Molecular marker for screening of paddy varieties in paddy field with gley soil and application thereof

Abstract

The application discloses a molecular marker for screening paddy varieties in gley soil paddy fields and application thereof, and provides application of a primer group for detecting a molecular marker in identifying a hypocotyl length in rice, wherein a genotype of a Kasp-9-10.0 site of the to-be-detected rice is TT homozygous type or CC homozygous type. The genotype of the Kasp-9-10.0 site can be detected to effectively evaluate the length of the hypocotyl of the rice. The genotype of the Kasp-9-10.0 site of the to-be-detected rice can be detected to identify the length of the hypocotyl of the rice, and the method has important application value in the process of molecular marker assisted breeding of the rice.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a molecular marker for screening rice varieties in latently incubated paddy fields and an application thereof. Background Art

[0002] Currently, the main methods of rice cultivation include transplanting and direct seeding. The transplanting method, which involves raising seedlings and transplanting rice, is inefficient and consumes large amounts of agricultural water. With the development of society, the rural labor force is losing significant amounts, the aging population is accelerating, and arable land and water resources are becoming increasingly scarce. Consequently, direct seeding of rice, a highly mechanized, resource-efficient, lightweight, and efficient method, has emerged. Direct seeding involves directly sowing rice seeds into the field, eliminating the need for raising seedlings and transplanting. It is more efficient and cost-effective than traditional rice cultivation methods, effectively addressing the high cost of rice cultivation and labor shortages in my country.

[0003] The success rate of direct-seeding rice seedlings is crucial. Submerged rice paddies are the most common low-yield fields in southern my country, accounting for approximately one-third of the southern rice paddy area. Submerged rice paddies present multiple obstacles, including long-term stagnant water and oxygen deficiency, cold water and low mud temperature, high levels of harmful reducing substances, slow nutrient conversion, and significant nutrient deficiencies, all of which are extremely detrimental to the success of direct-seeding rice seedlings.

[0004] The rice mesocotyl plays a crucial role in seedling emergence. A population of seedlings with long mesocotyls promotes rice seedling emergence and is closely linked to rice seedling growth and subsequent yield. Developing molecular markers for screening and creating new rice germplasm with long mesocotyls, and creating long mesocotyl rice germplasm, could effectively promote the development of direct-seeding rice technology and facilitate the efficient utilization of latent-cultivated rice fields.

[0005] Currently, SNPs are the most widely distributed and efficiently utilized genetic variation in the rice genome. SNP markers have been gradually applied to high-density genetic map construction, QTL mapping, germplasm genotyping, and genotype aggregation, effectively accelerating the molecular breeding process. The development of molecular markers tightly linked to the mesocotyl elongation QTL can be used to screen long mesocotyl varieties and purposefully increase the mesocotyl length of varieties through molecular marker-assisted selection (MAS). Among them, KASP (Kompetitive Allele-Specific PCR) markers can accurately identify the alleles of SNPs and can be effectively used to screen long mesocotyl varieties and create new germplasm. Summary of the Invention

[0006] In order to overcome the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a molecular marker for screening rice varieties in latent rice fields and its application.

[0007] The technical solution adopted by the present invention to solve the technical problem is as follows: the present invention includes a molecular marker for screening rice varieties in latent paddy fields, the molecular marker being a primer set for amplifying a target sequence including the Kasp-9-10.0 site on rice chromosome 9; the primer set consisting of an upstream primer F1, an upstream primer F2, and a downstream primer R; the upstream primer F1 consisting of a fluorescent label sequence A and a DNA fragment represented by positions 22 to 40 from the 5' end of SEQ ID NO:2; the upstream primer F2 consisting of a fluorescent label sequence B and a DNA fragment represented by positions 22 to 40 from the 5' end of SEQ ID NO:3; and the nucleotide sequence of the downstream primer R is shown in SEQ ID NO:4.

