CD99 gene molecular marker primer related to yolk weight of duck eggs and application of CD99 gene molecular marker primer

Abstract

The invention relates to a CD99 gene molecular marker primer related to duck egg yellow weight and application of the CD99 gene molecular marker primer, and belongs to the technical field of biology. The molecular marker is located at the 135221179th basic group of a No.1 chromosome of a duck reference genome GCF015476345.1 ZJU1.0 version, has A / T polymorphism, has three genotypes of A / A, A / T and T / T, and is located in an intron region of a CD99 gene. The egg yolk weight of the A / A genotype individual of the CD99 gene is higher than that of the A / T genotype individual and that of the T / T genotype individual; the molecular marker is used for screening the yellow weight index of the high-quality duck eggs and improving the rate of the high-quality duck eggs, can be applied to early selection of the high-quality ducks, is beneficial to accelerating the breeding progress, improving the breeding accuracy and reducing the breeding cost and the production cost, and has great economic application value and breeding value for the high-quality ducks.

Description

Technical Field

[0001] The invention relates to a CD99 gene molecular marker primer related to duck egg yolk weight and application thereof, belonging to the field of biotechnology. Background Art

[0002] With the development of the economy, people's demand for high-quality duck eggs continues to increase, prompting the egg-laying duck industry to flourish. The egg-laying performance of egg-laying ducks is a key indicator to measure their economic value, covering traits such as age of laying, egg production and egg quality, while yolk weight is an important parameter for evaluating egg quality. Egg yolks are rich in high-quality protein and essential amino acids for the human body, which play an important role in maintaining cell function and enhancing the immune system. At the same time, the fat in the yolk includes oleic acid, which helps regulate cholesterol levels, and linoleic acid, which is essential for the development of the nervous system and vision. Egg yolks are also a good source of multiple vitamins, such as vitamin A, which has a positive effect on preventing night blindness and dry eyes, and vitamin D, which promotes calcium absorption and bone health. In addition, egg yolks also contain minerals such as iron, zinc, selenium, and phosphorus, which are indispensable for the regulation of various physiological functions. Therefore, a larger yolk weight usually means that duck eggs contain more nutrients and are beneficial to the health of consumers. In terms of duck egg products, such as salted duck eggs and preserved duck eggs, the weight of the yolk directly affects the quality and taste of the final product. Egg processing companies may select duck eggs suitable for specific purposes based on the weight of the yolk. At the same time, yolk weight is also related to the hatching ability of duck eggs. During the incubation process, the yolk provides nutrition for embryo development. Duck eggs with larger yolk weight tend to have a higher hatching success rate.

[0003] In summary, egg yolk weight is an important component of egg-laying duck production performance and is affected by a variety of factors. Farmers need to implement refined management from multiple aspects such as selecting improved breeds, optimizing feed formulas, and improving the feeding environment to ensure that egg-laying ducks produce high-quality eggs. At the same time, further exploration should be made into methods for accurately regulating egg yolk weight under different environments to promote the sustainable development of the egg-laying duck industry.

[0004] CD99 is a transmembrane protein that plays a key role in cell-cell interactions, cell migration, and signal transduction. It is expressed in a variety of cell types, including immune cells, nerve cells, and germ cells. Its normal function is essential for processes such as cell recognition, adhesion, and intercellular communication. The CD99 gene is involved in the signal transduction process between the hypothalamus and pituitary cells. Studies have shown that abnormal expression of the CD99 gene may affect the function of GnRH neurons, thereby interfering with the normal secretion of gonadotropin. For example, in some experimental models, when CD99 gene expression is inhibited, the activity of GnRH neurons is abnormal, resulting in a decrease in FSH and LH secreted by the pituitary. Gonadotropin stimulates the growth of ovarian follicles, allowing the egg-laying duck's body to transport more nutrients to the developing follicles. Nutrients such as protein, fat, vitamins, and minerals will gradually accumulate in the follicles, and these nutrients will eventually constitute the main components of the yolk. As the follicles mature, the weight of the yolk will continue to increase. When the gonadotropin level in laying ducks is high, their ovarian function is active, the follicles can fully develop, more nutrients are accumulated during the yolk formation process, and the yolk weight is usually larger. On the contrary, if the gonadotropin level is insufficient, the follicle development is limited, less nutrients are accumulated, and the yolk weight may be smaller. Although further research is needed to confirm this, the CD99 gene may have an indirect effect on yolk weight through multiple pathways. Summary of the invention

[0005] The purpose of the present invention is to address the defects of the prior art, propose a primer for a CD99 gene molecule marker related to duck egg yolk weight and its application, further confirm the influence of the CD99 gene on duck egg yolk weight, quickly and accurately identify duck egg yolk weight and provide a new way for screening related to duck egg yolk weight.

