Indel marker linked with flowering cabbage branching gene Brbc1 and application of Indel marker

Abstract

The invention relates to the field of molecular biology, in particular to an Indel marker linked with a flowering cabbage branching gene Brbc1 and application of the Indel marker, two Indel markers A0729 and A0749 are located on the two sides of Brbc1 respectively, and two pairs of insertion-deletion polymorphism Indel markers linked with the Brbc1 gene are obtained through development and can be applied to molecular identification of the number of flowering cabbage breeding offspring branches and improvement of breeding efficiency. The Indel marker is developed by exploring markers closely linked with flowering cabbage branch related genes, the genetic effect of the Indel marker related to the flowering cabbage branch characters is obvious and stable, and the requirements of molecular breeding can be met.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and in particular to an Indel marker linked to a cabbage branching gene Brbc1 and an application thereof. Background Art

[0002] Chinese cabbage (Brassica campestris L.ssp. Chinensis var.utilis Tsen et Lee), also known as Chinese cabbage, is one of the largest Brassica vegetables in southern China with a long history of cultivation. It is a cruciferous vegetable of the Brassica family. It originated in China and is a specialty vegetable in the Huanghuai River Basin, especially in Shandong, Jiangsu, and Hubei (YuandPan, 2019), and is widely planted in Guangdong (Jia et al., 2019). Chinese cabbage is a vegetable with flower stalks as edible organs, and the flower stalks come from the branches of Chinese cabbage. The branching system of Chinese cabbage consists of the main branches developed from the apical meristem, the primary rosette branches developed from the axils of the primary rosette leaves, and the lateral branches developed from the axillary meristems of the stem leaves. Ordinary Chinese cabbage varieties only harvest the main branches, which are suitable for dense planting and mechanized harvesting; Lianzhou Chinese cabbage with many branches has multiple axillary buds on the rosette leaves, which further develop into multiple branches. It can be harvested multiple times after one planting, and the yield is high.

[0003] Chinese cabbage resources are relatively abundant, but the genetic background is narrow and the innovation efforts are insufficient, which is far from meeting the diverse breeding needs. The recognition and exploration of germplasm resources are the source of Chinese cabbage genetic breeding. Research on the genetic diversity of Chinese cabbage germplasm resources and population structure analysis are of great significance for the expansion of the genetic basis and effective utilization of Chinese cabbage. However, traditional breeding methods are time-consuming and slow in trait improvement, which makes it difficult to meet the needs of modern agriculture. With the development of biotechnology, molecular marker-assisted breeding has become an effective method to break through the bottleneck of traditional breeding. Discovering the regulatory genes related to Chinese cabbage branching and mastering the gene regulatory mechanism are of great significance for guiding the molecular breeding of Chinese cabbage.

[0004] Molecular marker development and genetic diversity analysis Among molecular markers, Indel markers are the most abundant genetic variation in plant genomes and have been widely used in genetic diversity analysis, genome-wide association mapping and marker-assisted selection breeding. The combination of molecular marker technology and quantitative genetics can decompose complex quantitative traits into individual quantitative trait loci (QTLs), and the associated markers can be used to assist breeding in the later stage. Indel molecular marker technology is a fragment that is inserted or deleted at the same site of the genome between different individuals of the same species. Because of its good stability and high polymorphism, it is widely used in the construction of fingerprint maps (Yang Jie et al., 2016). Indel is a PCR-based marker with the advantages of bi-allelic, co-dominant, high abundance and low cost. It has been widely used in crops. It has the characteristics of high diversity and is an important means of QTL mapping and molecular marker-assisted selection. Using the linkage relationship between Indel sites and certain functional genes or QTLs, functional genes or QTLs can be located on chromosomes.

[0005] At present, there are few genes that control the number of branches in Chinese cabbage, which cannot meet the needs of molecular breeding. If molecular markers related to the branching trait of Chinese cabbage can be developed, the markers can be used for molecular marker-assisted breeding of Chinese cabbage, which is of great significance for accelerating the innovation and creation of excellent Chinese cabbage germplasm resources and the selection and breeding of Chinese cabbage varieties. Summary of the invention

[0006] In view of the above technical problems, the present invention provides an Indel marker linked to the Chinese cabbage branching gene Brbc1 and its application, which are used to solve the above problems in the prior art.

