Nucleic acid molecule and application thereof in thymine base editing in plant genome

Abstract

The invention provides a nucleic acid molecule and application thereof in thymine base editing in a plant genome. The nucleic acid molecule provided by the invention is a thymine glucoamylase coding sequence. The invention constructs a thymine base editor in a plant genome and a base editing method based on the thymine glucoamylase coding sequence. The analysis on the genotyping of 1681 T0 plants finds that the thymine base editing method provided by the invention realizes up to 38.2% of T-to-G editing in a specific active window. Different from editing expressions of mammalian cells (mainly including T-to-C and T-to-G edits) and escherichia coli (mainly including T-to-A edits), the thymine base editing method provided by the invention mainly triggers T-to-G edits. By combining a thymine base editor with other base editors (such as ABE and AKBE), T: A base pairs can be converted into any target base pair, and huge application potential is provided for plant molecular breeding and gene function research.

Description

Technical Field

[0001] The present invention relates to a nucleic acid molecule and application thereof in thymine base editing in a plant genome, and relates to the technical field of gene editing. Background Art

[0002] Base editing is a gene editing technology developed since 2016. It has been successfully applied to a variety of organisms and can efficiently and accurately induce the replacement of bases in DNA and RNA, providing a powerful technical tool for basic and applied research. By combining different base modification enzymes (deaminases) with the CRISPR-Cas system, the cytosine base editor (CBE) and adenine base editor (ABE) were constructed, which achieved the conversion of cytosine base C>T and adenine base A>G, respectively.

[0003] Base editing technology has great potential in crop trait improvement, but the widely used deaminase base editors are mainly limited to the editing of adenine (A) and cytosine (C). In order to expand the types of base editing and avoid the use of deaminases, glycosylation enzyme-based base editors have been developed in this field, that is, engineered glycosylases are fused with SpCas9 nickase (SpCas9n). This type of editor can accurately recognize and remove specific guanine (G) or thymine (T) bases, and achieve base replacement through DNA replication or repair at abasic sites.

[0004] Although glycosylase-based guanine editors (gGBEs) have demonstrated efficient guanine editing capabilities in plants, glycosylase plant base editors (gTBEs) targeting thymine still need further research and development. Summary of the invention

[0005] The present invention provides a nucleic acid molecule and its application in thymine base editing in plant genomes.

[0006] The first aspect of the present invention provides a nucleic acid molecule, which is any one of the following A1)-A6):

[0007] A1) a nucleic acid molecule whose nucleotide sequence is shown at positions 3169-4077 of SEQ ID NO: 2;

[0008] A2) a nucleic acid molecule whose nucleotide sequence is shown at positions 3169-4077 of SEQ ID NO: 4;

[0009] A3) a nucleic acid molecule whose nucleotide sequence is shown at positions 3169-4077 of SEQ ID NO: 6;

[0010] A4) a nucleic acid molecule whose nucleotide sequence is shown at positions 3169-4077 of SEQ ID NO: 8;

[0011] A5) A nucleic acid molecule obtained by inserting the nucleic acid molecule described in any one of A1) to A4) into an effector protein coding sequence, wherein the effector protein is capable of cleaving DNA and / or RNA;

[0012] A6) A nucleic acid molecule that has 80% or more identity with the nucleic acid molecule shown in any one of A1) to A5) and encodes the same protein.

[0013] Further, in A5), the nucleic acid molecule obtained by inserting any one of A1)-A4) into the effector protein coding sequence is selected from at least one of A501)-A512):

[0014] A501) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 2;

[0015] A502) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 4;

[0016] A503) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 6;

[0017] A504) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 8;

[0018] A505) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 10;

[0019] A506) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 12;

[0020] A507) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 14;

[0021] A508) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 16;

[0022] A509) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 18;

[0023] A510) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 20;

[0024] A511) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 22;

[0025] A512) is a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 24.

[0026] In A501)-A504), the nucleotide sequence shown at positions 1-69 is the first nuclear localization sequence, positions 70-3153 are the 5' end sequence of the effector protein (specifically SpCas9n) coding sequence, positions 3154-3168 are the first linker, positions 3169-4077 are hUNG coding sequence / hTDG coding sequence / TDG-EK coding sequence / TDG3 coding sequence, positions 4078-4092 are the second linker, positions 4093-5109 are the 3' end sequence of the effector protein (specifically SpCas9n) coding sequence, and positions 5110-5193 are the second nuclear localization sequence.

