AcDRT100 protein and its application in improving disease resistance of kiwifruit

By screening and validating the AcDRT100 protein and its encoding gene, and using a recombinant vector for transient overexpression in kiwifruit, the resistance to kiwifruit canker was enhanced, solving the problem of kiwifruit canker control and achieving improvements in quality and yield.

CN119410700BActive Publication Date: 2026-06-26NORTHWEST A & F UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411853168.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-16
Publication Date
2026-06-26
Estimated Expiration
2044-12-16

AI Technical Summary

Technical Problem

Kiwifruit canker is caused by the pathogenic strain of *Pseudomonas syringae*. Current technology lacks effective resistant varieties and control measures, severely impacting the development of the kiwifruit industry.

Method used

By screening and validating the AcDRT100 protein and its encoding gene, it was transiently overexpressed in kiwifruit using a recombinant vector, which enhanced its resistance to bacterial canker and increased the expression level of defense response genes in the plant.

Benefits of technology

This study significantly improves the resistance of kiwifruit to bacterial canker, reduces pesticide dependence, and enhances quality and yield, providing new molecular markers and breeding ideas for disease-resistant kiwifruit breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119410700B_ABST
    Figure CN119410700B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of genetic engineering, and discloses an AcDRT100 protein and application thereof in improving disease resistance of kiwifruit. An AcDRT100 gene capable of improving the disease resistance of kiwifruit against bacterial canker disease is screened out, the gene is up-regulated in expression in kiwifruit of a'red sun' variety induced by Psa, the disease incidence of the kiwifruit is significantly reduced, and the plant resistance is improved. In addition, it is proved that the expression level of the disease resistance pathway genes AcNPR1, AcPR1, AcJAR1 and AcERF1 can be enhanced by transient overexpression of the AcDRT100 gene in kiwifruit, which provides theoretical support for the research on the molecular mechanism of the disease resistance of kiwifruit against bacterial canker disease. The application provides new insights and ideas for creating high-quality kiwifruit germplasm materials, reducing the dependence on pesticides in the prevention and treatment of bacterial canker disease of kiwifruit, and improving the quality and yield of kiwifruit.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to an AcDRT100 protein and its application in improving the disease resistance of kiwifruit. Background Technology

[0002] Kiwifruit (Actinidia chinensis Planch.), also known as Chinese gooseberry, star fruit, and vine pear, is widely popular for its unique taste and nutritional value. Rich in Vitamin C, it is hailed as the "King of Fruits." China, as the origin, evolution, and distribution center of the genus Actinidia, possesses extremely rich natural resources, providing abundant germplasm resources for the sustainable development of the global kiwifruit industry. However, diseases affecting kiwifruit production are becoming increasingly severe year by year. Kiwifruit canker, caused by the pathogenic species *Pseudomonas syringaepv. actinidiae* (Psa), is the most devastating bacterial disease affecting the kiwifruit industry. This pathogen can infect multiple tissues and organs of the kiwifruit tree, including the trunk, branches, shoots, leaves, and flowers, causing severe damage such as entire tree death and orchard destruction. However, due to a lack of understanding of the interaction mechanism between the pathogen and the plant, the progress of disease-resistant breeding and the development of targeted drugs for precise disease control are severely hampered.

[0003] With the continuous development of the kiwifruit industry, bacterial canker has also spread rapidly, causing huge losses to kiwifruit cultivation and production. The pathogen causing kiwifruit canker is extremely virulent, and no resistant varieties with complete immunity have yet been found among the cultivated kiwifruit varieties. The large number of kiwifruit varieties and their varying levels of resistance to canker provide an important material basis for the discovery of kiwifruit disease resistance genes. Current research mostly focuses on the screening of resistant germplasm resources and the molecular mechanisms of resistance responses, with relatively few reports on the discovery of kiwifruit resistance and susceptibility genes.

[0004] Identifying disease-resistance-related genes using pathogen effector proteins is an effective molecular breeding method for plant disease resistance. This provides potentially applicable genes and directions for breeding kiwifruit resistant to Psa (Pleurotus erythritis), and is of great significance for the green and efficient control of kiwifruit canker. Among these, type III secretion effectors (T3SEs) are key pathogenic factors of Psa. Identifying plant target proteins through the pathogen's T3SEs, elucidating the host's disease resistance mechanism, and exploring disease-resistant breeding materials is currently an effective approach. A pair of homologous effector proteins, HopBB1-1 / HopBB1-2, of the kiwifruit canker pathogen can target DNA damage repair / tolerance proteins (DRT) in the kiwifruit host, thereby affecting the kiwifruit's resistance to the pathogen. The functions and importance of DRT proteins in plants are manifested in maintaining genome stability, responding to external environmental stresses, participating in various cellular physiological processes, regulating DNA damage responses, promoting DNA double-strand break repair, forming DNA repair bodies, and improving gene targeting efficiency. These functions have a crucial impact on plant growth, development, resistance, and crop yield.

