas9 knockout vector
[0033] The present invention uses a CRISPR / Cas vector construction kit, selects the CRISPR / Cas vector BGK03 suitable for rice, and constructs the GSW8 knockout vector GSW8-BGK03. The specific process is as follows:
[0034] ①Synthesize Oligo sequences and prepare Oligo dimers: Design Oligo-F and Oligo-R sequences corresponding to the kit based on the above target sequence. The sequences are as follows:
[0035] Oligo-F: 5'-TGTGGTGCCAACTAAGCAATGGCCTTT-3' (SEQ ID NO.5);
[0036] Oligo-R: 5'-AAACAAAGGCATGCTTAGTTGGCA-3' (SEQ ID NO. 6).
[0037] The above oligo primers were synthesized and dissolved in water to 10 μM. A reaction system (18 μL Buffer Anneal, 1 μL Oligo-F, 1 μL Oligo-R) was prepared. After mixing, the mixture was heated at 95°C for 3 min on a PCR instrument and then slowly decreased to 20°C at a rate of 0.2°C / s to obtain oligo dimers.
[0038] ② Ligating the oligo dimer to the BGK03 vector: Prepare a ligation reaction system (10 μL) on ice with the following formula: 1 μL Enzyme Mix, 2 μL BGK03 Vector, 1 μL oligo dimer, and 6 μL ddH2O. Mix thoroughly and incubate at room temperature for 1 hour to complete the ligation.
[0039] ③ E. coli transformation: Take the DH5α competent cell out of the -80°C refrigerator and thaw it on ice. Then add the ligation product from step ② above, mix gently, and let it stand on ice for 30 minutes; then heat shock in a 42°C water bath for 50 seconds, immediately return it to ice and let it stand for 2 minutes; add 900 μL of antibiotic-free LB liquid culture medium (formula see Table 1) to the centrifuge tube, mix well, and place it on a 37°C shaker at 180 rpm for 60 minutes; centrifuge at 3000 rpm for 3 minutes at room temperature to collect the bacterial solution, retain 80 μL of the supernatant (discard the rest), gently pipette to resuspend the bacteria, evenly spread it on an LB plate containing kanamycin resistance, and culture it in a 37°C incubator overnight.
[0040] Table 1 LB medium formula
[0041]
[0042] ④ Obtain the GSW8 knockout vector GSW8-BGK03 plasmid: Pick the single clone grown on the LB plate in step ③ and inoculate it into 5 mL of LB liquid medium containing kanamycin. Incubate it at 37°C with a shaker at 200 rpm overnight. Use the OMEGA Plasmid Miniprep Kit I (D6943) to extract the plasmid according to the instructions. Use the special sequencing primers for constructing the BGK03 vector to construct the extracted plasmid. Sequencing confirms the target site sequence and obtains the correctly connected GSW8 knockout vector GSW8-BGK03 (see Figure 4 ); wherein the sequence of the dedicated sequencing primer for constructing the BGK03 vector is as follows: 5'-CCCAGTCACGACGTTGTAA-3' (SEQ ID NO.7).
[0043] (3) Rice genetic transformation
[0044] ① Transformation of Agrobacterium tumefaciens EHA105 with knockout vector plasmid: Add 1 μL of knockout vector plasmid to one tube of EHA105 competent cells and place on ice for 30 minutes. Quickly freeze in liquid nitrogen for 2 minutes. Lyse the cells in a 37°C metal bath for 5 minutes. Immediately add 600 μL of antibiotic-free LB medium and incubate at 180 rpm at 28°C for 2-3 hours. Centrifuge at 5000 rpm for 3 minutes, then resuspend the cells in 100 μL of LB medium. Spread the plate evenly on an LB plate containing rifampicin and kanamycin resistance markers and incubate in a 28°C incubator for 2-3 days. Identify the positive clones and store the resulting suspension at -80°C until further use.
[0045] ②Transformation of rice variety Zhonghua 11 (ZH11): The wild-type rice variety Zhonghua 11 was transformed using the Agrobacterium-mediated method, and resistance screening was performed with hygromycin to obtain the GSW8 gene knockout mutants GSW8-KO1 and GSW8-KO2.
