Compositions and methods for circular RNA affinity purification

Abstract

The present disclosure provides circular RNA (circRNA) compositions and methods for purification and uses thereof. In particular, the disclosure relates to compositions and methods of making and using circRNA comprising one or more aptamers that specifically bind to an affinity ligand.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is related to EP priority application number 22305884.3 filed on June 17, 2022 and EP priority application number 22306497.3 filed on October 6, 2022, and the contents of each are incorporated herein by reference. Background Art

[0002] Exogenous circularized RNA (circRNA) containing protein coding regions is becoming a valuable molecular tool and alternative to messenger RNA (mRNA) therapeutic agents. CircRNA is single-stranded and characterized by a covalently closed structure. Compared with linear RNA, circRNA has enhanced stability, significantly longer half-life, and can resist degradation by nucleases. The uses of exogenous circRNA include (1) overexpression of natural circRNA, (2) engineering circRNA produced in vitro to replace existing linear mRNA delivery, and / or (3) as part of the production and purification methods of linear and / or circular RNA as described herein.

[0003] Methods for effectively purifying exogenous circRNAs are still major obstacles that must be overcome before fully exerting the protein coding potential of circRNAs. Part of the reason is that there are different types and combinations of undesirable contaminants in the sample, which need to be separated from the pure sample of circRNA. Such contaminants are typically components and by-products of any upstream process (such as RNA manufacturing and cyclization conditions). Samples typically contain the desired circRNA and various contaminants, such as linear precursor RNA, nicked circular RNA, double-stranded RNA, triphosphate RNA, free nucleotides, endotoxins and solvents.

[0004] There remains a need for more efficient, reliable, and safer methods to purify circRNAs from large-scale manufacturing processes for potential therapeutic applications that are also economical in terms of the number of steps, step complexity, and resources used in the steps. Summary of the invention

[0005] In one aspect, the present disclosure provides a circular RNA comprising a protein coding region and at least one RNA aptamer.

[0006] In certain embodiments, an internal ribosome entry site (IRES) is located at the 5' end of the protein coding region.

[0007] In certain embodiments, the IRES is located at the 3' end of the protein coding region.

[0008] In certain embodiments, the IRES is derived from Coxsackievirus B3 (CVB3), encephalomyocarditis virus (EMCV), dicistroviruses, hepatitis C virus (HCV), poliovirus (PV), enterovirus 71 (EV71), human rhinovirus (HRV), foot-and-mouth disease virus (FMDV), or a synthetic IRES.

[0009] In certain embodiments, the IRES comprises the polynucleotide sequence of SEQ ID NO:75.

[0010] In certain embodiments, the protein coding region encodes at least one polypeptide or peptide.

[0011] In certain embodiments, the polypeptide is a biologically active polypeptide, a therapeutic polypeptide, or an antigenic polypeptide.

[0012] In certain embodiments, the circular RNA comprises at least one 5' internal homology arm and at least one 3' internal homology arm.

[0013] In certain embodiments, the 5' internal homology arm is about 5 to about 50 nucleotides in length.

[0014] In certain embodiments, the 5' internal homology arm comprises the nucleotide sequence of SEQ ID NO:70.

[0015] In certain embodiments, the 3' internal homology arm is about 5 to about 50 nucleotides in length.

[0016] In certain embodiments, the 3' internal homology arm comprises the nucleotide sequence of SEQ ID NO:71.

[0017] In certain embodiments, the circular RNA comprises at least one 3' exonic element.

[0018] In certain embodiments, the 3' exonic element comprises the nucleotide sequence of SEQ ID NO:81.

[0019] In certain embodiments, the circular RNA comprises at least one 5' exonic element.

[0020] In certain embodiments, the 5' exonic element comprises the nucleotide sequence of SEQ ID NO:83.

[0021] In certain embodiments, the circular RNA comprises at least one spacer sequence.

[0022] In certain embodiments, the spacer sequence is about 5 to about 75 nucleotides in length.

[0023] In certain embodiments, the spacer sequence comprises the nucleotide sequence of SEQ ID NO:78 or 79.

[0024] In certain embodiments, the spacer sequence is located at one or both of the 5' end and the 3' end of any of the following elements: a protein coding region, an IRES, a 5' internal homology arm, a 3' internal homology arm, a 5' exonic element, and a 3' exonic element.

[0025] In certain embodiments, the circular RNA comprises the following elements from 5' to 3': a) a 3' exonic element, b) a 5' internal homology arm, c) a spacer sequence, d) an IRES, e) a protein coding region, f) a spacer sequence, g) a 3' internal homology arm, and h) a 5' exonic element.

[0026] In certain embodiments, the circular RNA comprises the following elements from 5' to 3': a) a 3' exonic element, b) a 5' internal homology arm, c) a spacer sequence, d) a protein coding region, e) an IRES, f) a spacer sequence, g) a 3' internal homology arm, and h) a 5' exonic element.

[0027] In certain embodiments, at least one RNA aptamer is located at the 5' end or the 3' end of any of elements a)-h).

[0028] In certain embodiments, the circular RNA contains at least one 5' untranslated region (5'UTR), at least one 3' untranslated region (3'UTR), and / or at least one polyadenylation (poly A) sequence.

[0029] In certain embodiments, the 5'UTR, 3'UTR and / or poly A sequence is a spacer sequence.

[0030] In certain embodiments, the RNA aptamer is embedded in an RNA scaffold.

[0031] In certain embodiments, the RNA scaffold comprises at least one secondary structure motif.

[0032] In certain embodiments, the secondary structure motif is a tetraloop, a pseudoknot, or a stem-loop.

[0033] In certain embodiments, the RNA scaffold comprises at least one tertiary structure.

[0034] In certain embodiments, the secondary structural motifs and / or tertiary structures are nuclease resistant.

[0035] In certain embodiments, the RNA scaffold comprises a transfer RNA (tRNA).

[0036] In certain embodiments, the RNA aptamer is embedded in the tRNA hairpin loop of the tRNA.

[0037] In certain embodiments, the RNA aptamer is embedded in the tRNA anticodon loop of the tRNA.

[0038] In certain embodiments, the RNA aptamer is embedded in the tRNA D-loop of the tRNA.

[0039] In certain embodiments, the RNA aptamer is S1m, Sm, or a derivative or fragment thereof.

[0040] In certain embodiments, the circular RNA comprises one to four RNA aptamers.

[0041] In certain embodiments, the RNA aptamers are identical.

[0042] In certain embodiments, at least one of the RNA aptamers is different.

[0043] In certain embodiments, RNA aptamers are synthetically derived.

[0044] In certain embodiments, the RNA aptamer is a split aptamer or an X-aptamer.

[0045] In certain embodiments, RNA aptamers are naturally derived.

[0046] In certain embodiments, the RNA aptamer is derived from a hairpin RNA, a tRNA, or a riboswitch.

[0047] In certain embodiments, the RNA aptamer is bound to an affinity ligand.

[0048] In certain embodiments, the affinity ligand comprises protein A, protein G, streptavidin, glutathione, dextran, or a fluorescent molecule.

[0049] In certain embodiments, the affinity ligand comprises streptavidin.

[0050] In certain embodiments, the affinity ligand is immobilized on a chromatography resin.