[0027] In A505)-A508), the nucleotide sequence shown at positions 1-69 is the first nuclear localization sequence, positions 70-3204 are the 5' end sequence of the effector protein (specifically SpCas9n) coding sequence, positions 3205-3219 are the first linker, positions 3220-4128 are hUNG coding sequence / hTDG coding sequence / TDG-EK coding sequence / TDG3 coding sequence, positions 4129-4143 are the second linker, positions 4144-5061 are the 3' end sequence of the effector protein (specifically SpCas9n) coding sequence, and positions 5062-5145 are the second nuclear localization sequence.

[0028] In A509)-A512), the nucleotide sequence shown at positions 1-69 is the first nuclear localization sequence, positions 70-3813 are the 5' end sequence of the effector protein (specifically SpCas9n) coding sequence, positions 3814-3828 are the first linker, positions 3829-4737 are hUNG coding sequence / hTDG coding sequence / TDG-EK coding sequence / TDG3 coding sequence, positions 4738-4752 are the second linker, positions 4753-5109 are the 3' end sequence of the effector protein (specifically SpCas9n) coding sequence, and positions 5110-5193 are the second nuclear localization sequence.

[0029] Furthermore, the different positions of the hUNG coding sequence / hTDG coding sequence / TDG-EK coding sequence / TDG3 coding sequence in A501)-A512) are due to their insertion into different sites of the effector protein (specifically SpCas9n) coding sequence.

[0030] Furthermore, the nucleotide sequence of the first nuclear localization sequence is specifically:

[0031] 5'-ATGAAACGGACAGCCGACGGAAGCGAGTTCGAGTCACCAAAGAAGAAGCGGAAAGTCTCCGGAGGATCT-3'.

[0032] Furthermore, the nucleotide sequence of the second nuclear localization sequence is specifically:

[0033] 5'-ACTAGTTCCGGCGGCAGCGCTTCTCCAAAGCGTCCGCGTGACCGTCACGATGGAGAATTGGGTGGACGCAAACGTGC AAGAGGT-3'.

[0034] Furthermore, the nucleotide sequence of the first linker is specifically:

[0035] 5′-GGAGGAGGCGGTAGT-3′.

[0036] Furthermore, the nucleotide sequence of the second linker is specifically:

[0037] 5′-GGAGGTGGTGGTTCA-3′.

[0038] Furthermore, the identity of more than 80% can specifically be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0039] Furthermore, the nucleic acid molecule is preferably one of A504) (nucleic acid molecule with a nucleotide sequence such as SEQ ID NO: 8), A508) (nucleic acid molecule with a nucleotide sequence such as SEQ ID NO: 16), and A512) (nucleic acid molecule with a nucleotide sequence such as SEQ ID NO: 24).

[0040] The second aspect of the present invention provides a recombinant vector comprising the above nucleic acid molecule.

[0041] The third aspect of the present invention provides a recombinant microorganism or plant protoplast comprising the above-mentioned recombinant vector.

[0042] Furthermore, the recombinant microorganism is Agrobacterium comprising the above-mentioned recombinant vector.

[0043] The fourth aspect of the present invention provides the use of the above-mentioned nucleic acid molecules, or the proteins expressed by the above-mentioned nucleic acid molecules, or the above-mentioned recombinant vectors, or the above-mentioned recombinant microorganisms or plant protoplasts in realizing thymine base editing in plant genomes.

[0044] Furthermore, the plant is rice.

[0045] The fifth aspect of the present invention provides a method for realizing thymine base editing in a plant genome, comprising: constructing a recombinant vector comprising the above-mentioned nucleic acid molecule, introducing the recombinant vector into a plant cell, and editing the thymine base in the plant genome.

[0046] Furthermore, the method of introducing the recombinant vector into plant cells includes Agrobacterium-mediated method or protoplast transformation method.

[0047] Furthermore, the plant is rice.

[0048] The sixth aspect of the present invention provides a method for cultivating transgenic plants, comprising: constructing a recombinant vector comprising the above-mentioned nucleic acid molecule, introducing the recombinant vector into plant cells, editing the thymine bases in the plant genome, and obtaining transgenic plants.

[0049] Furthermore, the method of introducing the recombinant vector into plant cells includes Agrobacterium-mediated method or protoplast transformation method.

[0050] Furthermore, the plant is rice.