[0007] One purpose of the present invention is to develop relevant Indel linkage markers to regulate the number of branches in Chinese cabbage, which can be applied to the molecular identification of branching traits in hybrid offspring breeding materials and other Chinese cabbage materials.

[0008] To solve the above technical problems, according to one aspect of the present invention, the present invention provides the following technical solutions:

[0009] The above-mentioned Chinese cabbage branching gene Brbc1 was precisely located in the 72.5kb physical interval of chromosome 7 of Chinese cabbage.

[0010] Indel markers linked to branching-related genes of flowering cabbage and their application, wherein the primers are respectively composed of an Indel molecular marker primer of A0729 and an Indel molecular marker primer of A0749:

[0011] The Indel molecular marker primer sequence of A0729 is:

[0012] A0729-F / A0729-R:AGCCTAGATTTGCAAGTAAGC / CACTGCCATAGAAGCAC ACAC.

[0013] The characteristic band of the Indel marker linked to the multi-branching trait amplified by the A0729 primer is 192 bp, and the nucleotide sequence is as Seq ID No.1, and the characteristic band of the Indel marker linked to the few-branching trait is 178 bp, and the nucleotide sequence is as Seq ID No.2.

[0014] The Indel molecular marker primer sequence of A0749 is:

[0015] A0749-F / A0749-R:CCTATGCTCAACAGGAGGAGGTCACCGTTACAGAGATGCT.

[0016] The characteristic band of the Indel marker linked to the multi-branching trait amplified by primer A0749 is 165 bp, and the nucleotide sequence is as Seq ID No.3. The characteristic band of the Indel marker linked to the few-branching trait is 150 bp, and the nucleotide sequence is as Seq ID No.4.

[0017] Another object of the present invention is to use the above-mentioned Indel marker primers linked to the branching-related gene of Chinese cabbage in Chinese cabbage breeding. The marker can be used to accurately screen the number of branches in the offspring. If you want to obtain a material with many branches, the electrophoresis detection will screen out the characteristic bands consistent with the many-branching trait. If you want to obtain a material with few branches, the electrophoresis detection will screen out the characteristic bands consistent with the few-branching trait, thereby improving the breeding efficiency and providing a new genetic marker for the molecular breeding of Chinese cabbage branching.

[0018] In order to achieve the above object, the present invention adopts the following technical measures:

[0019] The Indel marker linked to the Chinese cabbage branching gene Brbc1 and its application are obtained by the following method:

[0020] (1) The double haploid (DH) line 'CX010' from the common single-branched Chinese cabbage obtained by the free microspore culture method was used as the female parent and the DH line '008(6)' from the multi-branched Lianzhou Chinese cabbage was used as the male parent. F1 was prepared and then self-pollinated to obtain the F2 generation. 816 F2 generation Chinese cabbage plants were used as the positioning population to locate the branching gene. Phenotypic identification began from the seedling stage until sampling was carried out when the branching phenotype was most obvious. Specific method: The standard for investigating the number of branches is that the number of branches within 5 cm of the base of the stem is the base branch of the stem.

[0021] (2) 50 plants with multiple branching phenotypes (7-10 branches), few branching phenotypes (1-3 branches), and intermediate branching phenotypes (5 branches) were selected from the F2 mapping population, and DNA was extracted using the modified cetyltriethylammonium bromide (CTAB) method (Murray and Thompson, 1980). Leaf DNA of each individual plant was extracted and mixed in equal amounts to form three mixed pools for GradedPool-Seq (GPS). DNA concentration was detected using an ELISA reader.

[0022] (3) The extracted DNA of the mixed pool samples was sent to Hangzhou Lianchuan Biotechnology Co., Ltd. (Hangzhou, China) for GPS sequencing experiments. The final location was 23400156bp-23799822bp and 24411036bp-24999768bp on chromosome A07.

