A gene OsMATE16 for regulating rice anther dehiscence, its encoded protein and applications

Abstract

The present invention discloses a gene for regulating rice anther dehiscence OsMATE16 and its encoded protein and applications, belonging to the technical field of molecular biology. The present invention constructs OsMATE16 knockout mutants of the gene OsMATE16-KO1 and OsMATE16-KO2 plants, and then identifies their phenotypes. It is found that compared with ZH11, OsMATE16-KO1 and OsMATE16-KO2 both have reduced anther dehiscence rate and seed setting rate, indicating that OsMATE16 the gene affects rice yield by regulating rice anther dehiscence. The present invention provides new research materials for the study of rice MATE family genes and new genetic resources for rice molecular breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and particularly relates to a gene for regulating rice anther dehiscence OsMATE16 and its encoded protein and application. Background Art

[0002] Seed setting rate is one of the main factors affecting rice yield, and rice anther dehiscence has an important impact on seed setting. In the late stage of stamen development, anthers dehisce to release mature pollen grains for pollination, fertilization, and seed production. In flowering plants, this process is strictly regulated to synchronize anther dehiscence, pollen tube maturation, and elongation to promote pollen-stigma interaction and achieve fertilization at the optimal time. Currently, the research progress on rice anther dehiscence mainly focuses on the phytohormone pathway, mainly auxin (IAA) and jasmonic acid (JA). In the late stage of anther development, OsFTIP7 mediates the nucleocytoplasmic distribution of OSH1, thereby directly inhibiting the auxin biosynthesis gene OsYUCCA4, thus down-regulating the level of auxin, promoting anther dehiscence, and ultimately controlling rice fertility (Song et al, 2018). DAO encodes a predicted 2-oxoglutarate and ferrous ion-dependent dioxygenase, which is responsible for oxidizing active IAA into inactive OxIAA. The auxin content in its mutants is higher, resulting in anther indehiscence (Zhao et al, 2013). In addition, it has been found that the OsTIE1-OsTCP1 module plays a key role in anther development by finely regulating JA biosynthesis (Fang et al, 2024). OsJAR1 is a jasmonic acid-amino acid synthetase involved in JA-regulated rice anther dehiscence (Xiao et al, 2014).

[0003] In summary, previous studies have reported several genes that can regulate rice anther dehiscence through the IAA and JA pathways, but there is no report on the regulation of anther dehiscence by MATE family genes. With the development of gene editing technology, researchers can use genetic engineering to create excellent new varieties. Therefore, searching for new genes affecting rice seed setting rate can provide a theoretical basis and new gene resources for cultivating new rice varieties. Summary of the Invention

[0004] To solve the above-mentioned deficiencies existing in the prior art, the purpose of the present invention is to provide a gene for regulating rice anther dehiscence OsMATE16 and its encoded protein and application to provide a new gene for regulating rice anther dehiscence.

[0005] The technical solution for the present invention to solve the above technical problems is as follows: providing a rice OsMATE16 gene, and the nucleotide sequence of the coding region of the rice OsMATE16 gene is shown in SEQ ID NO.1.

[0006] The present invention provides a protein encoded by the above-mentioned rice OsMATE16 gene, and the amino acid sequence of the protein encoded by the rice OsMATE16 gene is shown in SEQ ID NO.2.

[0007] The present invention provides an application of the above-mentioned rice OsMATE16 gene in regulating rice anther dehiscence.

[0008] Furthermore, regulating rice anther dehiscence means that the anther dehiscence rate of rice OsMATE16 decreases after the gene is knocked out.

[0009] Furthermore, regulating rice anther dehiscence means that the seed setting rate of rice OsMATE16 decreases after the gene is knocked out.

[0010] The present invention also provides a preparation for regulating rice anther dehiscence, and the preparation contains the above-mentioned rice OsMATE16 gene or the protein encoded by the above-mentioned rice OsMATE16 gene.