[0051] The seventh aspect of the present invention provides a protein expressed by the above nucleic acid molecule, wherein the protein is any one of the following A1)-A18):

[0052] A1) a protein having an amino acid sequence of positions 1057-1359 of SEQ ID NO: 3;

[0053] A2) a protein having an amino acid sequence of positions 1057-1359 of SEQ ID NO: 5;

[0054] A3) a protein having an amino acid sequence of positions 1057-1359 of SEQ ID NO: 7;

[0055] A4) a protein having an amino acid sequence of positions 1057-1359 of SEQ ID NO:9;

[0056] A5) a protein having an amino acid sequence of SEQ ID NO: 3;

[0057] A6) a protein having an amino acid sequence of SEQ ID NO: 5;

[0058] A7) a protein having an amino acid sequence of SEQ ID NO: 7;

[0059] A8) a protein having an amino acid sequence of SEQ ID NO: 9;

[0060] A9) a protein having an amino acid sequence of SEQ ID NO: 11;

[0061] A10) a protein having an amino acid sequence of SEQ ID NO: 13;

[0062] A11) a protein having an amino acid sequence of SEQ ID NO: 15;

[0063] A12) a protein having an amino acid sequence of SEQ ID NO: 17;

[0064] A13) a protein having an amino acid sequence of SEQ ID NO: 19;

[0065] A14) a protein having an amino acid sequence of SEQ ID NO: 21;

[0066] A15) a protein having an amino acid sequence of SEQ ID NO: 23;

[0067] A16) a protein having an amino acid sequence of SEQ ID NO: 25;

[0068] A17) a protein having 80% or more identity with any one of the proteins described in A1) to A16) and having the same function;

[0069] A18) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of any one of the proteins described in A1) to A16).

[0070] Furthermore, the identity of more than 80% can specifically be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.

[0071] The eighth aspect of the present invention provides a complex formed by linking the above protein with sgRNA.

[0072] The present invention provides a thymine saccharifying enzyme coding sequence, and a thymine base editor and a base editing method in a plant genome constructed based on the thymine saccharifying enzyme coding sequence. Through the analysis of the genotyping of 1681 T0 plants, it was found that the thymine base editing method provided by the present invention achieved up to 38.2% T-to-G editing within a specific activity window. Different from the editing performance of mammalian cells (mainly T-to-C and T-to-G editing) and Escherichia coli (mainly T-to-A editing), the thymine base editing method provided by the present invention mainly triggers T-to-G editing. By combining the thymine base editor with other base editors (such as ABE and AKBE), it is possible to convert the T:A base pair to any target base pair, which provides great application potential for plant molecular breeding and gene function research. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] Figure 1 To evaluate the editing efficiency of thymine base editors in rice protoplasts using a dual luciferase reporter system; A is a schematic diagram of the Cas embedded glycosylase vector structure, B is a glycosylase variant, C is a dual luciferase reporter system for evaluating thymine editing in rice protoplasts, and the nonsense mutation of glycine at position 69 is marked in red; D is a comparison of the NLuc recovery activity of different glycosylase base editors, the average relative luminescence intensity of CE1029hTDG is normalized to 1, and the figure marks the fold difference of the average editing activity of different editors at the same site (n=8);

[0074] Figure 2 To compare the editing efficiency of several Cas9-embedded thymine base editors at endogenous sites in rice; A is the Indel of CE-TBEs at six target sites; B is the thymine base editing efficiency of CE-TBEs at six target sites; C is the mutation types and editing efficiency of three Cas9-embedded TDG3 base editors at six endogenous target sites; D is the statistics of rice T0 plants edited by CE1029TDG3 in the target region of six endogenous target sites, with HiTO M shows that the plants with editing read ratio exceeding 10% in sequencing are recorded as effectively edited plants; E shows the statistics of rice T0 plants edited by CE1046TDG3 in the target regions of six endogenous target sites, and the plants with editing read ratio exceeding 10% in HiTOM sequencing are recorded as effectively edited plants; F shows the statistics of rice T0 plants edited by CE1249TDG3 in the target regions of six endogenous target sites, and the plants with editing read ratio exceeding 10% in HiTOM sequencing are recorded as effectively edited plants;

[0075] Figure 3The editing results of optimized thymine base editing tools at rice endogenous sites were verified by Sanger sequencing or subclone sequencing; A is the editing effect of CE1046TDG3 and CE1249TDG3 editing tools on SLR1, TB1, EPSPS, and ALS1 genes verified by Sanger sequencing; B is the editing effect of CE1029TDG3 on rice endogenous ALS1 and SLR1 genes verified by subclone sequencing, PAM is marked with a red box, sgRNA sequence is marked with an underline, and all three editing tools can produce precise thymine base editing at rice endogenous sites;