[0005] However, the specific function of the DRT100 protein (AcDRT100) in kiwifruit has not yet been fully confirmed. Research on the AcDRT100 gene and its role in the resistance process of kiwifruit canker is expected to provide technical ideas for the exploration of kiwifruit resistance resources and the development of molecular markers. Summary of the Invention

[0006] According to qRT-qPCR results, the AcDRT100 gene was significantly upregulated in response to salicylic acid (SA), jasmonic acid (JA), and ethylene (ET), and in Psa-infected 'Hongyang' kiwifruit plants. However, the specific function of the AcDRT100 gene has not yet been fully confirmed. Therefore, this invention focuses on the AcDRT100 gene and its role in kiwifruit canker resistance, aiming to provide new insights and approaches for the discovery of kiwifruit resistance resources and the development of molecular markers. To achieve this technical objective, the present invention provides the following technical solution:

[0007] The present invention first provides an AcDRT100 protein, the amino acid sequence of which is shown in SEQ ID NO:1.

[0008] Secondly, the present invention seeks protection for the coding gene of the AcDRT100 protein, the nucleotide sequence of which is shown in SEQ ID NO:2.

[0009] Thirdly, the present invention claims protection for a recombinant vector containing the aforementioned coding gene.

[0010] Fourthly, the present invention claims protection for a recombinant genetically engineered bacterium containing the aforementioned recombinant vector.

[0011] Fifthly, the present invention provides the application of the AcDRT100 protein in improving the disease resistance of kiwifruit. Specifically, the AcDRT100 protein plays a positive regulatory role after kiwifruit is infected with the pathogen of kiwifruit canker. In this application, the amino acid sequence of the AcDRT100 protein is shown in SEQ ID NO:1.

[0012] Furthermore, in the above application, the pathogen is *Pseudomonas syringae* pv. *Actinidiae*, a pathogenic species of *Actinobacterium syringae*.

[0013] Sixthly, the present invention also provides a method for breeding kiwifruit resistant to bacterial canker, the method comprising: transferring the encoding gene of the AcDRT100 protein into an expression vector to obtain a recombinant expression vector, and transferring the recombinant expression vector into kiwifruit material.

[0014] Compared with the prior art, the present invention "An AcDRT100 protein and its application in improving the disease resistance of kiwifruit" has the following beneficial effects:

[0015] This invention screened out an AcDRT100 gene that can enhance resistance to bacterial canker in kiwifruit. This gene was upregulated in the 'Hongyang' kiwifruit variety under Psa induction, significantly reducing disease incidence and improving plant resistance. Furthermore, this invention experimentally demonstrated that transient overexpression of the AcDRT100 gene in kiwifruit can enhance the expression levels of disease resistance pathway genes AcNPR1, AcPR1, AcJAR1, and AcERF1, providing theoretical support for the study of the molecular mechanisms of kiwifruit resistance to bacterial canker.

[0016] This invention provides new insights and ideas for creating high-quality kiwifruit germplasm materials, reducing reliance on pesticides in the prevention and control of bacterial canker in kiwifruit, and improving the quality and yield of kiwifruit. Attached Figure Description

[0017] Figure 1 This is a gel electrophoresis image of the AcDRT100 gene. Figure 1 Among them, AcDRT100-1 and AcDRT100-2 are two PCR amplification product samples.

[0018] Figure 2It is a phylogenetic tree of AcDRT100 homologous genes in different species constructed based on the maximum likelihood (ML) method.

[0019] Figure 3 It is based on multiple sequence alignment between AcDRT100 homologous genes in different species.

[0020] Figure 4 This is a schematic diagram of the predicted domains of the AcDRT100 protein.

[0021] Figure 5 The difference in phenotypes is due to Psa M228 infection of 'Hongyang' kiwifruit leaves. Figure 5 In the text, pCAMBIA1302-GFP represents Agrobacterium infection control containing only the empty pCAMBIA1302-GFP vector; pCAMBIA1302-AcDRT100 represents Agrobacterium infection containing the recombinant plasmid vector.