[0023] (4) Because the interval is too large and there are too many genes, it is not conducive to accurately predicting candidate genes. Select the Indel site with more obvious mutation from the sequencing results of the candidate interval, use the 150bp sequence upstream and downstream of the site to design primers, and use the parental DNA for screening to screen out markers that are polymorphic between the parents. 150 plants were randomly selected from the F2 population, and QTL genotyping technology was used together with the parents in combination with phenotypic data. Win QTL Cart 2.5 and JoinMap 4 software were used for analysis to further narrow the candidate interval to achieve fine positioning. Using this method, precise positioning of candidate genes has been successfully achieved in tomatoes and rice (Liu et al., 2019; Lei et al., 2020)

[0024] (5) Based on the above technical measures, the genetic localization of the Brbc1 gene on the chromosome was achieved, and the Indel markers A0729 and A0749 closely linked to Brbc1 were obtained, with the distance between the two being approximately 72.5 kb.

[0025] Technical effects and advantages of the present invention:

[0026] The invention is developed by exploring markers closely linked to genes related to Chinese cabbage branching. The Indel markers related to the Chinese cabbage branching trait of the invention have obvious and stable genetic effects and can meet the needs of molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 It is the morphological diagram of the two parents in this application;

[0028] Figure 2 It is the branch number statistical diagram of the two parents and the branch number distribution diagram of the F2 population plants provided in this application;

[0029] Figure 3 This is the preliminary map of the gene for identifying the number of branches in Chinese cabbage using the GradedPool-Seq method;

[0030] Figure 4 This is the main QTL location map of the Chinese cabbage branching gene in the embodiment of this application;

[0031] Figure 5 This is the characteristic sequence electrophoresis pattern of the Indel marker provided in this example in two varieties, the multi-branched material '008(6)' and the few-branched material 'CX010', and the F2 population material. DETAILED DESCRIPTION

[0032] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below with reference to the accompanying drawings.

[0033] The embodiments of the present invention are given for the purpose of illustration and description, and are not intended to be exhaustive or to limit the invention to the disclosed forms. Many modifications and variations will be apparent to those of ordinary skill in the art. The embodiments are selected and described in order to better illustrate the principles and practical applications of the present invention and to enable those of ordinary skill in the art to understand the present invention and thereby design various embodiments with various modifications suitable for specific uses.

[0034] Example 1

[0035] Construction of branch number segregating population and character investigation of Chinese flowering cabbage:

[0036] like Figure 1 The figure shows the morphological diagrams of the two parents in this application. Part A of the figure shows that the branching characteristic of '008(6)' is that 8 to 10 branches can be produced near the rosette leaves for harvest. Part B of the figure shows that the branching characteristic of 'CX010' is that 1 to 3 axillary buds are produced, but only one effective branch can be formed for harvest.

[0037] like Figure 2 As shown, the branch number statistics of the two parents and the branch number distribution diagram of the F2 population plants provided in this application are shown. Among them, the horizontal axis represents the branch frequency distribution, and the vertical axis represents the number of individual plants. The results show that the branch number is normally distributed, proving that the branch number is a quantitative trait.

[0038] In this example, the multi-branched Chinese cabbage DH line '008(6)' ( Figure 1 A) and the common Chinese flowering cabbage DH line 'CX010' as parents ( Figure 1 B), the number of branches between the two is significantly different ( Figure 2A), construct F2 segregation population by hybridization and selfing. The number of branches of each plant in the two parental materials and F2 generation segregation population was counted when the branching phenotype of Chinese cabbage was most obvious.

[0039] The specific method is: the standard for investigating the number of branches is that the number of branches within 5 cm of the base of the stem is the branches at the base of the stem.

[0040] The number of branches in the F2 population was separated and showed a normal distribution trend, indicating that the branching trait of Chinese cabbage is a quantitative trait ( Figure 2 B).