[0076] Figure 4 The optimized thymine base editing tool produces precise thymine base editing on rice SLR1 and ALS1 genes; A is the analysis of the mutation types and proportions of three Cas9-embedded TDG3 base editors at the SLR1-g3 site in representative T0 plants using Hi-TOM; B is the analysis of the mutation types and proportions of three Cas9-embedded TDG3 base editors at the ALS1-g1 site in representative T0 plants using Hi-TOM; C is the analysis of the mutation types and proportions of three Cas9-embedded TDG3 base editors at the SLR1-g3 site in representative T0 plants using Hi-TOM; Sequencing reads and their proportions of representative T0 plants edited by CE1029TDG3, and the data show sequencing reads with a frequency greater than 10%; D is the sequencing reads and their proportions of representative T0 plants edited by CE1046TDG3 and CE1029TDG3 at ALS1-g1, and the data show sequencing reads with a frequency greater than 10%; E is the dwarf phenotype of a representative T0 rice plant generated by CE1046TDG3; the scale bar is 3 cm; F is a schematic diagram of base conversion in rice using existing editors. DETAILED DESCRIPTION

[0077] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0078] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0079] The rice base editing vector rABE8e involved in the following embodiments is described in Wei, C., Wang, C., Jia, M., Guo, HX, Luo, PY, Wang, MG, Zhu, JK, & Zhang, H. (2021). Efficient generation of homozygous substitutions in rice in one generation utilizing an rABE8e baseeditor. Journal of integrative plant biology, 63(9), 1595-1599. https: / / doi.org / 10.1111 / jipb.13089.

[0080] The gene editing target sequences involved in the following embodiments are shown in Table 1, and the primer sequences involved in the following embodiments are shown in Table 2.

[0081] Table 1 Statistics of editing sites used in the present invention

[0082]

[0083]

[0084] Note: In Table 1, the bases underlined and in bold are PAM sequences.

[0085] Table 2 Primer sequences involved in the embodiments of the present invention

[0086]

[0087] Example 1 Construction of base editor

[0088] 1. If Figure 1 As shown in B, based on the amino acid sequence of human uracil DNA glycosylase (hUDG), the uracil DNA glycosylase is converted into thymine DNA glycosylase (hTDG) by mutating the tyrosine (Y) at position 147 (the 2nd position of the amino acid sequence of hUDG is the 1057th position of SEQ ID NO: 3, and the 1057th-1359th positions of SEQ ID NO: 3 delete the methionine at position 1 compared to hUDG, and the 147th position is the 1202nd position of SEQ ID NO: 3) to alanine (A). The amino acid sequence of thymine DNA glycosylase (hTDG) is shown in positions 1057-1359 of SEQ ID NO: 5.

[0089] 2. Through protein language model-assisted design and directed evolution strategy, the present invention provides two hTDG variants with higher activity, named TDG-EK and TDG3, to improve the editing efficiency of thymine editing tools in animal cells. Specifically, Figure 1 As shown in B, TDG-EK is based on hTDG, with the glycine (G) at position 107 mutated to glutamic acid (E), and the arginine (R) at position 260 mutated to lysine (K). The amino acid sequence of TDG-EK is positions 1057-1359 of SEQ ID NO: 7. TDG3 is based on hTDG, with the phenylalanine (F) at position 85 mutated to leucine (L), the glycine (G) at position 107 mutated to arginine (R), the leucine (L) at position 142 mutated to valine (V), the lysine (K) at position 175 mutated to glutamic acid (E), the serine (S) at position 237 mutated to leucine (L), the alanine (A) at position 255 mutated to valine (V), the lysine (K) at position 259 mutated to glutamic acid (E), the threonine (T) at position 266 mutated to alanine (A), the valine (V) at position 274 mutated to alanine (A), and the tyrosine (Y) at position 275 mutated to serine (S). The amino acid sequence of TDG3 is positions 1057-1359 of SEQ ID NO:9.