[0046] Example 4 Construction of GSW8 gene overexpression material
[0047] Total RNA was extracted and reverse transcribed to obtain cDNA using RNA extraction and reverse transcription kits from Chengdu Fuji Biotechnology Co., Ltd. The specific steps were performed according to the kit instructions. Using the synthesized cDNA as a template, amplification primers Y1865 and Y1866 were designed. The coding region of the GSW8 gene was amplified using the amplification primers and then fused to the plant expression vector pCAM1300A between the XbaI and SalI restriction sites using a multi-fragment recombinase to obtain the GSW8 overexpression vector pCAM1300A-GSW8 (see Figure 5 ) and transformed this vector into wild-type ZH11 rice according to the rice genetic transformation steps described in Example 3. Hygromycin resistance screening was performed to obtain GSW8 gene-overexpressing materials GSW8-OE1 and GSW8-OE2. Total RNA from leaves of the overexpressing plants was extracted according to the above method, and reverse transcribed to obtain cDNA. Fluorescence quantitative PCR was performed using primers Y1879 / 1880, with an ACTIN primer as an internal control. Primer sequences are shown in Table 2.
[0048] Table 2 Primer sequences
[0049] Primer name Sequence (5'-3') Y1865 ACCCGGGGATCCTCTAGAATGGGTTCACGGTTTCCATCC(SEQ ID NO.8) Y1866 CCCATCAACCACGTCGACGACTGGTATTACATCGATGTTCGATG(SEQ ID NO.9) Y1879 GGTGGTTTCATTCTTGGAG(SEQ ID NO.10) Y1880 CACATCTTGGGACCCTTTG(SEQ ID NO.11) ACTIN-F TGTATGCCAGTGGTCGTACCA(SEQ ID NO.12) ACTIN-R CCAGCAAGGTCGAGACGAA(SEQ ID NO.13)
[0050] Following the above steps, the overexpression plants GSW8-OE1 and GSW8-OE2 with significantly upregulated expression levels were successfully obtained (see Figure 6 ).
[0051] Example 5: GSW8 gene negatively regulates high temperature tolerance in rice
[0052] To further verify whether the GSW8 gene is involved in regulating high temperature tolerance in rice, wild type ZH11, knockout mutants GSW8-KO1 and GSW8-KO2 were subjected to high temperature treatment at seedling stage (see Figure 7 A), the treatment conditions are (see Figure 7 B): Seedlings grown at 28℃ for 14 days were treated at 42℃ for 96 hours and then allowed to grow again at normal temperature of 28℃ for 7 days. Figure 7 As shown in Figure C, after high temperature treatment, the survival rate of wild-type ZH11 was only 12.78%, while the survival rates of GSW8-KO1 and GSW8-KO2 were significantly higher than those of the wild-type, reaching 85.99% and 85.53%, respectively.
[0053] In addition, wild type ZH11, overexpression materials GSW8-OE1 and GSW8-OE2 were subjected to high temperature treatment at seedling stage (see Figure 8 A), the treatment conditions are (see Figure 8 B): Seedlings grown at 28℃ for 14 days were treated at 42℃ for 72 hours and then allowed to grow again at normal temperature of 28℃ for 7 days. Figure 8 As shown in C, after high temperature treatment, the survival rate of wild-type ZH11 was 89.60%, while the survival rates of GSW8-OE1 and GSW8-OE2 were significantly lower than that of the wild-type, at 21.35% and 27.48%, respectively.
[0054] The above results indicate that the GSW8 gene negatively regulates the high temperature tolerance of rice. Disrupting the GSW8 function by gene editing and other means can significantly improve the high temperature tolerance of rice.
[0055] In summary, the present invention demonstrates that the GSW8 gene can respond to high temperature stress in rice and negatively regulate the high temperature tolerance of rice, providing a new gene resource for breeding high temperature tolerant rice varieties.