[0006] The present invention first provides a primer for a CD99 gene molecular marker related to duck egg yolk weight. The present invention measures the egg yolk weight of a 30-week-old Jinding duck, performs SNP genotyping using whole genome resequencing technology, and obtains a CD99 gene molecular marker significantly related to duck egg yolk weight through whole genome association analysis, providing new gene and molecular marker resources for duck egg yolk weight trait selection. The molecular marker is located at the 135221179th base of chromosome 1 of the duck reference genome GCF_015476345.1_ZJU1.0 version, and the base mutation CD99 gene sequence is shown in SEQ ID NO:3 or SEQ ID NO:4 as the 174th base. The deoxyribonucleotide sequence of the duck DNA specific primer pair required for CD99 gene molecular marker detection is shown in SEQ ID NO:1 and SEQ ID NO:2.

[0007] The present invention further provides the application of primers of CD99 gene molecular markers related to duck egg yolk weight, which are used to detect the SNP molecular marker genotypes related to duck egg yolk weight of Jinding duck. The method specifically applied to the method of detecting the SNP genotypes related to duck egg yolk weight by PCR amplification combined with Sanger sequencing comprises the following steps: The first step is to perform PCR amplification on the duck DNA sample to be tested using duck DNA specific primers to obtain an amplified product; The second step is to perform Sanger sequencing on the amplified product; The third step is to determine the molecular marker genotype of the target site based on the sequencing results of the second step.

[0008] The nucleotide sequence of the duck DNA-specific primer pair in the first step of the above method consists of an upstream primer 5'-TCGCCAACTGAAGGAGTC-3' (SEQ ID NO: 1) and a downstream primer 5'-TGTTTGTGCCCTGAGGAT-3' (SEQ ID NO: 2).

[0009] In the second step, the final concentration of the reaction system is calculated as follows based on 25 μl: Duck DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl. The reaction conditions of the PCR amplification are 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 60 sec, 30 cycles in total; 72°C extension for 2 min; 20°C storage. The amplified product is 347 bp in length and contains the 135221179th base on chromosome 1 of the duck reference genome GCF_015476345.1_ZJU1.0 version, and the base mutations are A / A, A / T, and T / T. The nucleotide sequences of the amplified products are shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0010] In the third step, the judgment standard is that the yolk weight of ducks with A / A genotype at the CD99 gene SNP site is higher than that of ducks with A / T genotype and T / T genotype, and the yolk weight of ducks with A / T genotype is higher than that of ducks with T / T genotype.

[0011] The present invention detects the genotype of duck egg yolk weight by CD99 gene molecular markers, and the yolk weight of individuals with A / A genotype at 30 weeks of age is higher than that of individuals with A / T genotype and T / T genotype at CD99 gene SNP site, and the yolk weight of individuals with A / T genotype is higher than that of individuals with T / T genotype. By using the genomic DNA of the duck to be tested as a template and using a specific primer pair for PCR amplification, and then performing Sanger sequencing and SNP molecular marker genotyping on the PCR amplification product, the genotype of the SNP molecular marker can be used to select the duck egg yolk weight. In breeding, according to the breeding goal, by eliminating CD99 gene A / T genotype individuals, CD99 gene A / A genotype, T / T genotype individuals, the present invention uses the above molecular markers to screen high-quality duck egg yolk weight indicators, which has the beneficial effect of being able to efficiently and quickly identify duck egg yolk weight traits, improve the rate of high-quality duck eggs, help accelerate breeding progress, improve breeding accuracy, reduce breeding costs and production costs, and have great economic application value and breeding value for high-quality ducks, providing a scientific basis for the early selection of high-quality ducks. In addition, the detection method disclosed in the present invention is simple and easy to operate, can be carried out in the laboratory, and can also be applied to genome breeding technology. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This is the Manhattan plot of the GWAS analysis of duck egg yolk weight at 30 weeks of age.