[0051] In certain embodiments, at least one RNA aptamer is located: a) before the 3' exon element, b) between the 3' exon element and the 5' internal homology arm, c) between the 5' internal homology arm and the 5' spacer sequence, d) between the 5' spacer sequence and the IRES, e) between the protein coding region and the 3' spacer sequence, f) between the 3' spacer sequence and the 3' internal homology arm, g) between the 3' internal homology arm and the 5' exon element, h) after the 5' exon element, i) between the 3' exon and the IRES, and / or j) between the IRES and the 5' exon element.

[0052] In certain embodiments, at least one RNA aptamer is located: a) before the 3' exon element, b) between the 3' exon element and the 5' internal homology arm, c) between the 5' internal homology arm and the 5' spacer sequence, d) between the 5' spacer sequence and the protein coding region, e) between the IRES and the 3' spacer sequence, f) between the 3' spacer sequence and the 3' internal homology arm, g) between the 3' internal homology arm and the 5' exon element, h) after the 5' exon element, i) between the 3' exon and the protein coding region, and / or j) between the protein coding region and the 5' exon element.

[0053] In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 65 or 66.

[0054] In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:84. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:85. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:86. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:87. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:88. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:89. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:90. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:91. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:92. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:93.

[0055] In certain embodiments, the tRNA embedded with the RNA aptamer comprises the nucleotide sequence of SEQ ID NO:67.

[0056] In certain embodiments, the RNA aptamer is about 30-200 nucleotides in length.

[0057] In certain embodiments, the RNA aptamer is about 50-200 nucleotides in length.

[0058] In certain embodiments, the RNA aptamer is not a histone stem-loop.

[0059] In certain embodiments, the circular RNA comprises at least one chemical modification.

[0060] In certain embodiments, the chemical modification is pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thiol-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, 2'-O-methyluridine, or N6-methyladenosine.

[0061] In certain embodiments, the chemical modification is pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, N6-methyladenosine, or a combination thereof.

[0062] In certain embodiments, the chemical modification is N1-methylpseudouridine.

[0063] In another aspect, the disclosure provides a linear precursor RNA comprising at least a self-splicing ribozyme and a protein coding region, wherein the linear precursor RNA comprises at least one RNA aptamer.

[0064] In certain embodiments, the self-splicing ribozyme comprises at least two catalytic subunits.

[0065] In certain embodiments, the catalytic subunit of the self-splicing ribozyme is derived from a group I intron or a group II intron RNA transcript or a fragment thereof.

[0066] In certain embodiments, the catalytic subunit of the self-splicing ribozyme is derived from a replaced intron-exon (PIE) sequence from the cyanobacterium Anabaena pre-tRNA-Leu gene, the bacteriophage T4 Td gene, or the Tetrahymena pre-rRNA.

[0067] In certain embodiments, the catalytic activity of these two subunits produces circularized RNA.

[0068] In certain embodiments, the linear precursor RNA comprises the following elements from 5' to 3': a) a 5' external homology arm, b) a 3' self-splicing PIE fragment, c) a 5' internal homology arm, d) a 5' spacer sequence, e) an internal ribosome entry site (IRES), f) a protein coding region, g) a 3' spacer sequence, h) a 3' internal homology arm, i) a 5' self-splicing PIE fragment, and j) a 3' external homology arm, wherein an RNA aptamer is present at one or both of the 5' end or the 3' end of any one of elements a)-j).

[0069] In certain embodiments, the linear precursor RNA comprises the following elements from 5' to 3': a) a 5' external homology arm, b) a 3' self-splicing PIE fragment, c) a 5' internal homology arm, d) a 5' spacer sequence, e) a protein coding region, f) an IRES, g) a 3' spacer sequence, h) a 3' internal homology arm, i) a 5' self-splicing PIE fragment, and j) a 3' external homology arm, wherein an RNA aptamer is present at one or both of the 5' end or the 3' end of any one of elements a)-j).

[0070] In certain embodiments, the 5' outer homology arm and the 3' outer homology arm comprise the nucleotide sequence of SEQ ID NO:69 or SEQ ID NO:72.

[0071] In certain embodiments, the 5' outer homology arm and the 3' outer homology arm are each independently about 5 to about 50 nucleotides in length.

[0072] In certain embodiments, the 5' self-splicing PIE fragment comprises the nucleotide sequence of SEQ ID NO:74.

[0073] In certain embodiments, the 5' internal homology arm comprises the nucleotide sequence of SEQ ID NO:70.

[0074] In certain embodiments, the 5' internal homology arm is about 5 to about 50 nucleotides in length.

[0075] In certain embodiments, the 5' spacer and the 3' spacer comprise the nucleotide sequence of SEQ ID NO:78 or SEQ ID NO:79.

[0076] In certain embodiments, the 5' spacer and the 3' spacer are each independently about 5 to 75 nucleotides in length.

[0077] In certain embodiments, the 3' self-splicing PIE fragment comprises the nucleotide sequence of SEQ ID NO:73.

[0078] In certain embodiments, the IRES is derived from coxsackievirus B3 (CVB3), encephalomyocarditis virus (EMCV), a dicistrovirus, hepatitis C virus (HCV), poliovirus (PV), enterovirus 71 (EV71), human rhinovirus (HRV), foot-and-mouth disease virus (FMDV), or a synthetic IRES.

[0079] In certain embodiments, the IRES comprises the nucleotide sequence of SEQ ID NO:75.

[0080] In certain embodiments, the linear precursor RNA comprises at least one 5' untranslated region (5'UTR), at least one 3' untranslated region (3'UTR), and / or a polyadenylation (poly A) sequence.

[0081] In certain embodiments, the protein coding region encodes at least one polypeptide.

[0082] In certain embodiments, the polypeptide is a biologically active polypeptide, a therapeutic polypeptide, or an antigenic polypeptide.

[0083] In certain embodiments, the RNA aptamer is embedded in an RNA scaffold.

[0084] In certain embodiments, the RNA scaffold comprises at least one secondary structure motif.

[0085] In certain embodiments, the secondary structure motif is a tetraloop, a pseudoknot, or a stem-loop.

[0086] In certain embodiments, the RNA scaffold comprises at least one tertiary structure.

[0087] In certain embodiments, the secondary structural motifs and / or tertiary structures are nuclease resistant.

[0088] In certain embodiments, the RNA scaffold comprises a transfer RNA (tRNA).

[0089] In certain embodiments, the RNA aptamer is embedded in the tRNA hairpin loop of the tRNA.

[0090] In certain embodiments, the RNA aptamer is embedded in the tRNA anticodon loop of the tRNA.

[0091] In certain embodiments, the RNA aptamer is embedded in the tRNA D-loop of the tRNA.

[0092] In certain embodiments, the RNA aptamer is S1m, Sm, or a derivative or fragment thereof.

[0093] In certain embodiments, the linear precursor RNA comprises one to four RNA aptamers.

[0094] In certain embodiments, the RNA aptamers are identical.

[0095] In certain embodiments, at least one of the RNA aptamers is different.

[0096] In certain embodiments, RNA aptamers are synthetically derived.

[0097] In certain embodiments, the RNA aptamer is a split aptamer or an X-aptamer.

[0098] In certain embodiments, the RNA aptamer is a split aptamer comprising a 5' portion and a 3' portion.

[0099] In certain embodiments, the 5' portion of the split aptamer is located 3' to the 5' exonic element and the 3' portion of the split aptamer is located 5' to the 3' exonic element.