[0056] The nucleotide sequence of the GSW8 gene in the present invention is as follows:
[0057] ATGGGTTCACGGTTTCCATCCCACCAACTAAGCAATGGCCTTATG
[0058] TCTCGGGCCGACCAGAGCAACCTAAGGAGAAGGCTCCAGTCATTGCT
[0059] CCACAGCAATGCCATACACTGGGGGTGACATAAAGAAATCTGGAGAAC
[0060] TAGGGAAAATGTTTGACCTCCATGTTGAAAAGTCGCGGAAGTCTGGTC
[0061] CTTTGGGTAATCAACCTTCAAGAAATACTTCATTTGGTGGTGCTGGTTC
[0062] CAACTCTGGACCAGTTTCTAATGCTCTTGGTCGGTCCAACTACTCTGGT
[0063] TCTATTTCATCATCTGTTCCTGGTGCTGGAGGATCAGCAAGGGCAAAAT
[0064] CAAATTCTGGACCTCTCAATAAGCATGGAGAACCAGGAAAGAAGTCAT
[0065] CTGGTCCCCAGTCAGGCGGAGTGACCCCAATGGCACGTCAGAATTCTG
[0066] GTCCTTTACCTCCTGTTCTTCCTACAACTGGGCTGATCACATCAGGGCC
[0067] TATCTCCTCTGGACCTCTGAATTCATCTGGTGCTCCACGAAAAGTATCA
[0068] GGCCCTCTTGATCCTAGTGTATCAATGAAGATGCGTGCAACTTCTTTTG
[0069] CTCACAACCCAGCTGTTACAAACCTGAATGCCGATGATGGTTACTCTAT
[0070] TAAGGGCAGCATTCCTAAGACAATACTCTGGATGGTTATTCTGCTCTTTT
[0071] TGATGGGGTTCATAGCAGGTGGTTTCATTCTTGGAGCTGTTCATAACCC
[0072] TATTCTGCTGGTAGTTGTGGTGGTCATATTTTGCTTTGTTGCTGCTCTTG
[0073] TGATTTGGAACATTTGCTGGGGAACAAGAGGTGTGACTGGGTTCGTCA
[0074] GTCGCTATCCTGATGCTGATCTCAGAACAGCAAAAGATGGACAGTATGT
[0075] GAAGTTACTGGGGTTGTTACATGTGGAAATTTTCCTCTCGAGTCCTCA
[0076] TTTCAAAGGGTCCCAAGATGTGTGTACACTTCAACTTGCTTGTATGAGT
[0077] ACAGGGGCTGGGATTCGAAAGCTGCTAACACTGAGCACCGCCAATTTA
[0078] CTTGGGGTCTTAGGTCAATGGAGAGACATGCTGTTGATTTCTACATCTC
[0079] TGATTTCCAATCTGGACTACGAGCATTGGTCAAAACAGGATATGGAGC
[0080] ACGGGTAACCCCTTATGTTGATGAATCTGTTGTTATTGACATAAACCCA
[0081] GATAACAAGGACATGTCCCCCGAGTTCTTGAGATGGCTGCGTGAAAGG
[0082] AATCTATCAAGTGATGATCGGATAATGCGCCTGAAAGAAGGATACATTA
[0083] AGGAGGGCAGCACGGTGAGTGTTATGGGGGTTGTTCAAAGGAACGAC
[0084] AACGTGTTGATGATTGTTCCTCCATCGGAACCCATCTCCACTGGCTGCC
[0085] AGTGGGCCAAGTGCATCCTCCCTACTAGCCTTGATGGGCTAGTCTTAAG
[0086] ATGCGAAGATACATCGAACATCGATGTAATACCAGTCTGA(SEQ NO.1).
[0087] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.
Claims
1. An application of the GSW8 gene in regulating high temperature tolerance in rice, characterized in that: The nucleotide sequence of the GSW8 gene is shown in SEQ NO.
1.
2. The use of the GSW8 gene in regulating high temperature tolerance in rice according to claim 1, characterized in that: Knocking out the GSW8 gene will enhance the high temperature tolerance of rice.
3. The use of the GSW8 gene in regulating high temperature tolerance in rice according to claim 1, characterized in that: Overexpression of the GSW8 gene reduces high temperature tolerance in rice.
4. A method for preparing a high temperature resistant rice variety, characterized in that: A high-temperature-resistant rice variety is prepared by knocking out the GSW8 gene; the nucleotide sequence of the GSW8 gene is shown in SEQ NO.1.
Citation Information
Patent Citations
Protein GSW8 for regulating and controlling grain shape and thousand grain weight of rice, and coding gene and application of protein GSW8
CN113388016A