[0022] Figure 6 The left image shows the lesion area statistics after Psa M228 infection of 'Hongyang' kiwifruit leaves, and the right image shows the relative expression level of the AcDRT100 gene. Figure 6 In the text, pCAMBIA1302-GFP represents Agrobacterium infection control containing only the empty pCAMBIA1302-GFP vector; pCAMBIA1302-AcDRT100 represents Agrobacterium infection containing the recombinant plasmid vector.

[0023] Figure 7 This shows the expression of the AcDRT100 gene at different time points after Psa M228 infection of 'Hongyang' kiwifruit leaves.

[0024] Figure 8 This shows the biomass changes after Psa M228 infected the leaves of 'Hongyang' kiwifruit. Figure 8 In the text, pCAMBIA1302-GFP represents Agrobacterium infection control containing only the empty pCAMBIA1302-GFP vector; pCAMBIA1302-AcDRT100 represents Agrobacterium infection containing the recombinant plasmid vector.

[0025] Figure 9 This shows the expression of defense response-related genes AcNPR1, AcPR1, AcJAR1, and AcERF1 after PsaM228 infection of 'Hongyang' kiwifruit leaves. Figure 9 In the text, pCAMBIA1302-GFP represents Agrobacterium infection control containing only the empty pCAMBIA1302-GFP vector; pCAMBIA1302-AcDRT100 represents Agrobacterium infection containing the recombinant plasmid vector. Detailed Implementation

[0026] The present invention will now be described in conjunction with embodiments, providing a clear and complete description of the technical solutions in these embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0027] The pCAMBIA1302-GFP vector and various reagents used in the following examples are all commercially available; the 'Hongyang' kiwifruit variety is grown in a greenhouse; and the Pseudomonas syringaepv. actinidiae (Psa) M228 strain used in the experiment was isolated and provided by our laboratory.

[0028] Example 1

[0029] This embodiment describes the acquisition of the full-length cDNA sequence of the AcDRT100 gene.

[0030] RNA was extracted from leaves of 'Hongyang' kiwifruit using an RNA kit (Beijing Huayueyang Biotechnology Co., Ltd., catalog number: 0416-50); cDNA was obtained using a reverse transcription kit (Thermo Fisher Scientific, catalog number: K1162). The complete coding sequence (CDS) of the kiwifruit DRT100 gene (i.e., the AcDRT100 gene) was obtained based on the latest kiwifruit genome (V 3.0). Full-length primers for the AcDRT100 gene CDS sequence were designed using Primer 5.0 software, and PCR amplification was performed using cDNA as a template. The reaction system is shown in Table 1.

[0031] Table 1. Amplification system of AcDRT100 gene

[0032] Components volume cDNA 2.0μL AcDRT100-F (10μM) 2.0μL AcDRT100-R (10μM) 2.0μL 2×PhantaMaxBuffer 25.0μL NTPMix (10mMeach) 1μL PhantaMaxSuper-FidelityDNAPolymerase 1μL <![CDATA[ddH2O]]> 19.0μL Total volume 50.0μL

[0033] The PCR amplification program was based on the high-fidelity enzyme used (Nanjing Novizan Biotechnology Co., Ltd., catalog number: P505) and the optimized program used during the experiment. Specifically, it consisted of: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 58℃ annealing for 15 s, 72℃ extension for 45 s, 35 cycles; 72℃ extension for 5 min, and storage at 4℃. The agarose gel electrophoresis results of the PCR amplification products are shown below. Figure 1 As shown.

[0034] Example 2

[0035] This embodiment describes the sequence analysis and homologous evolutionary relationship of the AcDRT100 gene.

[0036] The cDNA sequence of the AcDRT100 gene, obtained by PCR gel electrophoresis, is consistent with its genomic coding region, with a full length of 1125 bp and encoding 374 amino acids. Homologous genes of this gene in different species were compared using the Phytozome database (https: / / phytozome.jgi.doe.gov / ), and a phylogenetic tree based on maximum likelihood (ML) was constructed using MEGAX (see...). Figure 2 The AcDRT100 gene was found to be evolutionarily distant from the previously reported DNA-damage-repair / toleration protein DRT100-like (DRT100) gene in Arabidopsis thaliana (L.) Heynh., suggesting that this gene is a newly discovered gene in kiwifruit.