[0100] In certain embodiments, the 5' portion of the split aptamer is located 3' to the 3' internal homology arm and the 3' portion of the split aptamer is located 5' to the 5' internal homology arm.

[0101] In certain embodiments, the cleaved aptamer is reformed into a functional aptamer following circularization of the linear precursor RNA.

[0102] In certain embodiments, RNA aptamers are naturally derived.

[0103] In certain embodiments, the RNA aptamer is derived from a hairpin RNA, a tRNA, or a riboswitch.

[0104] In certain embodiments, the RNA aptamer is bound to an affinity ligand.

[0105] In certain embodiments, the affinity ligand comprises protein A, protein G, streptavidin, glutathione, dextran, or a fluorescent molecule.

[0106] In certain embodiments, the affinity ligand comprises streptavidin.

[0107] In certain embodiments, the affinity ligand is immobilized on a chromatography resin.

[0108] In certain embodiments, at least one RNA aptamer is located: a) before the 5' external homology arm, b) between the 5' external homology arm and the 3' self-splicing PIE segment, c) between the 3' self-splicing PIE segment and the 5' internal homology arm, d) between the 5' internal homology arm and the 5' spacer sequence, e) between the 5' spacer sequence and the IRES, f) after the protein coding region but before the 3' spacer sequence, g) between the 3' spacer sequence and the 3' internal homology arm, h) between the 3' internal homology arm and the 5' self-splicing PIE segment, i) between the 5' self-splicing PIE segment and the 3' external homology arm, and / or j) after the 3' external homology arm.

[0109] In certain embodiments, at least one RNA aptamer is located: a) before the 5' external homology arm, b) between the 5' external homology arm and the 3' self-splicing PIE segment, c) between the 3' self-splicing PIE segment and the 5' internal homology arm, d) between the 5' internal homology arm and the 5' spacer sequence, e) between the 5' spacer sequence and the protein coding region, f) after the IRES, but before the 3' spacer sequence, g) between the 3' spacer sequence and the 3' internal homology arm, h) between the 3' internal homology arm and the 5' self-splicing PIE segment, i) between the 5' self-splicing PIE segment and the 3' external homology arm, and / or j) after the 3' external homology arm.

[0110] In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 65 or 66.

[0111] In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:84. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:85. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:86. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:87. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:88. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:89. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:90. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:91. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:92. In certain embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:93.

[0112] In certain embodiments, the tRNA embedded with the RNA aptamer comprises the nucleotide sequence of SEQ ID NO:67.

[0113] In certain embodiments, the RNA aptamer is about 30-200 nucleotides in length.

[0114] In certain embodiments, the RNA aptamer is about 50-200 nucleotides in length.

[0115] In certain embodiments, the RNA aptamer is not a histone stem-loop.

[0116] In certain embodiments, the linear precursor RNA comprises at least one chemical modification.

[0117] In certain embodiments, the chemical modification is pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thiol-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, 2'-O-methyluridine, or N6-methyladenosine.

[0118] In certain embodiments, the chemical modification is pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, N6-methyladenosine, or a combination thereof.

[0119] In certain embodiments, the chemical modification is N1-methylpseudouridine.

[0120] In certain embodiments, the linear precursor RNA is synthesized using in vitro transcription (IVT).

[0121] In one aspect, the present disclosure provides a circular RNA comprising a protein coding region and at least one RNA aptamer, wherein the circular RNA is formed by the above-mentioned linear precursor RNA.

[0122] In one aspect, the present disclosure provides a circular RNA comprising a protein coding region, wherein the circular RNA is formed from the above-mentioned linear precursor RNA, and wherein the circular RNA lacks an RNA aptamer.

[0123] In one aspect, the present disclosure provides a nucleic acid encoding the above-mentioned linear precursor RNA.

[0124] In one aspect, the present disclosure provides a vector comprising the above-mentioned nucleic acid.

[0125] In one aspect, the present disclosure provides a host cell comprising the above-mentioned vector.

[0126] In one aspect, the present disclosure provides a pharmaceutical composition comprising the aforementioned circular RNA or the aforementioned linear precursor RNA.

[0127] In one aspect, the present disclosure provides a method for producing circular RNA, the method comprising incubating the above-mentioned linear precursor RNA under conditions that allow the linear precursor RNA to circularize.

[0128] In certain embodiments, the linear precursor RNA is incubated with GTP and Mg2+.

[0129] In certain embodiments, the linear precursor RNA is incubated with GTP and Mg2+ for a time sufficient to circularize the linear precursor RNA.

[0130] In certain embodiments, GTP is present at a concentration of about 1 mM to about 15 mM.

[0131] In certain embodiments, GTP is present at a concentration of about 2 mM.

[0132] In certain embodiments, Mg2+ is present at a concentration of about 1 mM to about 50 mM.

[0133] In certain embodiments, Mg2+ is present at a concentration of about 10 mM.

[0134] In one aspect, the present disclosure provides a method for producing a plurality of circular RNA molecules, the method comprising incubating a plurality of linear precursor RNA molecules under conditions that circularize at least a portion of the linear precursor RNA molecules, wherein each linear precursor RNA molecule comprises the above-mentioned linear precursor RNA.

[0135] In certain embodiments, at least about 30% (ie, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or 100%) of the plurality of linear precursor RNA molecules are circularized.

[0136] In one aspect, the present disclosure provides a method for purifying circular RNA, comprising the following steps: (a) contacting a sample comprising the circular RNA described above with an affinity ligand immobilized on a chromatography resin, wherein an RNA aptamer comprises a binding affinity for the affinity ligand; (b) eluting the circular RNA from the chromatography resin; and (c) purifying the circular RNA from the sample.

[0137] In one aspect, the present disclosure provides a method for purifying a linear precursor RNA, comprising the following steps: (a) contacting a sample comprising the above-mentioned linear precursor RNA with an affinity ligand immobilized on a chromatographic resin, wherein an RNA aptamer comprises a binding affinity for the affinity ligand; (b) eluting the linear precursor RNA from the chromatographic resin; and (c) purifying the linear precursor RNA from the sample.

[0138] In certain embodiments, the method comprises one or more washing steps between the contacting step (a) and the eluting step (b).

[0139] In one aspect, the present disclosure provides a method for purifying circular RNA, the method comprising the steps of: (a) contacting a sample comprising the circular RNA with an affinity ligand immobilized on a chromatography resin; (b) eluting the circular RNA from the chromatography resin; and (c) isolating the circular RNA from the sample, wherein the circular RNA comprises a protein coding region and at least one RNA aptamer, wherein the RNA aptamer comprises a binding affinity for the affinity ligand.

[0140] In one aspect, the present disclosure provides a method for purifying a linear precursor RNA, the method comprising the steps of: (a) contacting a sample containing the linear precursor RNA with an affinity ligand immobilized on a chromatographic resin; (b) eluting the linear precursor RNA from the chromatographic resin; and (c) isolating the linear precursor RNA from the sample, wherein the linear precursor RNA comprises a protein coding region and at least one RNA aptamer, wherein the RNA aptamer comprises a binding affinity for the affinity ligand.

[0141] In one aspect, the present disclosure provides a method for purifying circular RNA, the method comprising the steps of: (a) contacting a sample comprising a plurality of linear precursor RNA molecules and a plurality of circular RNA molecules with an affinity ligand immobilized on a chromatographic resin; and (b) isolating the circular RNA molecules from the sample, wherein the linear precursor RNA molecules comprise a protein coding region and at least one RNA aptamer, and wherein the RNA aptamer comprises a binding affinity for the affinity ligand, and wherein the circular RNA molecules lack the RNA aptamer.