[0041] The steps for extracting total DNA from leaves of parents and F2 populations are as follows:

[0042] (1) Take fresh leaves and put them into a centrifuge tube. Add liquid nitrogen and grind them into powder. Then add 700uL CTAB solution preheated at 65°C to make full contact with the leaves. Put the centrifuge tube in an oven for 40 minutes and shake it every 10 minutes. Put the centrifuge tube in an oven for 40 minutes and shake it every 10 minutes.

[0043] (2) Take the centrifuge tube out of the oven, cool it for 10 minutes, add 200uL of chloroform:isoamyl alcohol (24:1), invert it for 3 minutes, and mix it thoroughly. Centrifuge it at room temperature for 10 minutes at 12000rpm. Transfer about 400 / 450uL of the supernatant to a sterile centrifuge tube.

[0044] (3) Add 2 times the volume of anhydrous ethanol (about 800uL) pre-cooled in a -30℃ refrigerator to the centrifuge tube, shake gently, and place the centrifuge tube in a -80℃ refrigerator for 8-10 minutes. Centrifuge at room temperature for 10 minutes at 12000rpm. Discard the supernatant, invert the centrifuge tube on filter paper, absorb it, add 200uL 70% ethanol, and centrifuge for 3 minutes at 3000rmp.

[0045] (4) Repeat step (3). Discard the supernatant, invert the centrifuge tube overnight, add 100uL of sterilized ultrapure water the next day, centrifuge for 2 minutes at 12000rpm. Detect the DNA concentration with an ELISA reader, dilute the DNA concentration to 50ng / uL, and store in a -30℃ refrigerator.

[0046] Example 2

[0047] The preliminary positioning of the QTL candidate interval for branching in Chinese cabbage includes:

[0048] (1) 50 plants were constructed in each of the multi-branch pool (7-10 branches), the few-branch pool (1-3 branches), and the intermediate pool (5 branches). GradedPool-Seq sequencing was performed on the three mixed pools and the two parents. The DNA samples were fragmented into fragments of 350 bp in length using a fragmentation kit and the library was constructed. The sequencing platform was NovaSeq 6000 (Illumina), and the sequencing mode was PE150.

[0049] (2) The raw data were quality controlled and the reads were aligned to the Chinese cabbage V3.0 reference genome ( http: / / brassicadb.org / brad / datasets / pub / Genomes / Brassica_rapa / V3.0 / ) using BWA.

[0050] (3) After the Ridit test analysis, the data was denoised, and the proportion of sites with significant p-values ​​to the total sites in the sliding window area was counted to determine the area significantly associated with the trait. Finally, the intervals of 23.4.0-23.8Mb and 24.4Mb-25.0Mb of chromosome A07 were located as candidate QTL intervals, and the gene regulating branching was located on chromosome A07 ( Figure 3 ).

[0051] like Figure 3 The figure shows the initial location map of the gene for the number of branches in Chinese cabbage identified using the GradedPool-Seq method. The horizontal axis is the chromosome position coordinate, with a unit of 100kb, and the vertical axis is the ratio of the number of points with a p value lower than the threshold in the window to the total number of points in the window. The higher the position of the point, the stronger the correlation with the trait. The intervals of 23.4Mb-23.8Mb and 24.4Mb-25Mb of chromosome A07 were finally located as candidate QTL intervals, and the gene regulating the number of branches was located on chromosome A07.

[0052] According to the Indel information, Indel sites without other mutations within 150 bp before and after were evenly selected in the candidate interval, and then primers were designed using Primer 5 software.

[0053] (1) Indel marker of A0729:

[0054] (AGCCTAGATTTGCAAGTAAGC / CACTGCCATAGAAGCACACAC).

[0055] (2) Indel marker of A0749:

[0056] (CCTATGCTCAACAGGAGGAG / GTCACCGTTACAGAGATGCT).

[0057] Example 3

[0058] Genetic map construction and QTL positioning:

[0059] PCR reaction system (10.0 μL): ddH2O 6 μL, DNA 1 μL, Buffer 1 μL, dNTP 0.8 μL, Taq 0.2 μL, upstream and downstream primers 0.5 μL each.