[0037] Through multiple sequence alignment (see...) Figure 3 Conserved domain analysis using NCBI (National Center for Biotechnology Information) CD search (https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi) revealed that the AcDRT100 gene possesses a repetitive LRR domain. The LRR domain is described in [link to LRR domain description]. Figure 4 The nucleotide sequence of the AcDRT100 gene is shown in SEQ ID NO:2, and the amino acid sequence of the protein it encodes is shown in SEQ ID NO:1.

[0038] Example 3

[0039] This example describes the transient expression analysis of the AcDRT100 gene.

[0040] 1. Constructing recombinant expression vectors

[0041] The pCAMBIA1302-GFP vector carries a built-in GFP marker gene. Inserting the target gene after the 35S promoter satisfies both subcellular localization and gene overexpression functions; therefore, this vector was chosen for constructing the recombinant expression vector. Based on the available restriction enzyme sites (NcoI and SpeI) of the pCAMBIA1302-GFP vector, homologous arm primers were designed using SnapGene software (https: / / www.snapgene.com / ). The primer sequences used to construct the recombinant expression vector are as follows:

[0042] AcDRT100-SpeI-F:

[0043] TTGGAGAGGACACGCTCGAGATGGAGGTACTATTATTCAGCTCTA (SEQ ID NO: 3);

[0044] AcDRT100-NcoI-R:

[0045] CGCCCTTCGACATAAGCTTTAGAGCTGAATAATAGTACCTCCAT (SEQ ID NO: 4).

[0046] Using primer pairs with homologous restriction enzyme sites, the target gene fragment was re-amplified by PCR, purified, and its concentration was measured. The amplification system is shown in Table 2.

[0047] Table 2. Amplification systems of recombinant expression vectors

[0048] Components volume cDNA 2.0μL AcDRT100-SpeI-F (10μM) 2.0μL AcDRT100-NcoI-R (10μM) 2.0μL 2×PhantaMaxBuffer 25.0μL NTPMix (10mMeach) 1μL PhantaMaxSuper-FidelityDNAPolymerase 1μL <![CDATA[ddH2O]]> 19.0μL Total volume 50.0μL

[0049] Meanwhile, after activating E. coli containing the empty vector pCAMBIA1302-GFP, plasmids were extracted by shaking, and the concentration was detected. The plasmids were then subjected to double enzyme digestion. The double enzyme digestion system is shown in Table 3.

[0050] Table 3. Plasmid double enzyme digestion system

[0051] pCAMBIA1302-GFP plasmid vector 1.0μg SpeI 1.0μL NcoI 1.0μL 10×GreenBuffer 2.0μL <![CDATA[ddH2O]]> Bring the total volume to 20.0 μL.

[0052] Double enzyme digestion conditions: Digestion was performed at 37℃ for 1 h in a water bath, followed by enzyme inactivation at 85℃ for 10 min. Detection was performed by 1.0% agarose gel electrophoresis, and the target fragment (Shanghai Mygen Biotechnology Co., Ltd., catalog number: D2111-03) was purified and recovered. Using software provided by Novizan (CE Design V1.04), the amounts of the AcDRT100 gene fragment and the linearized pCAMBIA1302-GFP plasmid vector were calculated, and the two were ligated to obtain the recombinant pCAMBIA1302-AcDRT100 plasmid vector (1686 bp in length). The ligation system is shown in Table 4.

[0053] Table 4. Connection System

[0054] Linearized pCAMBIA1302-GFP plasmid vector 1.0μg AcDRT100 gene fragment 1.0μL 5×CEIIBuffer 1.0μL Exnase 2.0μL <![CDATA[ddH2O]]> Bring the total volume to 20.0 μL.

[0055] Note: Exnase and 5×CE II Buffer were purchased from Nanjing Novizan Biotechnology Co., Ltd., product number: C112.

[0056] The mixture was placed in a PCR instrument at 37°C for 30 min for ligation, and then transformed into E. coli competent cells DH5α (Beijing Qingke Biotechnology Co., Ltd., catalog number: TSC-C14), and recombinant E. coli were screened and sequenced for verification.