[0142] In certain embodiments, the circular RNA molecule is not bound to an affinity ligand.

[0143] In certain embodiments, the circular RNA or linear precursor RNA is greater than or equal to 90% pure.

[0144] In one aspect, the present disclosure provides a method of treating or preventing a disease or disorder, the method comprising administering the above-described pharmaceutical composition to a subject in need thereof.

[0145] In one aspect, the disclosure provides a pharmaceutical composition comprising a plurality of circular RNA molecules, wherein at least about 90% of the circular RNAs comprise a protein coding region and at least one RNA aptamer. BRIEF DESCRIPTION OF THE DRAWINGS

[0146] The foregoing and other features and advantages of the present disclosure will be more fully understood from the following detailed description of illustrative embodiments, taken in conjunction with the accompanying drawings.

[0147] Figure 1The left part is a schematic diagram of aptamer-tagged linear precursor RNA being cyclized to form aptamer-tagged circRNA. The right part shows that streptavidin affinity binding during the purification process can occur with aptamers labeled to linear precursor RNA (top) or aptamers labeled circRNA (bottom).

[0148] Figure 2A A plasmid map encoding the 4xS1m aptamer, linear precursor RNA, and PIE sequence for RNA circularization is depicted. The plasmid elements are arranged in the following 5' to 3' order: T7 promoter, 5' external homology arm, 3' Anabaena intron / exon fragment, 5' internal homology arm, 5' poly AC spacer, CVB3 IRES, protein coding region, 3' poly AC spacer, 4xS1m aptamer, 3' internal homology arm, 5' Anabaena intron / exon fragment, and 3' external homology arm.

[0149] Figure 2B A plasmid map encoding the tRNA-S1m aptamer, linear precursor RNA, and PIE sequence for RNA circularization is depicted. The plasmid elements are arranged in the following 5' to 3' order: T7 promoter, 5' external homology arm, 3' Anabaena intron / exon fragment, 5' internal homology arm, 5' poly-AC spacer, CVB3 IRES, protein coding region, 3' poly-AC spacer, 3' internal homology arm, 5' Anabaena intron / exon fragment, 3' external homology arm, and tRNA-S1m aptamer.

[0150] Figure 2C A control plasmid map encoding a linear precursor RNA and a PIE sequence for RNA circularization but not encoding an aptamer is depicted. The plasmid elements are arranged in the following 5' to 3' order: T7 promoter, 5' external homology arm, 3' Anabaena intron / exon fragment, 5' internal homology arm, 5' poly AC spacer, CVB3 IRES, protein coding region, 3' poly AC spacer, 3' internal homology arm, 5' Anabaena intron / exon fragment, and 3' external homology arm.

[0151] Figure 3 is an image of an agarose gel comparing the amounts of RNA species (circular, precursor, or nicked) in the elution fraction, unbound fraction, and wash fraction after affinity purification of 4xS1m aptamer-tagged circRNA, tRNA-S1m aptamer-tagged circRNA, or circRNA no aptamer control using streptavidin Sepharose beads.

[0152] Figure 4It is a bar graph measuring the elution fraction, unbound fraction, and wash fractions (wash 1 and wash 2) recovered after affinity purification of 4xS1m aptamer-tagged circRNA, tRNA-S1m aptamer-tagged circRNA, or circRNA without aptamer control by streptavidin Sepharose beads. The measured amount of recovered RNA is expressed as a percentage of the input (i.e., the input is a sample of circRNA that has not undergone affinity purification).

[0153] Figure 5 The design strategy for the generation of aptamer-tagged circRNAs (left panel) and subsequent affinity purification (right panel) using positive selection is shown. In the positive selection method, the linear precursor RNA is flanked by split aptamers, which are not affinity purified because the intact aptamer is required for binding to the affinity matrix. After the linear precursor RNA is circulized, the intact aptamer will be formed, allowing the linear precursor RNA to bind to the affinity matrix.

[0154] Figure 6 The design strategy for generating circRNA (left panel) and subsequent affinity purification (right panel) using negative selection is shown. In the negative selection method, the aptamer is located at the 5' end of the 3' intron of the linear precursor RNA or outside the 3' end of the 5' intron, so that the linear precursor RNA binds to the affinity matrix. Since the aptamer is located at the 5' end of the 3' intron of the linear precursor RNA or outside the 3' end of the 5' intron sequence, the circRNA will not contain the aptamer after cyclization and will not bind to the affinity matrix.

[0155] Figure 7 Is a bar graph measuring elution, unbound, and wash recovered after affinity purification of 4xS1m aptamer-labeled linear precursor RNA (pML49), tRNA-S1m aptamer-labeled linear precursor RNA (pML50 and pML51), no aptamer control (pML47), 4xS1m aptamer-labeled circRNA (pML26), and tRNA-S1m aptamer-labeled circRNA (pML38) by streptavidin Sepharose beads. The amount of recovered RNA measured is expressed as a percentage of the input (i.e., the input is the total RNA in the sample).

[0156] Figure 8A-8D is an image of an agarose gel comparing the expression of 4xS1m aptamer-labeled linear precursor RNA (pML49, Fig. 8A ), tRNA-S1m aptamer-labeled linear precursor RNA (pML50, Figure 8B and pML51, Figure 8C ), and several controls ( Fig.8D) Amount of RNA species (circular, precursor or nicked) in the eluted fraction, unbound fraction and wash fraction after affinity purification with streptavidin Sepharose beads.

[0157] Figure 9A-9C The images of capillary electrophoresis tracer are compared with the linear precursor RNA (pML50, Fig.9A and pML51, Fig. 9B ) and 4xS1m aptamer-labeled linear precursor RNA (pML49, Fig. 9C ) Amount of RNA species (circular, precursor or nicked) in the eluted fraction, unbound fraction and wash fraction after affinity purification with streptavidin Sepharose beads.

[0158] Fig.10 Depicted are bar graphs of the % linear precursor or circular / nicked RNA in the input, unbound, and wash fractions of streptavidin Sepharose bead affinity purification.

[0159] Figure 11A-11B Depicted are the % and total yield (mg) of linear precursor or circular / nicked RNA in the input, unbound, and wash fractions of the streptavidin Sepharose bead affinity purification.

[0160] Fig. 12A Depicted are the % RNA of linear precursor, circular / nicked and intronic (combination of bound intron, 5' intron and 3' intron) in the input, unbound and wash fractions of streptavidin Sepharose bead affinity purification. Fig. 12B A schematic diagram of the IVT construct that generates a linear precursor RNA with 5'- and 3'-terminal aptamers is depicted.

[0161] Fig.13 The % linear precursor or circular / nicked RNA of large circRNAs in the input fraction and purified fractions of streptavidin Sepharose bead affinity purification are depicted.

