SNP molecular marker related to heat stress resistance traits of sheep and application thereof
By identifying an A/C polymorphic SNP molecular marker at position 209 of the sheep TSHR gene, primers were designed for PCR amplification and sequencing, solving the problem of the lack of molecular markers for heat stress resistance in sheep, and realizing the identification and breeding improvement of heat stress resistance in sheep.
Patent Information
- Application Number
- CN202411742376.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-29
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2044-11-29
AI Technical Summary
The lack of molecular markers for heat stress resistance traits in existing technologies is a problem that affects the summer production performance and health of meat sheep.
By discovering and utilizing the A/C polymorphic SNP molecular marker at position 209 of the sheep TSHR gene, specific primers were designed for PCR amplification and sequencing to identify sheep individuals with higher heat stress resistance.
It enabled early prediction and molecular marker-assisted breeding of sheep resistant to heat stress, improving the production performance and health of sheep in high-temperature environments.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular biology, specifically, it relates to a SNP molecular marker associated with heat stress resistance in sheep and its application. Background Technology
[0002] Sheep are a vital source of animal protein for humans. To increase mutton production, large-scale, intensive sheep farming has become an inevitable trend in my country's sheep industry. In modern intensive sheep farming, increasing stocking densities makes the impact of environmental stress on sheep production and health undeniable. Thermal environment is often a significant factor affecting the development of the sheep farming industry. Temperature and humidity are the two most sensitive factors in a thermal environment. In hot and humid summer conditions, sheep are highly susceptible to heat stress, leading to physiological, biochemical, immune, and metabolic imbalances, thus affecting their production performance, including feed intake, daily weight gain, time to market, reproductive performance, and immune function, resulting in substantial economic losses for the sheep industry during the summer. Therefore, improving the heat stress resistance of sheep is of great significance for sheep farming. In sheep breeding, molecular markers with heat stress resistance can be used to identify individuals with better heat stress resistance for breeding purposes; however, currently, there are few suitable molecular markers for selecting heat stress resistance traits in local Chinese sheep breeds.
[0003] The sheep thyroid-stimulating hormone receptor (TSHR) gene is located on chromosome 7, has 10 exons, and encodes a 764-amino acid transmembrane protein. The TSHR protein has seven transmembrane structures; the extramembrane and intramembrane structures each form three loops. The intramembrane structure has a shorter amino acid sequence, including a C-terminus and a phosphorylation site. TSHR is mainly expressed in thyroid cells and plays an important role in controlling thyroid cell metabolism. It maintains the normal function of thyroid follicles and promotes their growth. Studies have also found that TSHR is expressed in tissues of the sheep brain, including the pituitary tubercle, median eminence, ependymal paraventricular nucleus, and third ventricle.
[0004] TSHR plays a crucial role in the hypothalamic-pituitary-gonadal axis, regulating photoperiodic response and seasonal reproduction. The increased T3 concentration resulting from the interaction of TSHR and TSHβ suppresses estrus in sheep. However, the mechanism differs in birds: in birds, photoperiodic signal transduction begins with stimulation of photoreceptors deep in the brain. This is then further converted into neuroendocrine signals transmitted to the pituitary tubercle, inducing thyroid-stimulating cells to secrete TSHβ. TSHβ from the pituitary tubercle binds to TSHR expressed by ependymal cells, inducing DIO2 expression and converting T4 to biologically active T3. Increased DIO2 expression under prolonged light exposure, coupled with T3 induced by prolonged light exposure, leads to increased LH and follicle-stimulating hormone (FSH) secretion, further affecting gonadal growth. Besides regulating the aforementioned seasonal reproductive pathway, TSHR also plays a regulatory role in certain animal biological functions. Studies have found that TSHR expression levels differ between female and male black bass during germ cell maturation in different seasons. In female black bass, the TSHR gene plays a regulatory role in egg maturation and ovulation. In male black bass, it plays a regulatory role in gamete maturation and sperm release. Summary of the Invention
[0005] The purpose of this invention is to provide an SNP molecular marker related to heat stress resistance in sheep and its application.