[0008] In the above primer set, the nucleotide sequence of the fluorescent tag sequence A is shown in SEQ ID NO: 2 from position 1 to position 21 from the 5' end;

[0009] The nucleotide sequence of the fluorescent tag sequence B is shown in SEQ ID NO: 3 from position 1 to position 21 from the 5' end.

[0010] In the molecular marker, the nucleotide sequence of the fluorescent tag sequence A is shown in SEQ ID NO: 2 from position 1 to position 21 from the 5' end;

[0011] The nucleotide sequence of the fluorescent tag sequence B is shown in SEQ ID NO: 3 from position 1 to position 21 from the 5' end.

[0012] The present invention provides a primer set for identifying or assisting in identifying rice mesocotyl characteristics, which consists of an upstream primer F1, an upstream primer F2 and a downstream primer R;

[0013] The upstream primer F1 is a single-stranded DNA molecule represented by the following: GAAGATGACCAAATTCATGCTGGACCTCATATTCATGTTGTTTGGT;

[0014] The upstream primer F2 is a single-stranded DNA molecule represented by GAAGATCGGAATCAACGGATTGACCTCATATTCATGTTGTTTGGC;

[0015] The downstream primer R is a single-stranded DNA molecule represented by TCGGATGTTACGTGTGTATGCAACC.

[0016] The present invention also includes the use of the primer set as described above, which is any one of the following b1)-b3):

[0017] b1) determining the mesocotyl length of the rice to be tested;

[0018] b2) screening rice varieties with long mesocotyls;

[0019] b3) Rice breeding.

[0020] The present invention also includes the use of the DNA fragment shown in SEQ ID NO: 1, which is any one of the following b1) to b4):

[0021] b1) determining the mesocotyl length of the rice to be tested;

[0022] b2) screening rice varieties with long mesocotyls;

[0023] b3) Rice breeding;

[0024] b4) as a molecular marker for identifying the mesocotyl length of the rice to be tested.

[0025] The present invention also includes a method for identifying the mesocotyl of a test rice plant, comprising detecting the test rice plant using the above-mentioned molecular marker for screening rice varieties in latently incubated paddy fields, comprising the following steps: detecting whether the genotype of the test rice plant based on the Kasp-9-10.0 locus is CC homozygous or TT homozygous, and then performing the following judgment:

[0026] If the genotype of the rice to be tested is TT homozygous based on the Kasp-9-10.0 locus, the rice to be tested has a long mesocotyl;

[0027] If the genotype of the rice to be tested based on the Kasp-9-10.0 locus is CC homozygous, the mesocotyl of the rice to be tested is short;

[0028] The Kasp-9-10.0 locus is the 37th nucleotide from the 5' end of SEQ ID NO: 1 in the rice genome.

[0029] In the above method, the steps of detecting whether the genotype of the rice to be tested is TT homozygous or CC homozygous based on the Kasp-9-10.0 locus are as follows:

[0030] (a1) using genomic DNA of the rice to be tested as a template and performing PCR amplification using the primer set of claim 1 to obtain a PCR amplification product;

[0031] (a2) After completing step (a1), the fluorescent signal of the PCR amplification product is detected, and the genotype of the rice to be tested based on the Kasp-9-10.0 locus is obtained according to the color of the fluorescent signal.

[0032] In the above method, the steps of detecting whether the genotype of the rice to be tested is TT homozygous or CC homozygous based on the Kasp-9-10.0 locus are as follows:

[0033] (b1) using the genomic DNA of the rice to be tested as a template and performing PCR amplification using the primer set of claim 1 to obtain a PCR amplification product;

[0034] (b2) taking the PCR amplification product obtained in step (b1) and sequencing it;

[0035] (b3) Obtaining the genotype of the rice to be tested based on the Kasp-9-10.0 locus according to the sequencing results obtained in step (b2).

[0036] The present invention also includes a kit comprising a substance for detecting the genotype of the rice to be tested based on the Kasp-9-10.0 locus;

[0037] The Kasp-9-10.0 locus is the 37th nucleotide from the 5' end of SEQ ID NO: 1 in the rice genome.