[0013] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the three genotypes of the CD99 gene. Figure 3 This is the phenotypic distribution diagram of individuals with three genotypes of the chr1:135221179 molecular marker. DETAILED DESCRIPTION

[0014] The following embodiments are applicable to the breeding of Jinding ducks, which are commercially available and will not be described in detail. Example

[0015] In this example, the egg yolk weight of 30-week-old Jinding ducks was measured, and SNP genotyping was performed using whole genome resequencing technology. The CD99 gene molecular marker significantly associated with egg yolk weight was screened through whole genome association analysis. The results are as follows: Figure 1 shown.

[0016] This example uses the following experiments to identify and apply the CD99 gene molecular marker related to duck egg yolk weight. 1. Phenotypic and genotypic testing (1) Experimental materials and yolk weight phenotype determination 548 Jinding female ducks were selected as experimental animals and raised under the same feeding conditions with free access to food and water. At 30 weeks of age, the yolk weight of eggs produced by each duck was recorded in turn as the phenotypic data of duck egg yolk weight.

[0017] (2) Extraction of genomic DNA Blood was collected from the subwing vein of the individual to be tested, lysed after anticoagulation, digested with proteinase K, extracted with saturated sodium chloride method, dissolved in TE and stored at -20℃.

[0018] (3) PCR amplification Using the genomic DNA extracted as above as a template, a fragment containing the SNP molecular marker at base position 135221179 of duck chromosome 1 was amplified.

[0019] Upstream primer: 5'-TCGCCAACTGAAGGAGTC-3' (SEQ ID NO: 1) Downstream primer: 5'-TGTTTGTGCCCTGAGGAT-3' (SEQ ID NO: 2) The final concentration of the reaction system (25 μl) is: DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5 μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl.

[0020] The reaction conditions of PCR amplification are: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 55°C annealing for 30 sec, 72°C extension for 60 sec, 30 cycles in total; 72°C extension for 2 min; 20°C storage; 10 μl was taken for agarose detection, and a single target band of CD99 gene with a length of 347 bp was amplified, containing the 135221179th base of duck chromosome 1. The nucleotide sequence of the amplified product is shown in SEQ ID NO:3 or SEQ ID NO:4: TCGCCAACTGAAGGAGTCTGTCATCAGAGGACAGTTTTCATTTCTGCAGCTTACACTGTAGCCCCACCTAAAAAAAATGAAGATTGAACGCTCATCATTTCTGCTACGGATATCCTTTGCCAGTTCTACATCAGCTGCTTTCCATGCCCTTTTTGCCCCCATCCCTTTGAGACATCAAGGGGGAACCCTGTACCCATAGAGAAGTATGGGCAGCCTTTCCCTTTTCCTCCATTTCACACCCCTTTTCAGAGGGCAGGTGGGTCACTGATTGCCTCATCATGCCTCAGTTACACCCCAGCTACAGAAACAGAGGGAAAAAAAGTGACAGGATCCTCAGGGCACAAACA (SEQ ID NO:3).

[0021] TCGCCAACTGAAGGAGTCTGTCATCAGAGGACAGTTTTCATTTCTGCAGCTTACACTGTAGCCCCACCTAAAAAAAATGAAGATTGAACGCTCATCATTTCTGCTACGGATATCCTTTGCCAGTTCTACATCAGCTGCTTTCCATGCCCTTTTTGCCCCCATCCCTTTGAGACTTCAAGGGGGAACCCTGTACCCATAGAGAAGTATGGGCAGCCTTTCCCTTTTCCTCCATTTCACACCCCTTTTCAGAGGGCAGGTGGGTCACTGATTGCCTCATCATGCCTCAGTTACACCCCAGCTACAGAAACAGAGGGAAAAAAAGTGACAGGATCCTCAGGGCACAAACA (SEQ ID NO:4).

[0022] (4) Sequencing verification and genotyping The PCR products of each sample were subjected to Sanger sequencing, and the sequencing chromatograms are as shown in Figure 2 and Figure 3 shown.