[0006] To achieve the objectives of this invention, in a first aspect, this invention provides a SNP molecular marker associated with heat stress resistance in sheep, said molecular marker containing sheep... TSHR The nucleotide sequence of the gene, as shown in SEQ ID NO:1, has a polymorphism of A / C at position 209.
[0007] Furthermore, sheep individuals with genotypes AA and AC at the aforementioned polymorphic sites exhibit higher heat stress resistance than sheep individuals with genotype CC.
[0008] In this invention, sheep TSHR The gene's reference sequence number in NCBI is NC_056060.1, ARS-UI_Ramb_v2.0.
[0009] In a second aspect, the present invention provides primers for amplifying the molecular marker, including an upstream primer as shown in SEQ ID NO:2 and a downstream primer as shown in SEQ ID NO:3.
[0010] Thirdly, the present invention provides detection reagents or kits containing the primers.
[0011] Fourthly, this invention provides a method for identifying and breeding heat-stress-resistant sheep breeds, comprising:
[0012] 1) Extract total DNA from the sheep to be tested;
[0013] 2) Using DNA as a template, PCR amplification was performed using the primers shown in SEQ ID NO:2-3;
[0014] 3) Analyze the PCR amplification products.
[0015] Preferably, the PCR reaction system is as follows: 12.5 μL of 2 × Phanta Max Master Mix, 50-100 ng of DNA template, 1 μL each of 10 μM upstream and downstream primers, and ddH2O to a final volume of 25 μL.
[0016] Preferably, the PCR reaction program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 34 cycles; 72℃ final extension for 5 min.
[0017] Further, step 3) includes: performing Sanger sequencing on the amplified products to obtain the genotypes of the sites with the polymorphisms, and sheep individuals with genotypes AA and AC have higher heat stress resistance than sheep individuals with genotype CC.
[0018] Fifthly, the present invention provides any of the following applications of the molecular marker or its detection reagent:
[0019] (1) Used for early prediction of heat stress in sheep;
[0020] (2) Used for molecular marker-assisted breeding of sheep.
[0021] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects:
[0022] This invention was first discovered in TSHR A genetic SNP is found to be significantly associated with heat stress resistance in sheep, and can serve as a molecular marker for this trait. Sheep individuals identified using this method exhibit relatively strong heat stress resistance, and can be used to breed new sheep breeds with heat stress resistance. Attached Figure Description
[0023] Figure 1 In a preferred embodiment of the present invention, significant signal sites related to sheep temperature adaptability were obtained through genome-wide association analysis.
[0024] Figure 2 This is a PCR result diagram containing the target SNP site in a preferred embodiment of the present invention. The leftmost band is the DNA marker, and the remaining bands are PCR amplification bands of sheep DNA.
[0025] Figure 3 The results are Sanger sequencing results of PCR product fragments in a preferred embodiment of the present invention. Detailed Implementation
[0026] The present invention aims to provide a method for screening major gene loci for heat stress resistance in local Chinese sheep and a corresponding detection method.
[0027] The present invention also provides TSHR Gene molecular markers and their application in sheep breeding.
[0028] The present invention adopts the following technical solution:
[0029] This invention provides a method for breeding sheep with high heat stress resistance. The genotype at position 90568094 on chromosome 7 of sheep is detected. The reference genome version is ARS-UI_Ramb_v2.0, GCF_016772045.1. Individuals with genotypes AA and AC at this locus have higher heat stress resistance than individuals with genotype CC.
[0030] The present invention also provides the application of a substance for detecting the genotype of a SNP locus in the assisted breeding of heat stress resistance in sheep. The SNP locus is located at position 90568094 on sheep chromosome 7, at position 209 of the nucleotide sequence described in SEQ ID NO:1, and has A / C polymorphism (n=a or c).
[0031] Furthermore, the substance is a primer pair, the nucleotide sequences of which are shown in SEQ ID NO:2 and SEQ ID NO:3.
[0032] The present invention also provides a primer pair, the nucleotide sequence of which is shown in SEQ ID NO:2-3.