[0038] In the above-mentioned kit, the substance for detecting the genotype of the rice to be tested based on the Kasp-9-10.0 locus is any one of the above-mentioned primer sets.

[0039] The present invention also protects the use of any of the above-mentioned kits, which is any of the following b1) to b3):

[0040] b1) determining the mesocotyl length of the rice to be tested;

[0041] b2) screening rice varieties with long mesocotyls;

[0042] b3) Rice breeding.

[0043] Compared with the prior art, the present invention has the following beneficial effects:

[0044] The method provided by the present invention is used to detect whether the genotype of the rice plant under test at the Kasp-9-10.0 locus is TT homozygous or CC homozygous. By detecting the genotype at the Kasp-9-10.0 locus, the length of the rice mesocotyl can be effectively assessed. The specific criteria are as follows: if the genotype of the rice plant under test at the Kasp-9-10.0 locus is TT homozygous, the rice plant is likely to have a longer mesocotyl; if the genotype of the rice plant under test at the Kasp-9-10.0 locus is CC homozygous, the rice plant is likely to have a shorter mesocotyl. By detecting the genotype of the rice plant under test at the Kasp-9-10.0 locus, the rice plant's mesocotyl length can be identified, which has important application value in rice molecular marker-assisted breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1The figure shows the genotyping results of Kasp-9-10.0 on the IR 145 / KALASU F2:3 population in the example; red represents the KALASU genotype (TT), blue represents the IR 145 genotype (CC), pink represents detection failure, and green represents heterozygous (CT).

[0046] Figure 2 The genotyping results of Kasp-9-10.0 for 236 Indica rice varieties in the example are shown; red represents the KALASU genotype (TT), blue represents the IR 145 genotype (CC), pink represents detection failure, and green represents heterozygous (CT). DETAILED DESCRIPTION

[0047] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0048] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0049] 'IR 145' is an important indica rice material, whose hypocotyl is short, only 0.18 cm, while Kalasu has a longer hypocotyl, 4.20 cm.

[0050] IR145 See: Liu, J., Zhan, J., Chen, J., Lu, X., Zhi, S., & Ye, G. (2021). Validation of genes affecting rice grain zinc content through candidate gene-based association analysis. Frontiers in Genetics, 12, 701658.

[0051] KALASU See: Wang, Y., Liu, J., Meng, Y., Liu, H., Liu, C., & Ye, G. (2021). Rapid identification of QTL for mesocotyl length in rice through combining QTL-seq and genome-wide association analysis. Frontiers in Genetics, 12, 713446.

[0052] Example 1. Development and polymorphism detection of the rice mesocotyl length molecular marker Kasp-9-10.0

[0053] Ⅰ Development of molecular marker Kasp-9-10.0

[0054] After extensive experiments and through precise mapping, the inventors of the present invention designed and synthesized a primer set suitable for identifying rice mesocotyl length using allele-competitive PCR on rice chromosome 9 (10,024,501 bp). This primer set consists of three primer sequences: upstream primer F1 (FAM), upstream primer F2 (HEX), and downstream primer R, and is used to amplify the target sequence encompassing the Kasp-9-10.0 locus. The nucleotide sequences of each primer are shown in Table 1.

[0055] Table 1 Nucleotide sequences of various primers

[0056]

[0057] The Kasp-9-10.0 locus is the 37th nucleotide from the 5' end of SEQ ID NO: 1 in the rice genome, and the genotypes are TT homozygous, AA homozygous, and AT heterozygous. SEQ ID NO: 1: TTTTTATATTATGGACCTCATATTCATGTTGTTTGG[C / T]ACTTAAGCATATAATTAT TACGATGGATCGTTTATT.