[0162] Fig.14 Depicted is GFP expression in Hela cells from purified and unpurified circRNAs. DETAILED DESCRIPTION

[0163] The present disclosure is particularly related to novel circRNA compositions and methods for RNA affinity purification. In particular, the present disclosure relates to circRNA and linear RNA precursor compositions comprising at least one RNA aptamer. The RNA aptamers associated with the disclosed circRNA compositions enable the use of effective affinity purification. Methods for making aptamer compositions of these circRNA markers are also disclosed herein. I. Definitions

[0164] Unless otherwise specified herein, the scientific and technical terms used in conjunction with the present invention should have the meanings commonly understood by those of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can also be used in the practice or test of the present invention, exemplary methods and materials are described below. In the event of a conflict, this specification (including definitions) will be used as the standard. Typically, the nomenclature and technology used in conjunction with cell and tissue culture, molecular biology, virology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, medicine and pharmaceutical chemistry, and protein and nucleic acid chemistry and hybridization as described herein are those nomenclatures and technologies well known in the art and commonly used. Enzymatic reactions and purification techniques are carried out as generally realized in the art or as described herein according to the manufacturer's instructions. Further, unless the context requires otherwise, singular terms should include plural numbers, and plural terms should include singular numbers. Throughout the present specification and examples, the words "have" and "comprise" or variations such as "has / having", "comprises / comprising" should be understood to mean the inclusion of the stated integer or groups of integers but not the exclusion of any other integer or groups of integers. All publications and other references mentioned herein are incorporated by reference in their entirety. Although a number of documents are cited herein, this citation does not constitute an admission that any of these documents forms part of the common general knowledge in the art.

[0165] It should be noted that the term "a" or "an" entity refers to one or more of the entity; for example, "a nucleotide sequence" is understood to mean one or more nucleotide sequences. Therefore, the terms "a / an", "one or more", and "at least one" can be used interchangeably herein.

[0166] In addition, "and / or" where used herein should be regarded as a specific disclosure of each of the two specified features or components with or without the other. Therefore, the term "and / or" as used in phrases such as "A and / or B" is intended to include "A and B", "A or B", "A" (alone) and "B" (alone). Similarly, the term "and / or" as used in phrases such as "A, B and / or C" is intended to cover each of the following aspects: A, B and C; A, B or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0167] It should be understood that wherever aspects are described herein with the language "comprising," similar aspects described in the form of "consisting of" and / or "consisting essentially of" are also provided.

[0168] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present disclosure relates. For example, Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary Of Cell And Molecular Biology, 3rd ed., 1999, Academic Press; and Oxford Dictionary Of Biochemistry And Molecular Biology, Revised ed., 2000, Oxford University Press can provide a general dictionary of many of the terms used in the present disclosure for one of ordinary skill.

[0169] Units, prefixes and symbols are all expressed in the form accepted by the International System of Units (SI). Numerical ranges include numbers that limit the range. Unless otherwise indicated, amino acid sequences are written from left to right in the amino to carboxyl direction. The headings provided herein are not limitations on the various aspects of the present disclosure. Therefore, the terms of the definitions immediately below are more fully defined by reference to the specification (in its entirety).

[0170] The term "approximately" or "about" is used herein to mean approximately, roughly, approximately, or about. When the term "approximately" is used in conjunction with a numerical range, it defines the range by extending the boundary above and below the numerical value described. In general, the term "approximately" can limit the numerical value to a change of, for example, 10% above and below (higher or lower) above and below the specified value. In some embodiments, the term represents a deviation of ±10%, ±5%, ±4%, ±3%, ±2%, ±1%, ±0.9%, ±0.8%, ±0.7%, ±0.6%, ±0.5%, ±0.4%, ±0.3%, ±0.2%, ±0.1%, ±0.05% or ±0.01% from the indicated numerical value. In some embodiments, "approximately" represents a deviation of ±10% from the indicated numerical value. In some embodiments, "approximately" represents a deviation of ±5% from the indicated numerical value. In some embodiments, "approximately" represents a deviation of ±4% from the indicated numerical value. In some embodiments, "approximately" represents a deviation of ±3% from the indicated numerical value. In some embodiments, "approximately" represents a deviation of ±2% from the indicated numerical value. In some embodiments, "about" means a deviation of ±1% from the indicated value. In some embodiments, "about" means a deviation of ±0.9% from the indicated value. In some embodiments, "about" means a deviation of ±0.8% from the indicated value. In some embodiments, "about" means a deviation of ±0.7% from the indicated value. In some embodiments, "about" means a deviation of ±0.6% from the indicated value. In some embodiments, "about" means a deviation of ±0.5% from the indicated value. In some embodiments, "about" means a deviation of ±0.4% from the indicated value. In some embodiments, "about" means a deviation of ±0.3% from the indicated value. In some embodiments, "about" means a deviation of ±0.1% from the indicated value. In some embodiments, "about" means a deviation of ±0.05% from the indicated value. In some embodiments, "about" means a deviation of ±0.01% from the indicated value.

[0171] Depending on the context, the term "polynucleotide" or "nucleotide" can include a single nucleic acid as well as multiple nucleic acids. In some embodiments, the polynucleotide is an isolated nucleic acid molecule or construct, such as a circular RNA (circRNA) or a plasmid DNA (pDNA). In some embodiments, the polynucleotide comprises a conventional phosphodiester bond. In some embodiments, the polynucleotide comprises an unconventional bond (e.g., an amide bond, such as found in a peptide nucleic acid (PNA)). The term "nucleic acid" can refer to any one or more nucleic acid fragments present in the polynucleotide, such as a DNA or RNA fragment. An "isolated" nucleic acid or polynucleotide refers to a nucleic acid molecule DNA or RNA removed from its natural environment. For example, for the purposes of this disclosure, a recombinant polynucleotide encoding a factor VIII polypeptide contained in a vector is considered to be isolated. Further examples of isolated polynucleotides include recombinant polynucleotides maintained in a heterologous host cell or purified (partially or substantially) from other polynucleotides in a solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the polynucleotides disclosed herein. Polynucleotides or nucleic acids isolated according to this disclosure further include such molecules produced synthetically. In addition, polynucleotides or nucleic acids may include regulatory elements, such as promoters, enhancers, ribosome binding sites, or transcription termination signals.

[0172] As used herein, the term "polypeptide" is intended to include a single "polypeptide" as well as a plurality of "polypeptides", and refers to a molecule consisting of monomers (amino acids) linearly linked by amide bonds (also referred to as peptide bonds). The term "polypeptide" refers to any one or more chains of two or more amino acids, not the specific length of the product. Therefore, peptides, dipeptides, tripeptides, oligopeptides, "proteins", "amino acid chains" or any other terms used to refer to one or more chains of two or more amino acids are included in the definition of "polypeptide", and the term "polypeptide" can replace any of these terms, or be used interchangeably. The term "polypeptide" is also intended to refer to products modified after polypeptide expression, including but not limited to glycosylation, acetylation, phosphorylation, amidation, derivatization of known protection / blocking groups, proteolytic cleavage or modification of non-naturally occurring amino acids. The polypeptide can be derived from a natural biological source or produced by recombinant technology, but is not necessarily translated from a specified nucleic acid sequence. It can be produced in any manner, including by chemical synthesis.

[0173] An "isolated" polypeptide or fragment, variant or derivative thereof is one that is not in its natural environment. No particular level of purification is required. For example, an isolated polypeptide may simply be removed from its native or natural environment. For purposes of this disclosure, recombinantly produced polypeptides and proteins expressed in host cells are considered isolated, as are native or recombinant polypeptides that are separated, fractionated, or partially or substantially purified by any suitable technique.