[0033] The present invention also provides a kit containing the primer pair described above.
[0034] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.
[0035] Example 1 TSHR Discovery of gene SNP molecular markers
[0036] Redundancy analysis (RDA) was performed on climate data and resequencing genomic data. It was found that annual temperature range (bio7) and precipitation in the driest month (bio14) could explain most of the environmental factor variation for different genotypes. Using resequencing data from 400 individuals of eight local sheep breeds (Tibetan sheep, Oula sheep, Large-tailed Han sheep, Small-tailed Han sheep, Sishui fur sheep, Wadi sheep, Tan sheep, and Hu sheep) living in different temperature regions, a latent factor mixed effects (LFMM) model was used to analyze the association between the environmental factor bio7 and genomic data. The results showed that significant association sites with bio7 were distributed across multiple chromosomes, suggesting that there are major genes involved in adaptation to the bio7 environmental factor. Figure 1 ).in TSHR The intron region chr7:90568094 (reference genome version: ARS-UI Rammb v2.0) contains both A and C alleles. The A allele frequency was significantly higher than the C allele frequency in sheep populations with strong heat stress resistance. Similarly, the allele frequency variation at chr7:90568094 was consistent with the bio7 distribution gradient, suggesting that the A allele at this locus helps sheep adapt to high-temperature environments and resist heat stress. Figure 1 ( ), which can be used as a molecular breeding marker for screening or introducing sheep with heat stress adaptability.
[0037] exist TSHR A gene SNP is found that is significantly associated with heat stress resistance in sheep. This SNP is located at position 90568094 on chromosome 7 of sheep (reference genome version is ARS-UI_Ramb_v2.0, GCF_016772045.1) and has A / C polymorphism. When the genotype of this SNP locus is AA or AC, it has better heat resistance than CC and can be used as a molecular marker for heat stress resistance in sheep.
[0038] Example 2 Detection of SNP molecular markers
[0039] The SNP molecular marker detection method provided in this embodiment includes:
[0040] (1) The SNP is located at position 209 of the nucleotide sequence shown in SEQ ID NO:1. Based on the upstream and downstream sequences of this SNP site, specific primers for amplifying this fragment were designed:
[0041] Upstream primer TSHR-F1: 5′- TAGACTGGCTGCTGTAACCTC-3′ (SEQ ID NO:2)
[0042] Downstream primer TSHR-R1: 5′- CACAGCATTACCACAGTCTG -3′ (SEQ ID NO:3)
[0043] (2) Using the specific primers from (1), PCR amplification was performed on the sheep DNA sample to obtain an amplified product containing the mutated region. The amplified product was 460 bp. Figure 2 The sequence is as follows (where the 209th base is a mutation sequence), which is an A>C mutation: 5'-TAGACTGGCTGCTGTAACCTCTTACTTGGGTTTTTGTACATAAATGAGGTTAATTGACCCCCTTCCTCCATTTTTAGACTTCACAGTGCTCTGGAGCTTGATATCCAGCCATTGCCTGAAGAGGCCACGTCTGGACCATACCCTGTGGCATTTGTAAACAAGGCTGCTTATCACTGCCATCTGAGGAGTCAATTGGCCAGCACACCATNTGATGATTG ACTCTCTATCACTTTTTCCTTACAGTGAAAGTTTAGCATGGCCCACCTCATTATTTTGAAGGAAAAGTGCATTGCTTTTTTGATTCAATCCTTTATAACCTTCACTCAGGAGATAGTTACAGAGGCATTGTACTTGGCATTGGTGATACAGCAATGAGTAAGACAGAGCTTACATCCTGATTGGGGAGACAATGAAAAAGTAAACAAAGAAGCAAGATAATCACAGACTGTGGTAATGCTGTG-3' (SEQ ID NO:1).
[0044] The amplification system is shown in Table 1:
[0045] Table 1 TSHR Amplification System
[0046]
[0047] The 2 × Phanta® Max Master Mix was prepared using a high-fidelity PCR enzyme from Nanjing Novizan Biotechnology Co., Ltd., catalog number P525-02.