[0090] 3. Embedding the above-mentioned thymine DNA glycosylase into the Cas9 protein (specifically SpCas9n, the amino acid sequence of the N-terminus of SpCas9n is 24-1051 of SEQ ID NO:3, and the amino acid sequence of the C-terminus of SpCas9n is 1365-1703 of SEQ ID NO:3, that is, the carboxyl group of the 1051st amino acid in the 24-1051 of SEQ ID NO:3 is connected to the amino group of the 1365th amino acid in the 1365-1703 of SEQ ID NO:3 to form SpCas9n) helps to improve the efficiency and purity of base editing. In order to optimize a set of efficient plant thymine base editing tools, such as Figure 1As shown in A, in this example, three TDG variants (hTDG, TDG-EK and TDG3) were embedded in three different sites of SpCas9n (I1029-G1030, F1046-I1063 (delete the amino acid sequence between 1046 and 1063) and P1249-E1250 sites), and connected by a linker including 5 amino acid residues (the amino acid sequence of the linker is GGGGS), and the nuclear localization sequence was connected at the N-terminus and C-terminus of the connection product to construct 9 different Cas9 embedded TDG variants (Cas-embedded TDG vatiants, CE-TDGs), as candidate thymine base editing vectors, respectively named: CE1029hTDG (amino acid sequence as shown in SEQ ID NO: 5), CE1029TDG-EK (amino acid sequence as shown in SEQ ID NO: 7), CE1029TDG3 (amino acid sequence as shown in SEQ ID NO:9), CE1046hTDG (amino acid sequence as shown in SEQ ID NO:13), CE1046TDG-EK (amino acid sequence as shown in SEQ ID NO:15), CE1046TDG3 (amino acid sequence as shown in SEQ ID NO:17), CE1249hTDG (amino acid sequence as shown in SEQ ID NO:21), CE1249TDG-EK (amino acid sequence as shown in SEQ ID NO:23), CE1249TDG3 (amino acid sequence as shown in SEQ ID NO:25). And by embedding the same site of SpCas9n protein, three control uracil base editors were constructed, named as: CE1029hUDG (amino acid sequence as shown in SEQ ID NO:3), CE1046hUDG (amino acid sequence as shown in SEQ ID NO:11), CE1249hUDG (amino acid sequence as shown in SEQ ID NO:19).

[0091] Example 2 Functional verification in rice using the above 12 base editors

[0092] 1. Construction of base editor coding sequence:

[0093] 1.1. In order to improve the editing efficiency of the above-mentioned base editor in the rice genome, the coding sequences corresponding to the above-mentioned 9 different CE-TDGs and 3 control uracil base editors were codon optimized in this embodiment, and the coding sequences of hUDG and TDG3 were synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd. The coding sequence of hUDG is 3169-4077 of SEQ ID NO: 2, and the coding sequence of TDG3 is 3169-4077 of SEQ ID NO: 8. The coding sequences of hTDG and TDG-EK were obtained by mutating the hUDG coding sequence, and the coding sequence of hTDG is 3169-4077 of SEQ ID NO: 4, and the coding sequence of TDG-EK is 3169-4077 of SEQ ID NO: 6.

[0094] 1.2. Using the primers shown in Table 2 (CE1029-F1, CE1029-R1, CE1029-F2, CE1029-R2, CE1046-F1, CE1046-R1, CE1046-F2, CE1046-R2, CE1249-F1, CE1249-R1, CE1249-F2, CE1249-R2, Glycosylase-F and Glycosylase-R), the coding sequences of hUDG, hTDG, TDG3 and TDG-EK were inserted into the SpCas9 nickase coding sequence (SEQ ID NO:2, positions 70-3153 and positions 4093-5109), the coding sequences of 12 base editors were constructed, namely CE1029hUDG (nucleotide sequence as shown in SEQ ID NO:2), CE1029hTDG (nucleotide sequence as shown in SEQ ID NO:4), CE1029TDG-EK (nucleotide sequence as shown in SEQ ID NO:6), CE1029TDG3 (nucleotide sequence as shown in SEQ ID NO:8), CE1046hUDG (nucleotide sequence as shown in SEQ ID NO:10), CE1046hTDG (nucleotide sequence as shown in SEQ ID NO:12), CE1046TDG-EK (nucleotide sequence as shown in SEQ ID NO:14), CE1046TDG3 (nucleotide sequence as shown in SEQ ID NO:15), CE1046hUDG (nucleotide sequence as shown in SEQ ID NO:16), CE1046hTDG (nucleotide sequence as shown in SEQ ID NO:17), CE1046TDG-EK (nucleotide sequence as shown in SEQ ID NO:18), CE1046TDG3 (nucleotide sequence as shown in SEQ ID NO:19). NO:16), CE1249hUDG (nucleotide sequence as shown in SEQ ID NO:18), CE1249hTDG (nucleotide sequence as shown in SEQ ID NO:20), CE1249TDG-EK (nucleotide sequence as shown in SEQ ID NO:22), CE1249TDG3 (nucleotide sequence as shown in SEQ ID NO:24). Using the ClonExpress II one-step cloning kit (Vazyme, Nanjing, China), the coding sequences of the above 12 base editors were cloned into the KpnI and SpeI sites of the rice base editing vector (rABE8e) to construct the corresponding base editing vector.