[0174] As used herein, "administering" or "administering" refers to delivering a composition described herein, such as a chimeric protein, to a subject. Compositions, such as chimeric proteins, can be administered to a subject using methods known in the art. In particular, the composition can be administered intravenously, subcutaneously, intramuscularly, intradermally, or via any mucosal surface, such as orally, sublingually, buccally, nasally, rectally, vaginally, or via a pulmonary route. In some embodiments, administration is performed intravenously. In some embodiments, administration is performed subcutaneously. In some embodiments, administration is self-administered. In some embodiments, a parent administers the chimeric protein to a child. In some embodiments, the chimeric protein is administered to a subject by a health care practitioner such as a doctor, medical staff, or nurse. II. Circular RNA and Linear Precursor RNA

[0175] Disclosed herein are circular RNA (circRNA) compositions comprising a protein coding region and at least one RNA aptamer. Also disclosed herein are linear precursor RNA compositions comprising a self-splicing ribozyme and a protein coding region, wherein the linear precursor RNA comprises at least one RNA aptamer.

[0176] As used herein, the term "circular RNA" or "circRNA" refers to an RNA polynucleotide that does not include a 5' end or a 3' end, i.e., a continuous RNA molecule that does not have a 5' end or a 3' end. Exogenous circRNA constructs containing protein coding regions have been previously described and shown to be able to extend the duration of protein expression of full-length RNA. Wesselhoeft et al., (2018), Nat Commun. [Nature Communication], 9(1): 2629; Wesselhoeft et al., (2019), Mol Cell. [Molecular Cell], 74(3): 508-520; WO 2019236673.

[0177] As used herein, the term "linear RNA precursor" refers to a non-circular RNA polynucleotide, but it contains a sequence motif to promote cyclization reaction, thereby producing circular RNA. In certain embodiments, the sequence motif that promotes cyclization is a self-splicing ribozyme. The self-splicing ribozyme method effectively coordinates the cyclization of various RNAs (including RNAs with protein coding regions) in vitro. Designing a linear precursor RNA with additional auxiliary sequences helps to create favorable conditions for splicing (i.e., 5' external homology arms, 5' internal homology arms, 5' spacer sequences, 3' spacer sequences, 3' internal homology arms, and 3' external homology arms). The same. Functional proteins are exogenous circRNA constructs produced in eukaryotic cells, and translation is successfully initiated by incorporating internal ribosome entry sites (IRES) and internal polyadenylation bundles.

[0178] Exogenous circRNA purified by HPLC showed excellent protein production quality in terms of protein yield and stability. However, the samples retained impurities and unwanted RNA species, including linear precursor RNA, nicked circular RNA, double-stranded RNA, triphosphate-RNA, free nucleotides, endotoxins, and solvents.

[0179] Provided herein are methods and compositions that facilitate robust and stable protein expression in eukaryotic cells using exogenous circRNAs by improving the efficiency, quality, and reliability of circRNA purification methods. A. IRES

[0180] Translation of circRNA can only be initiated in a cap-independent manner because circRNA lacks a 5' cap and a 3' poly A tail. IRES-mediated translation of exogenous circRNA is one of the widely accepted mechanisms for circRNA translation initiation. Pamudurti et al., (2017), 66: 9–21e27; Petkovic (2015), Nucleic Acids Res., 43: 2454-2465.

[0181] In some embodiments, the circRNA disclosed herein comprises an internal ribosome entry site (IRES) located at the 5' end of the protein coding region. In some embodiments, the linear precursor RNA disclosed herein comprises an IRES. In some embodiments, the IRES is located at the 3' end of the protein coding region in the linear precursor RNA, but is transferred to the 5' end of the protein coding region after circulization.

[0182] In some embodiments, the IRES is derived from Taura syndrome virus, blood-sucking assassin bug virus, Theile's encephalomyelitis virus, simian virus 40, fire ant virus 1, graminearum aphid virus, reticuloendotheliosis virus, human poliovirus 1, stink bug enterovirus, Kashmir bee virus, human rhinovirus 2, green leafhopper virus-1, human immunodeficiency virus type 1, green leafhopper virus-1, louse P virus, hepatitis C virus (HCV), hepatitis A virus, GB hepatitis virus, Inflammatory virus, equine rhinitis virus, tea geometrid-like virus, encephalomyocarditis virus (EMCV), Drosophila C virus, crucifer tobacco virus, cricket paralysis virus, bovine viral diarrhea virus 1, black queen cell virus, aphid lethal paralysis virus, avian encephalomyelitis virus, acute bee paralysis virus, hibiscus yellow ringspot virus, classical swine fever virus, human FGF2, human SFTPA1, human AMLURUNX1, Drosophila antennae, human AQP4, human AT1R, human BAG-1, Human BCL2, human BiP, human c-IAP1, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1α, human n.myc, mouse Gtx, human p27kip1, human PDGF2 / c-sis, human p53, human Pim-1, mouse Rbm3, Drosophila reaper, canine Scamper, Drosophila Ubx, human UNR, mouse UtrA, human VEGF-A, human XIAP, Drosophila In some embodiments, the IRES is derived from CVB3 IRES. In another embodiment, the IRES comprises the polynucleotide sequence of SEQ ID NO: 75. In another embodiment, the IRES is encoded by the polynucleotide sequence of SEQ ID NO: 51. B. 5' and 3' homology arms

[0183] As used herein, "homology arm" is any continuous sequence predicted to form base pairs with at least about 75% (e.g., at least about 80%, at least about 85%, at least about 90%, at least about 95% or 100%) of another homology arm in RNA (i.e., circular RNA or linear RNA precursor). The length of the homology arm sequence is about 5 to about 50 nucleotides. The homology arm sequence can be located before and adjacent to, or included in, the 3' intron fragment, and / or located after and adjacent to, or included in, the 5' intron fragment. It is predicted that the homology arm sequence has less than 50% (e.g., less than 45%, less than 40%, less than 35%, less than 30%, less than 25%) base pairing with an unexpected sequence in RNA (e.g., a non-homologous arm sequence). "Strong homology arm" refers to a homology arm with a Tm greater than 50°C when base pairing with another homology arm in RNA.

[0184] "Internal homology arms" and "external homology arms" refer to the direction of the homology arms relative to the self-splicing PIE segment and the protein coding region. In the linear precursor RNA, the internal homology arms are located between the self-splicing PIE segment and the protein coding region. Under circularization conditions, the internal homology arms remain in the circular RNA. In the linear precursor RNA, the external homology arms flank the self-splicing PIE segment. Under circularization conditions, the external homology arms are removed and are not present in the circular RNA.

[0185] In some embodiments, the circRNA disclosed herein comprises a 5' internal homology arm. In some embodiments, the linear precursor RNA disclosed herein comprises a 5' internal homology arm. In some embodiments, the 5' internal homology arm comprises the nucleotide sequence of SEQ ID NO: 70. In some embodiments, the length of the 5' internal homology arm is about 5 to about 50 nucleotides.

[0186] In some embodiments, the circRNA disclosed herein comprises a 3' internal homology arm. In some embodiments, the linear precursor RNA disclosed herein comprises a 3' internal homology arm. In some embodiments, the 3' internal homology arm comprises the nucleotide sequence of SEQ ID NO: 71. In some embodiments, the length of the 3' internal homology arm is about 5 to about 50 nucleotides.