[0023] 2. Result analysis 511 30-week-old Jinding female ducks with clear records of egg yolk weight phenotype were selected for correlation analysis. The t.test test function of R4.0 software was used for statistical test, and the pairwise mean comparison mode was selected to perform statistical test on the genotype and egg yolk weight of the experimental duck group. P<0.05 indicated a significant difference, and P<0.01 indicated an extremely significant difference. The results are shown in Tables 1 and 2. Figure 2 , Figure 3 As shown, among the individuals tested, there were 301 individuals with the A / A genotype of the CD99 gene, 113 individuals with the A / T genotype, and 97 individuals with the T / T genotype. The yolk weight of the individuals with the three genotypes at 30 weeks of age was significantly different (p<0.01). The average yolk weight of the A / A genotype individuals at 30 weeks of age was 26.97, which was significantly higher than that of the A / T and T / T genotype individuals (p<0.01), and was 1.53 higher than that of the A / T genotype individuals and 2.62 higher than that of the T / T genotype individuals. The average yolk weight of the A / T genotype individuals was 25.44, which was significantly higher than that of the T / T genotype individuals (p<0.01), and was 1.09 higher than that of the T / T genotype individuals. The results showed that the duck CD99 gene molecular marker was significantly correlated with duck egg yolk weight. According to the actual breeding goals, CD99 gene A / A genotype individuals can be selected to increase duck egg yolk weight, or CD99 gene T / T genotype individuals can be selected to reduce duck egg yolk weight, thereby improving the overall yolk weight uniformity, improving breeding efficiency, and meeting market demand. Table 1 Association analysis between the molecular marker at base 135221179 on chromosome 1 and yolk weight genotype Number / piece Egg yolk weight at 30 weeks Standard Deviation CV A / A 301 <![CDATA[26.97 a ]]> 0.77 2.86% A / T 113 <![CDATA[25.44 b ]]> 0.68 2.68% T / T 97 <![CDATA[24.35 c ]]> 0.67 2.75% Note: Data in the same column with the same letters on their shoulders indicate no significant difference, while data with different letters on their shoulders indicate significant difference (P<0.05).

[0024] In addition to the above implementations, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the protection scope required by the present invention.

Claims

1. A primer for CD99 gene molecular marker related to duck egg yolk weight, characterized in that: The nucleotide sequences of the primers for the molecular marker are shown in SEQ ID NO: 1 and SEQ ID NO:

2.

2. The use of primers for the CD99 gene molecule marker associated with duck egg yolk weight according to claim 1, characterized in that: Detect the SNP molecular marker genotypes associated with duck egg yolk weight of Jinding duck.

3. The use of primers for CD99 gene molecular markers related to duck egg yolk weight according to claim 2, characterized in that: The detection method comprises the following steps, The first step is to perform PCR amplification on the duck DNA sample to be tested using duck DNA specific primers to obtain an amplified product; The second step is to perform Sanger sequencing on the amplified product; The third step is to determine the molecular marker genotype of the target site based on the sequencing results of the second step.

4. The use of primers for the CD99 gene molecule marker associated with duck egg yolk weight according to claim 3, characterized in that: The nucleotide sequence of the duck DNA-specific primer pair in the first step consists of an upstream primer SEQ ID NO: 1 and a downstream primer SEQ ID NO:

2. The amplified product is 347 bp in length and contains the 135221179th base on chromosome 1 of the duck reference genome GCF_015476345.1_ZJU1.0 version, and the base mutations are A / A, A / T, and T / T.

5. The use of primers for duck egg yolk weight-related CD99 gene molecule markers according to claim 4, characterized in that: The final concentration of the PCR reaction system is 25 μl. Duck DNA to be tested 50 ng 2 x Accurate Taq Master Mix 12.5μl Upstream primer 1 μl Downstream primer 1 μl Add sterile water to 25 μl. The reaction conditions of the PCR amplification are: pre-denaturation at 94°C for 5 minutes; denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 60 seconds, for a total of 30 cycles; extension at 72°C for 2 minutes; and storage at 20°C. The nucleotide sequences of the amplified products are shown in SEQ ID NO: 3 and SEQ ID NO:

4.

6. The use of primers for CD99 gene molecular markers related to duck egg yolk weight according to claim 3, characterized in that: In the third step, the judgment standard is that the yolk weight of ducks with A / A genotype at the CD99 gene SNP site is higher than that of ducks with A / T genotype and T / T genotype, and the yolk weight of ducks with A / T genotype is higher than that of ducks with T / T genotype.

Images