[0058] Because genomic DNA is composed of two reverse-complementary single-stranded DNA molecules forming a double-stranded DNA molecule, protein-encoding DNA molecules are generally designated as sense DNA molecules, while the reverse-complementary DNA molecules of sense DNA molecules are designated as antisense DNA molecules. The genotypes at the Kasp-9-10.0 locus are all sense DNA genotypes.

[0059] Ⅱ Polymorphism detection

[0060] 1. Phenotypic identification of mesocotyls of IR 145 / KALASU in the field

[0061] In June 2018, 'IR145' was hybridized with KALASU. After harvesting the F1 seeds, they were propagated in December 2018 at a pilot base in Lingshui County, Hainan Province, and F2 seeds were obtained from individual plants in April 2019. Approximately 400 plump rice grains were selected from the F2 seeds and sown in a 10×5-hole tray filled with a uniformly proportioned nutrient soil at a depth of 6 cm. The soil was covered to a level surface. Next, 500 g of nutrient soil was placed in a tray and compacted. The tray was then placed inside the tray and sprayed with tap water. The entire setup was placed in a constant temperature, dark incubator at 30°C. Watering was continued daily at a fixed time until seedlings emerged, and germination was recorded. After approximately 10 days of constant temperature incubation, the trays were removed from the artificial climate chamber, and the soil around the seedlings' roots was quickly rinsed with running water. Individual plants with extreme growth conditions were removed. The lines with uniform growth were photographed, and the length of their hypocotyls was measured using Image J software.

[0062] 2. Molecular identification of 232 rice F2:3 populations

[0063] (1) The CTAB method was used to extract genomic DNA from young leaves of 232 rice germplasm resources to meet the requirements of PCR. The specific standards were as follows: agarose electrophoresis should show a single DNA band; the A260 / A280 ratio should be between 1.8 and 2.0 and the A260 / A230 ratio should also be between 1.8 and 2.0 as detected by the UV spectrophotometer Nanodrop 2100 (Thermo), and there should be no significant light absorption at 270 nm; the DNA concentration should be between 50 and 200 ng / μL.

[0064] (2) Perform competitive allele-specific PCR. Using the extracted rice genomic DNA as a template, PCR amplification was performed using the primer set synthesized in step 3 to generate PCR products. The PCR reaction procedure was as follows: pre-denaturation at 94°C for 15 minutes; then denaturation at 94°C for 20 seconds, 61°C to 55°C (using a touch-down program, the temperature decreased by 0.6°C per cycle), 1 minute, for a total of 10 cycles; then denaturation at 94°C for 20 seconds, 55°C for 1 minute, and amplification continued for 26 cycles.

[0065] (3) After step (2) is completed, when the temperature of the PCR amplification product drops below 40°C, the fluorescence value is read by scanning the FAM and HEX beams of the microplate reader (the FAM fluorescent label is read at an excitation light of 485nm and an emission light of 520nm, and the HEX fluorescent label is read at an excitation light of 528nm and an emission light of 560nm). The genotype of the rice to be tested based on the Kasp-9-10.0 locus is determined according to the color of the fluorescent signal. The specific judgment rules are as follows: If the sample to be tested shows a blue fluorescent signal based on the Kasp-9-10.0 locus, the Kasp-9-10.0 locus of the rice is TT homozygous, which is consistent with KALASU; if a red fluorescent signal is shown, it is CC homozygous, which is consistent with IR145; if a green fluorescent signal is shown, it is TC heterozygous. The test results are as follows. Figure 1 3. Significance Analysis

[0066] The mesocotyl lengths of the two rice genotypes were statistically analyzed, and the results are listed in Table 2. t-test analysis was also performed using the PROC TTEST model in the internationally recognized SAS 9.2 statistical software. The statistical results are shown in Table 3. The data showed that the average mesocotyl length of the rice varieties homozygous for CC was 1.40 cm, a 21.3% decrease compared to the average mesocotyl length of the rice varieties homozygous for TT (1.78 cm). The difference was significant at the 0.05 significance level (see Table 3). This finding suggests that testing the genotype at the Kasp-9-10.0 locus can effectively assess rice mesocotyl length. The specific criteria are as follows: If the rice variety being tested is homozygous for the Kasp-9-10.0 locus genotype, it is likely to have a longer mesocotyl; if the rice variety is homozygous for the Kasp-9-10.0 locus genotype, it is likely to have a shorter mesocotyl.