[0187] In some embodiments, the linear precursor RNA disclosed herein comprises a 5' external homology arm and a 3' external homology arm. In some embodiments, the 5' external homology arm and the 3' external homology arm comprise the nucleotide sequence of SEQ ID NO: 69 or SEQ ID NO: 72. In some embodiments, the length of the 5' external homology arm and the 3' external homology arm is each independently about 5 to about 50 nucleotides. C. Spacer sequence

[0188] The spacer sequence can be used to separate the different elements in the circular RNA or linear precursor RNA of the present disclosure. By separating different elements, the RNA secondary structure can be folded better. For example, but not limited in any way, the spacer can be placed at the 5' end of IRES to allow IRES to fold into a suitable structure. The spacer sequence can be a poly-A sequence, a poly-AC sequence, a poly-C sequence, a poly-U sequence, or the spacer sequence can be engineered according to the spatial constraints of the secondary structure constituted by other elements contained in the linear precursor RNA (for example, aptamer, IRES and 5' and 3' self-splicing PIE fragment). The spacer sequence can promote cyclization by introducing a spacer-spacer complementary region to promote the formation of "splicing bubble (splicing bubble)", and the spacer sequence promotes functionality by allowing the highly structured intron part of the self-splicing PIE fragment and IRES to fold into its correct secondary structure.

[0189] In certain embodiments, the circular RNA or linear precursor RNA disclosed herein include at least one spacer sequence. In certain embodiments, the circular RNA or linear precursor RNA include two or more spacer sequences. These two or more spacer sequences may include the same nucleotide sequence. In other embodiments, at least one of these two or more spacer sequences includes different nucleotide sequences. In certain embodiments, the length of the spacer sequence is about 5 to about 500 nucleotides. In certain embodiments, the length of the spacer sequence is about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450 or about 500 nucleotides. In certain embodiments, the length of the spacer sequence is greater than about 500 nucleotides.

[0190] In some embodiments, the circular RNA or linear precursor RNA disclosed herein comprises a 5' spacer and a 3' spacer sequence. In some embodiments, the 5' spacer and the 3' spacer comprise the nucleotide sequence of SEQ ID NO: 78 or SEQ ID NO: 79. D. Self-splicing ribozyme elements and circularization of linear precursor RNA

[0191] The self-splicing ribozyme cyclization method using a displaced type I catalytic intron allows long linear precursor RNAs to be cyclized and only requires the addition of GTP and Mg2+ as cofactors (i.e., cyclization conditions). Petkovic and Muller, (2015) Nucleic Acids Research, 43(4):2454-2465. The displaced intron-exon (PIE) splicing strategy consists of fused partial exons flanked by half-intron sequences (i.e., 3' self-splicing PIE fragment and 5' self-splicing PIE fragment). Puttaraju and Been, (1992) Nucleic Acids Research, 20(20):5357-5364. After the addition of cyclization conditions, the linear precursor RNA containing the 3' and 5' self-splicing PIE undergoes a double transesterification reaction characterized by a type I catalytic intron. During the reaction, the exonic elements fuse to form a 5' to 3' linked ring. Petkovic and Muller, (2015) Nucleic Acids Research, 43(4): 2454-2465; Wesselhoeft et al., (2018), Nat Commun., 9(1): 2629.

[0192] In some embodiments, the linear precursor RNA disclosed herein comprises at least two catalytic subunits. In some embodiments, the catalytic subunit of the self-splicing ribozyme is derived from a type I intron or type II intron RNA transcript or a fragment thereof. In some embodiments, the catalytic subunit of the self-splicing ribozyme is derived from a replaced intron-exon (PIE) sequence from a cyanobacterium Anabaena pre-tRNA-Leu gene, a T4 phage Td gene, or a Tetrahymena pre-rRNA. In some embodiments, the RNA catalytic subunit comprises a 3' self-splicing PIE fragment and a 5' self-splicing PIE fragment. In some embodiments, the 3' self-splicing PIE fragment comprises the nucleotide sequence of SEQ ID NO: 73. In some embodiments, the 5' self-splicing PIE fragment comprises the nucleotide sequence of SEQ ID NO: 74. In some embodiments, the catalytic activity of the two subunits produces a circularized RNA.

[0193] In some embodiments, the circRNA disclosed herein comprises a 3' exon element. In some embodiments, the 3' exon element comprises the nucleotide sequence of SEQ ID NO: 81. In some embodiments, the circRNA comprising a protein coding region and at least one RNA aptamer comprises a 5' exon element. In some embodiments, the 5' exon element comprises the nucleotide sequence of SEQ ID NO: 83. E. 5' and 3' UTR sequences and poly A sequences

[0194] Previous studies have shown that 5' and 3' UTR sequences do not hinder efficient RNA circularization and can potentially improve circRNA expression by acting as additional spacer sequences (see, e.g., WO 2019236673). Polyadenylation (poly A) sequences can also function as spacers.

[0195] In some embodiments, the circRNA disclosed herein contains at least one 5' untranslated region (5'UTR), at least one 3' untranslated region (3'UTR) and / or at least one polyadenylation (poly A) sequence. In some embodiments, the linear precursor RNA disclosed herein contains at least one 5' untranslated region (5'UTR), at least one 3' untranslated region (3'UTR) and / or a polyadenylation (poly A) sequence.

[0196] In some embodiments, the 5'UTR comprises the nucleotide sequence of SEQ ID NO: 76. In some embodiments, the 3'UTR comprises the nucleotide sequence of SEQ ID NO: 77.

[0197] In some embodiments, the length of the 5'UTR may be between about 50 and 500 nucleotides. In some embodiments, the length of the 3'UTR may be between 50 and 500 nucleotides or longer. In some embodiments, the circular RNA and linear precursor RNA disclosed herein comprise a 5' or 3'UTR derived from a gene different from the gene encoding the polypeptide in the protein coding region. In some embodiments, the circRNA disclosed herein comprises a chimeric 5' or 3'UTR. In some embodiments, the linear precursor RNA disclosed herein comprises a chimeric 5' or 3'UTR. F. IVT: Generation of linear precursors

[0198] The term "in vitro transcription" or "IVT" refers to the process of synthesizing RNA in a cell-free system (in vitro). As disclosed herein, linearized plasmid DNA can be used as a template for the production of linear RNA precursors. The promoter used to control in vitro transcription can be any promoter of any DNA-dependent RNA polymerase. Examples of DNA-dependent RNA polymerases are T7, T3 and SP6 RNA polymerases. A DNA template for in vitro RNA transcription can be obtained by cloning a nucleic acid (particularly a cDNA corresponding to a target RNA to be transcribed in vitro) and introducing it into a DNA suitable for in vitro transcription (e.g., plasmid DNA). The cDNA can be obtained by reverse transcription of mRNA, chemical synthesis, or oligonucleotide cloning.