[0011] The present invention has the following beneficial effects: The present invention constructs knockout mutants OsMATE16 of the gene and OsMATE16-KO1 plants through the CRISPR / Cas9 system, and then identifies their phenotypes. It is found that compared with ZH11, OsMATE16-KO2 and OsMATE16-KO1 and OsMATE16-KO2 both have reduced anther dehiscence rates and seed setting rates. It shows that OsMATE16 the gene affects rice yield by regulating rice anther dehiscence. The present invention provides new research materials for the study of rice MATE family genes and new genetic resources for rice molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 is a schematic diagram of the CRISPR / Cas9 vector of the OsMATE16 gene;

[0013] Figure 2 is a diagram of the knockout target site and plant phenotype of the OsMATE16 gene;

[0014] Figure 3 is an observation of anther dehiscence of ZH11 and OsMATE16 knockout plants;

[0015] Figure 4 is an analysis of the OsMATE16 gene expression profile. DETAILED DESCRIPTION OF THE INVENTION

[0016] The following examples are only used to explain the present invention and are not intended to limit the scope of the present invention. For those not specified in the examples, they are carried out according to conventional conditions or conditions recommended by the manufacturer. For reagents or instruments not specified by the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0017] Example 1: OsMATE16 Construction of gene knockout vector, transformation and plant phenotype observation

[0018] (1) OsMATE16 Obtaining gene sequences

[0019] Using the database Rice Resource Center ( http: / / ricerc.sicau.edu.cn ), the coding region of the rice OsMATE16 gene and the amino acid sequence of the encoded protein were obtained.

[0020] (2) OsMATE16 Construction and transformation of gene editing vector

[0021] The guide RNA (gRNA) sequence of the gene editing target site was designed using the website (http: / / skl.scau.edu.cn / ), and the gRNA was constructed onto the pYLCRISPR / Cas9 Pubi-H vector with hygromycin resistance in plants (see Figure 1 ), and the specific method was referred to (Yao-Guang Liu, Current Protocols in Molecular Biology , 2016). The receptor of the gene editing vector transformation material was japonica rice Zhonghua 11 (ZH11), and the genetic transformation experiment was completed by Baige Gene Company.

[0022] (3) OsMATE16 Phenotypic analysis of knockout mutant plants

[0023] For the obtained transgenic plants, the DNA of single plants was extracted using the CTAB method from the single plant leaves as a template, and amplification primers spanning the target site were designed. After amplification using the single plant DNA as a template, it was sent to Sangon Biotech Co., Ltd. for sequencing; the sequences of the amplification primers are shown as follows:

[0024] F: TCAACGTGCTCCTCGTGT (SEQ ID NO.3);

[0025] R: TTGGGATGCAGTGACTGATA (SEQ ID NO.4).

[0026] After aligning the obtained sequences with the DNAMAN5 software, the results showed that 2 transgenic plants with premature termination of protein translation were obtained, which were named OsMATE16-KO1 and OsMATE16-KO2。Two individuals with loss-of-function harvested in the T0 generation were sown in plots to form T1 generation transgenic lines and their phenotypes were observed. It was found that compared with ZH11, the seed setting rate of the knockout transgenic plants decreased significantly (see OsMATE16 ). Figure 2 ).

[0027] (4) OsMATE16 Observation of the anther dehiscence phenotype of the knockout mutant

[0028] ZH11 and OsMATE16-KO1 plants growing normally in the field until the heading stage were marked with a marker pen at around 11:00 am for the florets that bloomed on the same day. 15 plants were marked for each material, and 20 florets were marked for each individual plant. When they grew to around 16:00 pm on the same day (after growing for 5 hours), the florets were taken to observe the anther dehiscence under a microscope. Each floret has 6 anthers. If the number of anthers with dehiscence is from 1 to 6, it is counted as dehiscence, and when the number of dehiscence is 0, it is counted as non-dehiscence. Every 5 individual plants have 100 florets, which is one biological replicate, and there are 3 biological replicates in total. The results showed that compared with ZH11, OsMATE16-KO1 the anther dehiscence rate decreased significantly. The statistical results showed that OsMATE16-KO1 the anther dehiscence rate of Figure 4 was significantly lower than that of ZH11 (see