[0067] Table 2 KASP-9-10.0 detection results and mesocotyls in IR 145 / KALASU F2:3 population

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077] KALASU genotype (TT, blue), IR 145 genotype (CC, red), heterozygous (CT) in green

[0078] Table 3 Mesocotyl association analysis of Kasp-1-38383221 in IR 145 / KALASU population

[0079]

[0080] Example 2 Association analysis and verification of primer sets with embryonic axis length in natural rice varieties

[0081] 1. Detection of genotypes of 236 rice varieties at the KASP-9-10.0 locus

[0082] According to the steps in Example 1, the rice to be tested was replaced with 236 different varieties, and the other steps remained unchanged. After the operation, the genotype detection results of these 236 rice varieties at the KASP-9-10.0 locus were obtained, as shown in Figure 2 .

[0083] 2. Measure the length of the mesocotyl

[0084] The rice accessions were 236 accessions of the Indica subgroup from Southeast and South Asia. Fifteen intact, crack-free rice kernels were selected from each accession and sown in a 10×5-well tray filled with a quantitatively formulated nutrient soil. Fifteen kernels were placed in each hole at a depth of 6 cm, ensuring no overlap between kernels. The soil was then covered flush with the surface of the hole. Subsequently, 500 g of nutrient soil was weighed and compacted in a tray. The tray was then placed inside the tray and sprayed with tap water. The entire setup was incubated in a dark, constant-temperature incubator at 30°C. Watering was performed daily at a fixed time until seedlings emerged, and germination was recorded. After approximately 10 days of constant-temperature incubation, the trays were removed from the artificial climate chamber, and the soil around the roots of the seedlings was quickly rinsed with running water. Plants with significantly different growth conditions were removed. Uniformly growing plants were photographed, and their hypocotyl lengths were measured using Image J software.

[0085] The sources of materials are recorded as follows: Wang W, Mauleon R, Hu Z, Chebotarov D, Tai S, Wu Z, Li M, Zheng T, Fuentes RR, Zhang F, Mansueto L, Copetti D, Sanciangco M, Palis KC, Xu J, Sun C, Fu B, Zhang H, Gao Y, Zhao X, Shen F, Cui X, Yu H, Li Z, Chen M, Detras J,ZhouY,Zhang X,Zhao Y,Kudrna S,Wang C,Li R,Jia B,Lu J,He Z,Naredo MEB,Talag J,Wang X,Li J, Fang

[0086] 3. Correlation Analysis

[0087] The average mesocotyl lengths of the two rice genotypes were statistically analyzed (Table 4), and a t-test was performed using the PROC TTEST model using the internationally recognized SAS 9.2 statistical software. The statistical results are shown in Table 5. The results showed that the average mesocotyl length of the rice cultivar homozygous for CC (mesocotyl 1.01 cm) was 26.3% lower than that of the rice cultivar homozygous for TT (mesocotyl 1.37 cm), a significant difference at the 0.05 level (Table 5).

[0088] Table 4 Genotype detection results of 236 rice varieties

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097] KALASU genotype (TT, blue), IR 145 genotype (CC, red), green heterozygous (CT)

[0098] Table 5 Kasp-1-38383221 association analysis of the mesocotyl length in the IR 145 / KALASU population

[0099]

[0100] The above results show that the genotype of Kasp-9-10.0 locus in the rice to be detected can be used to identify the mesocotyl length in the rice, which has important application value in the process of molecular marker assisted breeding of rice.