[0048] The amplification conditions were as follows: Amplification was performed using a PCR amplification instrument. The first stage was pre-denaturation at 95℃ for 5 min; the second stage was denaturation at 95℃ for 30 s, annealing at 60℃ for 30 s, extension at 72℃ for 30 s, for 34 cycles; the third stage was final extension at 72℃ for 5 min, and storage at 4℃.
[0049] (3) The amplified products were subjected to Sanger sequencing to obtain the genotypes of the SNP sites. Figure 3 ).
[0050] Example 3: Validation of SNP molecular markers
[0051] In August, the genomes of 78 Hu sheep individuals living in the same factory area with an ambient temperature of 28-35℃ and respiratory rates measured at temperatures of 30-34℃ were amplified. The amplification primers, amplification conditions, and amplification system were the same as in Example 2. The sequencing results of the PCR products showed that 28 sheep were homozygous individuals containing the SNP locus (genotype CC), 43 sheep were heterozygous individuals containing the SNP locus (genotype AC), and 7 sheep were wild-type individuals (genotype AA, consistent with the reference genome).
[0052] The respiratory rate (breaths / minute) of all sheep was measured multiple times, with the respiratory rate reflecting the degree of heat stress. A variance analysis was performed on the respiratory rate of each sheep and its genotype, and the results are shown in Table 2. Homozygous individuals with this molecular marker mutation had a higher respiratory rate than wild-type and heterozygous individuals, indicating a higher degree of heat stress. Significant differences were observed among the three genotypes, suggesting that sheep with genotypes AA and AC had lower respiratory rates and stronger resistance to heat stress.
[0053] Table 2. Analysis of variance of mean respiratory rate in sheep of different genotypes
[0054]
[0055] Note: Different lowercase letters on the same shoulder label indicate significant differences (P<0.05).
[0056] The experimental results above show that locus 90568094 on chromosome 7 of sheep (reference genome version is ARS-UI_Ramb_v2.0, GCF_016772045.1) has A / C polymorphism. When the genotype at this locus is AA or AC, the average respiratory rate and heat stress indicators are significantly reduced. Sheep individuals with genotypes AA and AC have better heat stress resistance than individuals with genotype CC.
[0057] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. A method for identifying and breeding heat-stress-resistant sheep breeds, characterized in that, include: 1) Extract total DNA from the sheep to be tested; 2) Using DNA as a template, PCR amplification was performed on SNP molecular markers related to heat stress resistance in sheep using primers shown in SEQ ID NO:2-3; the sequence of the molecular marker is shown in SEQ ID NO:1, wherein the polymorphism at position 209 of SEQ ID NO:1 is A / C; 3) Analyze the polymorphism of the SNP molecular markers in the PCR amplification products; sheep individuals with genotypes AA and AC at polymorphic sites have higher heat stress resistance than sheep individuals with genotype CC.
2. The method according to claim 1, characterized in that, The PCR reaction system consisted of: 12.5 μL of 2 × Phanta Max MasterMix, 50-100 ng of DNA template, 1 μL each of 10 μM upstream and downstream primers, and ddH2O to a final volume of 25 μL.
3. The method according to claim 2, characterized in that, The PCR reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 34 cycles; 72℃ final extension for 5 min.
4. The method according to claim 2 or 3, characterized in that, Step 3) includes: performing Sanger sequencing on the amplified products to obtain the genotypes of the sites with the polymorphisms. Sheep individuals with genotypes AA and AC have higher heat stress resistance than sheep individuals with genotype CC.
5. Any of the following applications of reagents for detecting SNP molecular markers associated with heat stress resistance in sheep: (1) Used for early prediction of heat stress in sheep; (2) Used for molecular marker-assisted breeding of sheep to improve their heat stress resistance; The sequence of the molecular marker is shown in SEQ ID NO:1, wherein the polymorphism at position 209 of SEQ ID NO:1 is A / C.
Citation Information
Patent Citations
Molecular marker for screening oxidative stress resistance of sheep and application of molecular marker
CN117051116A
Composition and method for promoting reduction of heat stress in animals
US20150374740A1