[0095] 2. In order to verify the function of the above base editor, the pDLuc-TBE plasmid was introduced into rice protoplasts, such as Figure 1As shown in C, the pDLuc-TBE plasmid includes a 2x35S promoter (positions 811-1674 of SEQ ID NO: 26), a mutant nano-luciferase (Nano-luciferase, NLuc) coding sequence (positions 277-801 of SEQ ID NO: 26), a NOS terminator (positions 1-270 of SEQ ID NO: 26), a ZmUBI promoter (positions 1687-3672 of SEQ ID NO: 26), a firefly luciferase (Firefly luciferase, FLuc) coding sequence (positions 3675-5327 of SEQ ID NO: 26), and a terminator PolyA (positions 5477-5665 of SEQ ID NO: 26). A nonsense mutation (Gly69*; GGA>TGA) was introduced into the NLuc gene using the ClonExpress II one-step cloning kit to inactivate it. The T-to-G editing produced by the thymine base editor can convert it into a read-through codon, thereby restoring the expression of NLuc, which is used as a reporter gene to verify the function of the thymine base editor; firefly luciferase is used as a conversion internal control.

[0096] like Figure 1 As shown in C, based on the coding sequence of nanoluciferase NLuc, three sgRNAs were designed in this example, targeting specific thymine sites (T9, T10 and T11), respectively, and the nucleotide sequences are shown in Table 1. According to the above three reporter gene target sequences shown in Table 1, the oligonucleotide chains shown in Table 3 (sgRNA-T9-UP / sgRNA-T9-LW, sgRNA-T10-UP / sgRNA-T10-LW, sgRNA-T11-UP / sgRNA-T11-LW) were synthesized, and after annealing (1 μl of each upstream and downstream primer was added to 18 μl of 1 / 10 TE buffer pH=8.0, heated at 95°C for 2 min and then slowly cooled to room temperature), T4 ligation reaction was carried out with the adenine base editing vector CE-TBEs (nucleotide sequence as shown in SEQ ID NO: 1, BsaI cleavage site is located at positions 247-262 of SEQ ID NO: 1) after BsaI digestion to construct a ligation product (i.e., the above oligonucleotide chain replaces positions 247-262 of SEQ ID NO: 1). The above-mentioned ligation product is inserted into the U6-gRNA expression frame of the 12 base editing vectors constructed in the above 1.2 to obtain a base editor.

[0097] Table 3 Synthesized endogenous target sequence oligonucleotide chains

[0098]

[0099] 3. Protoplast transfection and dual luciferase reporter experiment: Use the Nipponbare rice variety for protoplast experiments. Grow the rice seedlings in the dark at 28°C for 10 days, and isolate the rice protoplasts according to conventional methods in the art. The rice base editor constructed in step 2 and the pDLuc-TBE plasmid are co-transfected into the rice protoplasts. The transfected protoplasts are cultured in the dark at 23°C. After 24 hours, the protoplasts are collected and the Dual-Glo TM Nanoluciferase activity was measured using the Luciferase Assay System (Promega) according to the manufacturer's instructions.

[0100] Test results such as Figure 1 As shown in D, the editing efficiency of TDG3 was 2.2 to 20.8 times higher than that of hTDG and 1.3 to 4.5 times higher than that of TDG-EK. Among them, CE1046TDG3 showed the highest repair activity at the T9 site of the NLuc reporter gene.

[0101] Example 3 Editing efficiency of thymus density base editor in stable transgenic plants

[0102] 1. In order to evaluate the editing efficiency of the above-mentioned base editor in stable rice transgenic plants, this example selected six endogenous target sites (SLR1-g1, SLR1-g2, SLR1-g3, ALS1-g1, EPSPS-g1, TB1-g1) for testing. The sequences of the six endogenous target sites are shown in Table 1.

[0103] According to the above six endogenous target sequences shown in Table 1, the oligonucleotide chains shown in Table 4 were synthesized, and after annealing (1 μl of each upstream and downstream primer was added to 18 μl of 1 / 10TE buffer pH=8.0, heated at 95°C for 2 min and then slowly cooled to room temperature), a T4 ligation reaction was performed with the adenine base editing vector after BsaI digestion to construct a ligation product. The above ligation product was inserted into the U6-gRNA expression frame of the 9 thymine base editing vectors (excluding 3 CE-hUDG vectors) constructed in 1.2 of Example 2 above to obtain a base editor.