[0060] PCR reaction program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 55-60°C for 30 s, extension at 72°C for 1 min (35 cycles); post-extension at 72°C for 5 min.

[0061] The PCR products were separated by 6% non-denaturing polyacrylamide gel electrophoresis at 220V constant power, and finally silver-stained. After color development, the gel was placed under a film viewing lamp to read and record the band pattern.

[0062] The genotype of each F2 plant was analyzed based on the results, with the same genotype as the maternal genotype recorded as "0", the same genotype as the paternal genotype recorded as "2", and the heterozygous genotype recorded as "1". Win QTL Cart 2.5 and JoinMap4 were then used to analyze the genotyping and phenotypic data.

[0063] Based on the genetic map, genotype data of the F2 population and branching phenotype data, Win QTL Cart2.5 software was used to detect QTLs, and two Indel markers closely linked to the branching trait of Chinese cabbage were detected ( Figure 4 ).

[0064] like Figure 5 The figure shows the characteristic sequence electrophoresis patterns of the Indel markers provided in this embodiment in the two varieties of the multi-branched material '008(6)' and the few-branched material 'CX010' and the F2 population material. If a multi-branched plant appears in the F2 population, it will have the same band as the multi-branched material '008(6)'. If a few-branched plant appears in the F2 population, it will have the same band as the few-branched material 'CX010'. If a heterozygous plant appears in the F2 population, it will have the bands of the multi-branched material '008(6)' and the few-branched material 'CX010'.

[0065] Example 4

[0066] The invention provides an Indel marker linked to a branching gene Brbc1 of Chinese cabbage and its application, comprising: the characteristic band of the Indel marker linked to the multi-branching trait amplified by the A0729 primer is 192bp, the nucleotide sequence is as Seq ID No.1, and the characteristic band of the Indel marker linked to the few-branching trait is 178bp, the nucleotide sequence is as Seq ID No.2; three electrophoresis results may appear: only the 192bp band appears, indicating that the corresponding Chinese cabbage is a homozygous material with the multi-branching trait; only the 178bp band appears, indicating that the corresponding Chinese cabbage is a homozygous material with the few-branching trait; the material with both the 192bp and 178bp bands is a dominant heterozygous material, which does not belong to the target selection material. The Indel molecular marker primer sequence of A0749 is A0749-F / A0749-R: CCTATGCTCAACAGGAGGAGGTCACCGTTACAGAGATG CT. The characteristic band of the Indel marker linked to the multi-branching trait amplified by primer A0749 is 165bp, and the nucleotide sequence is as Seq ID No. 3. The characteristic band of the Indel marker linked to the few-branching trait is 150bp, and the nucleotide sequence is as Seq ID No. 4. There may be three electrophoresis results: only the 165bp band appears, indicating that the corresponding Chinese cabbage is a homozygous material with the multi-branching trait; only the 150bp band appears, indicating that the corresponding Chinese cabbage is a homozygous material with the few-branching trait; and the 165bp and 150bp bands appear at the same time, indicating that the dominant heterozygous material.

[0067] The nucleotide sequence is as follows:

[0068] Seq ID No.1

[0069] AGCCTAGATTTGCAAGTAAGCATATGTGTAGTAGTTAGAAAAAAAAGCTACTTTAAGCATACATAAGATAGTATGTTTGAGATTAATAAGAAAAGAATTGAGAAAATGTAGACATACAAAGATAATCTCTTCTCTCCTATAAGAACAAACACAAACGTGAGAGAGGAGTTGTGTGTGCTTCTATGGCAGTG

[0070] Seq ID No.2

[0071] AGCCTAGATTTGCAAGTAAGCATATGTGTAGTAGTTAGAAAAAAAAGCTACTTTAAGCATACATAAGATAGTATGTTTGAGATTAATAAGAAAAGAATTGAGAAAATGTAGACATACAAAGATAATCTCTTCTCTCCTAAACGTGAGAGAGGAGTTGTGTGTGCTTCTATGGCAGTG