[0057] 2. Recombinant expression vector transformed into Agrobacterium

[0058] The recombinant *E. coli* culture, verified by sequencing, was incubated overnight at 37°C with shaking in 5 mL of LB / spe+ liquid medium with 200 rpm, using a 0.5 μL agar. The pCAMBIA1302-AcDRT100 plasmid vector was extracted from *E. coli* using a plasmid recovery kit (Beijing Zhuangmeng International Biotechnology Co., Ltd., catalog number: ZPK101-3) and transformed into *Agrobacterium* GV3101 (Shanghai Weidi Biotechnology Co., Ltd., catalog number: AC1001). After approximately 48 h of incubation, single colonies were picked and placed in LB liquid medium (containing kanamycin and rifampin), and cultured at 28°C with shaking at 220 rpm until the culture reached OD. 600 =0.6~0.8, to obtain Agrobacterium carrying the recombinant plasmid vector.

[0059] 3. Transient overexpression of the target gene

[0060] (1) Disinfection: Take leaves of 'Hongyang' kiwifruit that are of normal size and without disease spots. The kiwifruit are grown in the greenhouse of Northwest A&F University. Place the collected leaves in a foam box and soak them in 0.06% sodium hypochlorite (NaClO) in the dark for 5 minutes. Then rinse them twice with sterile water until there is no pungent odor. Soak the leaves for 1 minute before each rinse. Then use sterile filter paper to absorb excess moisture from the surface of the leaves.

[0061] (2) Leaf disc extraction: Place the treated leaves on sterile filter paper and use a sterile punch with a 1cm aperture to extract the leaf disc. When extracting the leaf disc, be careful to avoid the main vein and lateral veins of the leaf.

[0062] (3) Agrobacterium infection: Collect the Agrobacterium carrying the recombinant plasmid vector from step 2, wash twice with 10 mM MgCl2, and then resuspend in Agrobacterium infection solution (0.2 mM acetylsylgenone (AS), 10 mM MgCl2, pH=5.6 (adjusted with KOH) 10 mM MES). Then place the prepared leaf discs into 50 mL centrifuge tubes containing the bacterial suspension, mix well, and ensure the leaf discs are fully in contact with the Agrobacterium suspension. Use a vacuum method (0.2 MPa, 15 min) to fully immerse the leaf discs. Then remove the leaf discs, absorb the surface moisture, place them on 0.08% water agar, and incubate at 28℃ for 48 h. Agrobacterium infection containing the pCAMBIA1302-GFP empty vector was used as a control; the remaining treatment steps were the same.

[0063] (4) Inoculation with Psa: Take 20 μL of Psa M228 bacterial culture stored at ultra-low temperature and inoculate it onto LB solid medium using the streak plate method in a clean bench. After activation culture at 28℃ for 2 days, when single colonies have formed, randomly pick a single colony and inoculate it into LB liquid medium. Incubate at 28℃ and 220 rpm for 14 hours until OD reaches the target value. 600=0.6. The obtained bacterial suspension was centrifuged at 8000 rpm for 10 min, the bacterial precipitate was collected, the bacterial cells were washed three times with sterile water and then mixed by pipetting. The concentration of the bacterial suspension was determined using a spectrophotometer. The concentration of the bacterial suspension was then adjusted to OD. 600 =0.1, collect bacterial cells and dilute to a final concentration of 1×10. 5 CFU / mL. The same vacuum method was used to infect kiwifruit leaves with PsaM228.

[0064] 4. Analysis of transient overexpression results of the target gene

[0065] (1) Statistics on leaf disease incidence and AcDRT100 gene expression

[0066] After infecting kiwifruit leaves with Psa M228 using the above method, the leaves were incubated at 16℃ for about 5 days. The disease incidence of the leaves after Psa M228 infection was observed by taking pictures, and the area of ​​lesions was counted. In addition, the relative expression level of AcDRT100 gene was counted. Figure 5 The difference in phenotypes is due to Psa M228 infection of 'Hongyang' kiwifruit leaves. Figure 6 The left image shows the lesion area statistics after Psa M228 infection of 'Hongyang' kiwifruit leaves, and the right image shows the relative expression level of the AcDRT100 gene. Figures 5-6 The results showed that after inoculation with Psa M228, the leaves of 'Hongyang' kiwifruit overexpressing the AcDRT100 gene exhibited reduced disease incidence and significantly decreased lesion area. The relative expression level of the AcDRT100 gene was increased, indicating that transient overexpression of the AcDRT100 gene in kiwifruit materials enhanced resistance to Psa.