[0029] Example 2: OsMATE16 Expression profile analysis of

[0030] Different tissue samples of rice at different developmental stages were taken in the field and placed in a mortar pre-cooled with liquid nitrogen. The samples pre-cooled with liquid nitrogen were ground thoroughly. About 50 mg of the sample was taken and placed in a 2 mL RNAase-free EP tube. Total RNA was extracted using the RNA extraction kit from QIAGEN. 500 ng of RNA was reverse transcribed using the reverse transcription kit from Takara, and the reverse transcription product was diluted 5 times. Using gene-specific primers and OsUbiquitin as an internal reference control, qPCR reactions were carried out on a real-time quantitative system (qTOWER3G, Analytik, Jena, Germany). Three biological replicates were set for each sample, and statistical analysis was carried out after the reaction was completed. Among them, C2 is the booting stage; LB1 is the leaf at the seedling stage; LB2 is the leaf at the booting stage; YP2, YP3, YP5, YP9, and YP12 are young panicles with lengths of 2, 3, 5, 9, and 12 cm; H9, H12, and H15 are glumes with panicle lengths of 9, 12, and 15 cm; E5, E10, E15, E20, E25, and E30 are caryopses developed for 5, 10, 15, 20, 25, and 30 days after fertilization; Anther is the anther. The sequences of the specific primers and the OsUbiquitin primers are shown as follows:

[0031] OsMATE16-qPCR-F: TGACAGGGGCTGAATTAGA (SEQ ID NO.5);

[0032] OsMATE16 -qPCR-R: CCAGTGCTTGTAGCTATA (SEQ ID NO.6);

[0033] OsUbiquitin-qPCR-F: TTCATGGCCAACCACTT (SEQ ID NO.7);

[0034] OsUbiquitin-qPCR-R: AGCCTGCTGGTTGTAGA (SEQ ID NO.8).

[0035] It can be seen from Figure 4 that OsMATE16 it is highly expressed mainly in the stems, leaves and young panicles at different developmental stages.

[0036] The coding region and protein sequence of the OsMATE16 gene in the present invention are as follows:

[0037] (1) Coding region sequence:

[0038]

[0039] (2) Protein sequence:

[0040] MAIPLQGKAQQQQGEGGKGDGAVDDDGDDQPSVASELRELWGMAAPITALNCVVYLRAMVSVLCLGRLGPLDLAGGALAIGLTNITGHSVLFGLASGLEPLCAQAFGSKNYDLLTLSLQRAVLLLTLAALPIALLWLHVGPILVALGQDPTISASAAAYAAYALPDLAASAVLQPLRVYLRSQGITKPMAACSAIAVALHVPLNVLLVFGLGFGVRGVAAAQALTNTNMVLFLLAYIRWSRACDATWKGWARPAAVASGLAGLVRLAVPSCVGVCLEWWWYEVVTVLAGYLPDPAAAVGAAGVLIQTTSLMYTVPMALAACVSTRVGNELGGGKPRRARMAAMVALGCAVVIGVVHVAWTAAFSREWVELFTREAAVVRLAAAAMPILGLCELGNCPQTTGCGVLRGTARPAVGARINLLSFYLVGTPVAVTLAFGARVGFGGLWYGLLSAQAACVALVLLAVVWRTDWHLEALRAKKLTGLEMIAAAAEGDDDECKRLIAPLPPPDGHDVAVDVV (SEQ ID NO.2).

[0041] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Rice OsMATE16 The application of a gene in regulating rice anther dehiscence is characterized in that: The rice OsMATE16 The nucleotide sequence of the gene coding region is shown in SEQ ID NO.1; the rice OsMATE16 The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: The method for regulating rice anther dehiscence is to knock out rice OsMATE16 The anther dehiscence rate of rice was reduced after the gene was mutated.

3. The use according to claim 1, characterized in that: The method for regulating rice anther dehiscence is to knock out rice OsMATE16 The rice seed setting rate is reduced after the gene is modified.

4. A preparation for regulating rice anther dehiscence, characterized in that: The preparation comprises the rice according to claim 1 OsMATE16 The gene or the rice according to claim 1 OsMATE16 Protein encoded by a gene.

Images