[0104] Table 4 Synthesized endogenous target sequence oligonucleotide chains

[0105]

[0106]

[0107] 2. The constructed base editor was transferred into EHA105 Agrobacterium competent cells using the freeze-thaw / heat shock method. Agrobacterium-mediated transformation of Nipponbare callus cells was performed according to the existing method (Lu et al., 2017). Hygromycin-resistant callus was selected by adding 50 mg / L hygromycin B (Yeasen, Shanghai, China). Plants were regenerated from hygromycin-resistant callus according to the conventional rice transformation method.

[0108] 3. The genomic DNA was extracted from rice leaves using the CTAB method, and the genotype of the T0 transgenic lines was identified. To evaluate the mutation frequency, the primers shown in Table 2 were used to amplify the targeting sequence of the sgRNA and perform HiTOM sequencing, which was confirmed by Sanger sequencing.

[0109] A total of 1681 T0 plants were generated from the nine thymine base editors and analyzed by Hi-TOM sequencing. The results are shown in Table 5. Plants with a mosaic rate of more than 10% were considered to be effectively edited and verified by subclone sequencing. Figure 2-3 shown.

[0110] like Figure 2 As shown in Figure A, the hTDG variant induced only 3.8% and 1.5% indels at the SLR1-g2 and ALS1-g1 target sites, respectively. Figure 2 As shown in Figure 2B, none of the CE-hTDG constructs achieved thymine editing at the targets tested.

[0111] As shown in Table 5 and Figure 2 As shown in Figure 2B, for the TDG-EK variants, no thymine editing activity was detected for the CE1029TDG-EK and CE1249TDG-EK editors, while CE1046TDG-EK achieved 3.6% (1 / 28) and 2.1% (1 / 48) T-to-G conversions at the T11 site of SLR1-g3 and the T3 site of TB1-g1, respectively.

[0112] like Figure 2 As shown in Figures AB, consistent with the protoplast results, the TDG3 variant significantly enhanced the thymine DNA glycosylase activity in rice, increased the thymine editing efficiency and insertion / deletion mutation (indel) frequency. Figure 2 As shown in C, CE1046TDG3 performed better than CE1029TDG3 and CE1249TDG3, producing an average of 29.1% indel mutations and 16.4% thymine editing. The highest thymine editing efficiency was at the SLR1-g3 site, reaching 38.2% (13 / 34).

[0113] like Figure 2As shown in Figure C, the CE-TBE editor mainly produced T-to-G editing in rice T0 plants, with the only exception being CE1046TDG3, which induced 5.9% (2 / 34) T-to-A editing at the SLR1-g3 target site, but no T-to-C editing was observed in this example. Figure 2 As shown in Figure DF, different chimeric variants exhibit different activity windows. CE1029TDG3 shows a wider editing range (T-6 to T17, PAM located at 21-23), while CE1046TDG3 has a narrower editing window (T-1 to T11), and CE1249TDG3 presents a shifted editing window (mainly T9 to T14).

[0114] Table 5 Statistics of editing efficiency of different thymine base editors in T0 plants

[0115]

[0116]

[0117] Note: In Table 5, mutations were detected by HiTOM sequencing, and effective editing was determined when the editing mosaicism rate was >10%. Base editing only counted the base editing allele mutations in the plants that did not contain random insertions and deletions.

[0118] 4. The genomic DNA was extracted from rice leaves using the CTAB method, and the genotype of the T0 transgenic lines was identified. To evaluate the mutation frequency, the primers shown in Table 2 were used to amplify the targeting sequence of the sgRNA and perform HiTOM sequencing. The CE1029TDG3, CE1046TDG3, and CE1249TDG3 vectors were cloned at the endogenous site SLR1-g3 ( Figure 4 Middle A), ALS1-g1( Figure 4 The HiTOM sequencing results of representative plants produced at the B) site are shown in a bar graph. CE1046TDG3 produced a high editing efficiency at SLR1-g3, Figure 4 Figure C shows the sequences with a ratio of >10% in the HiTOM sequencing results of three representative plants. CE1029TDG3 produced a high editing efficiency in ALS1-g1. Figure 4 Middle D shows the sequences with a ratio >10% in the HiTOM sequencing results of 3 representative plants.