[0067] (2) Temporal expression characteristics of the AcDRT100 gene during Psa infection

[0068] Samples were taken at 0h, 12h, 24h, 48h, 72h, 96h, and 120h after Psa M228 infection. RNA was extracted from kiwifruit leaves and cDNA was obtained using a reverse transcription kit. The expression of the AcDRT100 gene was detected by qRT-PCR using these cDNAs. Figure 7 This shows the expression of the AcDRT100 gene at different time points after PsaM228 infection of 'Hongyang' kiwifruit leaves. Figure 7 It can be seen that the AcDRT100 gene is significantly upregulated after being induced by Psa M228, and the expression level is the highest at 48h.

[0069] (3) Calculation of leaf disc pathogen biomass after Psa infection

[0070] Three leaf discs infected with Psa M228 for 5 days were collected. The discs were surface-sterilized with 0.6% NaClO for 30 seconds, rinsed three times with sterile water, then surface-sterilized with 75% alcohol for 30 seconds, and rinsed three times with sterile water. The surface moisture was then blotted dry with sterile filter paper. The dried discs were placed in a pre-prepared sterile mortar with 1 mL of sterile water and ground into a homogenate. After standing for 10 minutes, a 10-fold serial dilution was performed. 50 μL of the diluted solution was spread onto LB agar containing 50 μg / mL kanamycin, and then inverted in a 28°C incubator. After 4 days of incubation, the discs were irradiated with UV light, and colonies exhibiting green fluorescence were counted. Each treatment was performed in triplicate. Figure 8 This shows the biomass changes after Psa M228 infected the leaves of 'Hongyang' kiwifruit. Figure 8 This indicates that the biomass of PsaM228 decreased significantly after overexpression of the AcDRT100 gene.

[0071] (4) Expression of immune-related genes in leaf discs after Psa infection

[0072] The salicylic acid (SA) pathway genes NPR1 and PR1, the jasmonic acid (JA) pathway gene JAR1, and the ethylene (ET) pathway gene ERF from Arabidopsis thaliana were compared with the kiwifruit database to obtain the corresponding homologous genes in kiwifruit: AcNPR1, AcPR1, AcJAR1, and AcERF1. qRT-PCR specific primers for these genes were designed using NCBI Primerblast, and their specificity was verified to ensure accurate amplification results. The expression of the above four genes was detected using cDNA from leaf discs 1 day after inoculation with Psa M228. The reaction system followed the ChamQ assay of Novizan. The qPCRMasterMix manual was used, with Actin as the internal control gene. The relative expression levels of each gene were calculated using the 2-ΔΔT method to analyze the expression of immune-related genes. Three biological replicates were performed.

[0073] Figure 9 This shows the expression of defense response-related genes AcNPR1, AcPR1, AcJAR1, and AcERF1 after PsaM228 infection of 'Hongyang' kiwifruit leaves. Figure 9 The results showed that the expression levels of defense response-related genes were significantly upregulated after Psa induction.

[0074] In summary, this invention screened out the AcDRT100 gene, which can enhance the resistance of kiwifruit to bacterial canker. This gene was upregulated in the 'Hongyang' kiwifruit variety under Psa induction, significantly reducing the incidence of disease and improving plant resistance. Furthermore, experiments confirmed that transient overexpression of the AcDRT100 gene in kiwifruit can enhance the expression levels of disease resistance pathway genes AcNPR1, AcPR1, AcJAR1, and AcERF1, providing theoretical support for the study of the molecular mechanisms of kiwifruit resistance to bacterial canker. This invention provides new insights and approaches for creating high-quality kiwifruit germplasm materials, reducing reliance on pesticides in the control of bacterial canker in kiwifruit, and improving kiwifruit quality and yield.

[0075] The embodiments described above are only some, not all, of the embodiments of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments. All other embodiments obtained by those skilled in the art through related deductions and substitutions based on the inventive concept, without inventive effort, are within the scope of protection of the present invention.

Claims

1. The application of AcDRT100 protein in improving the disease resistance of kiwifruit, characterized in that, The AcDRT100 protein plays a positive regulatory role in kiwifruit infection with the pathogen causing peptic ulcer disease. The amino acid sequence of the AcDRT100 protein is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that, The pathogen is *Pseudomonas syringae*, a pathogenic strain of Actinobacillus kiwifruit. Pseudomonas syringae pv. Actinidiae.

3. A method for breeding kiwifruit varieties resistant to bacterial canker, characterized in that, The method includes: The gene encoding the AcDRT100 protein was transferred into an expression vector to obtain a recombinant expression vector, which was then transferred into kiwifruit material. The nucleotide sequence of the gene encoding the AcDRT100 protein is shown in SEQ ID NO:2.