[0072] Seq ID No.3

[0073] CCTATGCTCAACAGGAGGAGGCTCGTCTTCCTCTGGGATCACAAAGCTCTCTTGGATCGGCCACGGAGTTGATGTGCTAAACGCAGCAGAAGACTGCTTTGTTTGGTACTGCTCAAAGCTTGTTGCTGTCTGCTGCTTCTTTCTGAGCATCTCTGTAACGGTGAC

[0074] Seq ID No.4

[0075] CCTATGCTCAACAGGAGGAGGCTCGTCTTCCTCTGGGATCACAAAGCTCTCTTGGATCGGCCACGGAGTTGATGTGGACTGCTTTGTTTGGTACTGCTCAAAGCTTGTTGCTGTCTGCTGCTTCTTTCTGAGCATCTCTGTAACGGTGAC

[0076] The invention discloses an Indel marker related to the branching trait of flowering cabbage, and uses it to precisely locate the Indel marker closely linked to the branching trait of flowering cabbage, and designs a primer pair for screening the branching trait through the marker. The primer can be used to accurately screen the number of branches, thereby improving breeding efficiency.

[0077] Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field and related fields without creative work should fall within the scope of protection of the present invention. The structures, devices and operating methods not specifically described and explained in the present invention are implemented according to the conventional means in the field unless otherwise specified and limited.

Claims

1. An Indel marker linked to the Chinese cabbage branching gene Brbc1, characterized in that: It includes two Indel markers, which are A0729 and A0749, respectively, and are composed of A0729-F / A0729-R and A0749-F / A0749-R, respectively. The nucleotide sequences of the primers of the markers are as follows: The Indel molecular marker primer sequence of A0729 is: A0729-F / A0729-R:AGCCTAGATTTGCAAGTAAGC / CACTGCCATAGAAG CACACAC; The Indel molecular marker primer sequence of A0749 is: A0749-F / A0749-R:CCTATGCTCAACAGGAGGAG / GTCACCGTTACAGAG ATGCT.

2. The Indel marker linked to the Chinese cabbage branching gene Brbc1 according to claim 1, characterized in that: The characteristic band of the Indel marker linked to the multi-branching trait amplified by the A0729 primer is 192 bp, and the nucleotide sequence is as Seq ID No.1, and the characteristic band of the Indel marker linked to the few-branching trait is 178 bp, and the nucleotide sequence is as Seq ID No.

2.

3. The Indel marker linked to the Chinese cabbage branching gene Brbc1 according to claim 2, characterized in that: The characteristic band of the Indel marker linked to the multi-branching trait amplified by the A0749 primer is 165 bp, and the nucleotide sequence is as Seq ID No.

3. The characteristic band of the Indel marker linked to the few-branching trait amplified by the A0749 primer is 150 bp, and the nucleotide sequence is as Seq ID No.

4.

4. The Indel marker linked to the Chinese cabbage branching gene Brbc1 according to claim 3, characterized in that: The A0729 primer amplification includes the following electrophoresis results: If only the 192bp band appears, it means that the corresponding Chinese cabbage is a homozygous material with many branches; if only the 178bp band appears, it means that the corresponding Chinese cabbage is a homozygous material with few branches; if both the 192bp and 178bp bands appear, it is a dominant heterozygous material.

5. The Indel marker linked to the Chinese cabbage branching gene Brbc1 according to claim 4, characterized in that: The A0749 primer amplification includes the following electrophoresis results: If only the 165bp band appears, it means that the corresponding Chinese cabbage is a homozygous material with a multi-branching trait; if only the 150bp band appears, it means that the corresponding Chinese cabbage is a homozygous material with a few branching traits; if both the 165bp and 150bp bands appear, it is a dominant heterozygous material.

6. Use of the Indel marker according to any one of claims 1 to 5 in the identification of the branching gene Brbc1 in hybrid offspring breeding materials and other Chinese flowering cabbage materials.

Images