[0119] like Figure 4 As shown in Figure E, plants with a high proportion of amino acid substitutions or non-frameshift indel mutations at the TVHYNP motif in the SLR3-g3 target site exhibited a semi-dwarf phenotype. Figure 4As shown in Figure 5F, by combining the thymine base editor with other base editors (such as ABE and AKBE), the T:A base pair can be converted into any target base pair, providing great application potential for plant molecular breeding and gene function research.

[0120] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A nucleic acid molecule, characterized in that The nucleic acid molecule is any one of the following A1)-A6): A1) a nucleic acid molecule whose nucleotide sequence is shown at positions 3169-4077 of SEQ ID NO: 2; A2) a nucleic acid molecule whose nucleotide sequence is shown at positions 3169-4077 of SEQ ID NO: 4; A3) a nucleic acid molecule whose nucleotide sequence is shown at positions 3169-4077 of SEQ ID NO: 6; A4) a nucleic acid molecule whose nucleotide sequence is shown at positions 3169-4077 of SEQ ID NO: 8; A5) A nucleic acid molecule obtained by inserting the nucleic acid molecule described in any one of A1) to A4) into an effector protein coding sequence, wherein the effector protein is capable of cleaving DNA and / or RNA; A6) A nucleic acid molecule that has 80% or more identity with the nucleic acid molecule shown in any one of A1) to A5) and encodes the same protein.

2. The nucleic acid molecule according to claim 1, characterized in that In A5), the nucleic acid molecule obtained by inserting any one of A1)-A4) into the effector protein coding sequence is selected from at least one of A501)-A512): A501) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 2; A502) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 4; A503) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 6; A504) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 8; A505) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 10; A506) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 12; A507) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 14; A508) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 16; A509) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 18; A510) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 20; A511) a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO: 22; A512) is a nucleic acid molecule having a nucleotide sequence such as SEQ ID NO:

24.

3. A recombinant vector comprising the nucleic acid molecule of claim 1 or 2.

4. A recombinant microorganism or plant protoplast comprising the recombinant vector according to claim 3.

5. Use of the nucleic acid molecule according to claim 1 or 2, or the protein expressed by the nucleic acid molecule according to claim 1 or 2, or the recombinant vector according to claim 3, or the recombinant microorganism or plant protoplast according to claim 4 in realizing thymine base editing in a plant genome.

6. A method for editing thymine bases in a plant genome, characterized in that: include: A recombinant vector comprising the nucleic acid molecule of claim 1 or 2 is constructed, and the recombinant vector is introduced into a plant cell to edit the thymine base in the plant genome.

7. A method for cultivating transgenic plants, characterized in that: include: A recombinant vector comprising the nucleic acid molecule of claim 1 or 2 is constructed, the recombinant vector is introduced into a plant cell, and the thymine base in the plant genome is edited to obtain a transgenic plant.

8. The method according to claim 6 or 7, characterized in that: The plant is rice.

9. The protein expressed by the nucleic acid molecule according to any one of claims 1 or 2, characterized in that: The protein is any one of the following B1)-B18): B1) a protein having an amino acid sequence of positions 1057-1359 of SEQ ID NO: 3; B2) a protein having an amino acid sequence of positions 1057-1359 of SEQ ID NO: 5; B3) a protein having an amino acid sequence of positions 1057-1359 of SEQ ID NO: 7; B4) a protein having an amino acid sequence of positions 1057-1359 of SEQ ID NO: 9; B5) a protein having an amino acid sequence of SEQ ID NO: 3; B6) a protein having an amino acid sequence of SEQ ID NO: 5; B7) a protein having an amino acid sequence of SEQ ID NO: 7; B8) a protein having an amino acid sequence of SEQ ID NO: 9; B9) a protein having an amino acid sequence of SEQ ID NO: 11; B10) a protein having an amino acid sequence of SEQ ID NO: 13; B11) a protein having an amino acid sequence of SEQ ID NO: 15; B12) a protein having an amino acid sequence of SEQ ID NO: 17; B13) a protein having an amino acid sequence of SEQ ID NO: 19; B14) a protein having an amino acid sequence of SEQ ID NO: 21; B15) a protein having an amino acid sequence of SEQ ID NO: 23; B16) a protein having an amino acid sequence of SEQ ID NO: 25; B17) A protein that has 80% or more identity with any of the proteins described in B1) to B16) and has the same function; B18) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of any one of the proteins described in B1) to B16).

10. A complex formed by linking the protein according to claim 9 with sgRNA.

Images