[0101] The present application has been described in detail. For those skilled in the art, without departing from the spirit and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wider range under the same parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that the present application can be further improved. In summary, according to the principle of the present application, the present application intends to include any change, use or improvement of the present application, including the change made by the conventional technology known in the art, which is out of the range disclosed in the present application. Some basic features can be applied according to the scope of the following attached claims.

Claims

1. A method for screening rice varieties for latent incubation in paddy fields, the molecular marker comprising a primer set for amplifying a target sequence on rice chromosome 9, including the Kasp-9-10.0 locus; the primer set comprising an upstream primer F1, an upstream primer F2, and a downstream primer R; the upstream primer F1 comprising a fluorescent tag sequence A and a DNA fragment represented by positions 22 to 40 from the 5' end of SEQ ID NO: 2; the upstream primer F1 being a single-stranded DNA molecule represented by the sequence GAAGATGACCAAATTCATGCTGGACCTCATATTCATGTTGTTTGGT; The upstream primer F2 is composed of a fluorescent tag sequence B and a DNA fragment represented by positions 22 to 40 from the 5' end of SEQ ID NO: 3; the upstream primer F2 is a single-stranded DNA molecule represented by GAAGATCGGAATCAACGGATTGACCTCATATTCATGTTGTTTGGC; The nucleotide sequence of the downstream primer R is shown in SEQ ID NO: 4; the downstream primer R is as follows: a single-stranded DNA molecule represented by TCGGATGTTACGTGTGTATGCAACC; The application is any one of the following b1)-b2): b1) Determine the mesocotyl length of the rice to be tested; b2) Screening of rice varieties with long mesocotyls.

2. A method for identifying the mesocotyl of a rice plant to be tested, comprising detecting the rice plant to be tested using the molecular marker for screening rice varieties in latently incubated paddy fields as claimed in claim 1, characterized in that: The method comprises the following steps: detecting whether the genotype of the rice to be tested is CC homozygous or TT homozygous based on the Kasp-9-10.0 locus, and then making the following judgment: If the genotype of the rice to be tested is TT homozygous based on the Kasp-9-10.0 locus, the rice to be tested has a long mesocotyl; If the genotype of the rice to be tested based on the Kasp-9-10.0 locus is CC homozygous, the mesocotyl of the rice to be tested is short; The Kasp-9-10.0 locus is the 37th nucleotide from the 5' end of SEQ ID NO: 1 in the rice genome.

3. The method for identifying the mesocotyl of a rice plant to be tested according to claim 2, wherein: The steps of detecting whether the genotype of the rice to be tested is TT homozygous or CC homozygous based on the Kasp-9-10.0 locus are as follows: (a1) using genomic DNA of the rice to be tested as a template and performing PCR amplification using the primer set of claim 1 to obtain a PCR amplification product; (a2) After completing step (a1), the fluorescent signal of the PCR amplification product is detected, and the genotype of the rice to be tested based on the Kasp-9-10.0 locus is obtained according to the color of the fluorescent signal.

4. The method for identifying the mesocotyl of a rice plant to be tested according to claim 2, wherein: The steps of detecting whether the genotype of the rice to be tested is TT homozygous or CC homozygous based on the Kasp-9-10.0 locus are as follows: (b1) using the genomic DNA of the rice to be tested as a template and performing PCR amplification using the primer set of claim 1 to obtain a PCR amplification product; (b2) taking the PCR amplification product obtained in step (b1) and sequencing it; (b3) Obtaining the genotype of the rice to be tested based on the Kasp-9-10.0 locus according to the sequencing results obtained in step (b2).

5. A use of a kit, comprising a substance for detecting the genotype of a rice plant to be tested based on the Kasp-9-10.0 locus; the Kasp-9-10.0 locus being the 37th nucleotide from the 5' end of SEQ ID NO: 1 in the rice genome; the substance for detecting the genotype of a rice plant to be tested based on the Kasp-9-10.0 locus being the primer set of claim 1; the use being any of the following b1) to b2): b1) Determine the mesocotyl length of the rice to be tested; b2) Screening of rice varieties with long mesocotyls.

Images