[0199] The linear precursor RNA disclosed herein can be synthesized according to any of a variety of known methods. In some embodiments, the linear precursor RNA according to the present invention can be synthesized via in vitro transcription (IVT). Methods for in vitro transcription are known in the art. See, for example, Geall et al. (2013) Semin. Immunol. 25(2):152-159; Brunelle et al. (2013) Methods Enzymol. 530:101-14. Briefly, IVT is typically performed with a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may include DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNase I, pyrophosphatase, and / or RNase inhibitor. The exact conditions will vary depending on the specific application. The presence of these reagents is undesirable in the final RNA product and is considered an impurity or contaminant that must be purified to provide a clean and uniform linear precursor RNA or generated circRNA suitable for therapeutic use. G. Total length and chemical modifications of circRNAs and linear precursor RNAs

[0200] The methods disclosed herein can be used to purify circRNA or linear precursor RNA of various nucleotide lengths. In some embodiments, the disclosed methods can be used to purify circRNA or linear precursor RNA of length greater than about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb or 15 kb. The circRNA or linear precursor RNA disclosed herein can be modified or unmodified. In some embodiments, the circRNA or linear precursor RNA disclosed herein contains one or more modifications, which typically enhance RNA stability or regulate circRNA translation. Tang and Lv, (2021), Int J Biol Sci. [International Journal of Biological Sciences] 17 (9); 2262-2277. Exemplary modifications include backbone modifications, sugar modifications or base modifications. In some embodiments, the disclosed linear precursor RNA can be synthesized from naturally occurring nucleotides and / or nucleotide analogs (modified nucleotides), including but not limited to purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)) and analogs or derivatives of modified nucleotide purines and pyrimidines, such as, for example, 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5- uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetate methyl ester, 5-methylaminomethyl-uracil , 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, braided glycoside, β-D-mannosyl-braided glycoside, phosphoramide, phosphorothioate, peptide nucleotide, methylphosphonate, 7-deazaguanosine, 5-methylcytosine, N6-methyladenosine and inosine.In some embodiments, the disclosed circRNA or linear precursor RNA comprises at least one chemical modification, including but not limited to consisting of: pseudouridine, N1-methyl pseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thiol-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine and 2'-O-methyluridine. In some embodiments, the modified nucleotide comprises N1-methyl pseudouridine. The preparation of such analogs is known to those skilled in the art, for example, from U.S. Pat. No. 4,373,071, U.S. Pat. No. 4,401,796, U.S. Pat. No. 4,415,732, U.S. Pat. No. 4,458,066, U.S. Pat. No. 4,500,707, U.S. Pat. No. 4,668,777, U.S. Pat. No. 4,973,679, U.S. Pat. No. 5,047,524, U.S. Pat. No. 5,132,418, U.S. Pat. No. 5,153,319, U.S. Pat. No. 5,262,530, and U.S. Pat. No. 5,700,642. H. Protein coding region

[0201] The circRNA or linear precursor RNA disclosed herein contains a protein coding region encoding a protein (e.g., a polypeptide or peptide). In some embodiments, the protein coding region is derived from a single gene or a single synthetic or expression construct. However, in some embodiments, the circRNA or linear precursor RNA composition disclosed herein comprises multiple protein coding regions and each can or co-encode one or more proteins.

[0202] In some embodiments, the circRNA or linear precursor RNA comprising an RNA aptamer as disclosed herein encodes a therapeutic polypeptide. In some embodiments, the therapeutic polypeptide comprises an antibody heavy chain, an antibody light chain, an enzyme, or a cytokine.

[0203] In some embodiments, circRNA or linear precursor RNA encodes cytokines. Non-limiting examples of cytokines include IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, INF-α, INF-γ, GM-CFS, M-CSF, LT-β, ​​TNF-α, growth factors and hGH.

[0204] In one embodiment, the circRNA or linear precursor RNA comprising RNA aptamers encodes a genome editing polypeptide. In certain embodiments, the genome editing polypeptide is a CRISPR protein, a restriction nuclease, a meganuclease, a transcription activator-like effector protein (TALE, including TALE nuclease, TALEN) or a zinc finger protein (ZF, including ZF nuclease, ZFN). See, for example, International Publication No. WO 2020139783.

[0205] In some embodiments, the circRNA or linear precursor RNA encodes an enzyme used in enzyme replacement therapy. Examples of enzyme replacement therapy include lysosomal diseases such as Gaucher disease, Fabry disease, MPS I, MPS II (Hunter syndrome), MPS VI, and glycogen storage disease type II.

[0206] In some embodiments, the circRNA or linear precursor RNA comprising an RNA aptamer encodes an antigen of interest. The antigen can be a polypeptide derived from a virus, such as influenza virus, coronavirus (e.g., SARS-CoV-1, SARS-CoV-2, or MERS-related virus), Ebola virus, dengue virus, human immunodeficiency virus (HIV), hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), herpes simplex virus (HSV), respiratory syncytial virus (RSV), rhinovirus, cytomegalovirus (CMV), Zika virus, human papillomavirus (HPV), human metapneumovirus (hMPV), human parainfluenza virus type 3 (PIV3), Epstein-Barr virus (EBV), or chikungunya virus.

[0207] The antigen can be derived from a bacterium, such as Staphylococcus aureus, Moraxella (e.g., Moraxella catarrhalis; causing otitis, respiratory tract infections, and / or sinusitis), Chlamydia trachomatis (causing chlamydia), Borrelia (e.g., Borrelia burgdorferi causing Lyme disease), Bacillus anthracis (causing anthrax), Salmonella typhi (causing typhoid fever), Mycobacterium tuberculosis (causing tuberculosis), Propionibacterium acnes (causing acne), or non-typeable Haemophilus influenzae.

[0208] If desired, the circRNA or linear precursor RNA comprising RNA aptamers may encode more than one antigen. In some embodiments, the circRNA or linear precursor RNA disclosed herein may encode two, three, four, five, six, seven, eight, nine, ten or more antigens. These antigens may be from the same or different pathogens. For example, a polycistronic protein coding region may be translated into more than one antigen (e.g., each antigen coding sequence is separated by a nucleotide linker encoding a self-cleaving peptide (e.g., a 2A peptide)), and may be further fused to an aptamer.

[0209] In some embodiments, the circRNA or linear precursor RNA compositions disclosed herein are used in vaccines. RNA vaccines provide a promising alternative to traditional subunit vaccines (containing antigenic proteins derived from pathogens). RNA-based vaccines allow for the de novo expression of complex antigens in vaccinated subjects, thereby allowing for appropriate post-translational modifications and presentation of antigens in a native conformation. In addition, once established, the manufacturing process for circRNA vaccines can be used for a variety of antigens, enabling rapid development and deployment of circRNA vaccines. A detailed discussion of RNA vaccines can be found in Pardi et al., (2018) Nat Rev Drug Discov [Nature Reviews Drug Discovery] 17, 261–279. III. Aptamers

[0210] Widespread use of RNA affinity purification is limited by the lack of efficient RNA fusion tags. Unless the RNA to be purified naturally contains sequences with strong affinity for the target that can be immobilized on a stationary phase (i.e., a chromatography resin), the RNA may need to be tagged with a specific sequence, similar to the polyhistidine tags used in protein science.

[0211] Disclosed herein are circular RNA compositions comprising a protein coding region and at least one aptamer. Disclosed herein are linear precursor RNA compositions comprising at least a self-splicing ribozyme and a protein coding region, wherein the linear precursor RNA comprises at least one RNA aptamer. Aptamers associated with these circular RNA and linear precursor RNA compositions enable the use of affinity purification with minimal effect on translation efficiency and immunogenicity. Disclosed herein are methods of making such circular RNA-labeled and linear precursor RNA-labeled aptamer compositions.

[0212] As used herein, the term "aptamer" refers to any nucleic acid sequence with a non-covalent binding site for a specific target. Exemplary aptamer targets include nucleic acid sequences, proteins, peptides, antibodies, small molecules, minerals, antibiotics, etc. The aptamer binding site can be derived from the secondary, tertiary or quaternary conformational structure of the aptamer.

[0213] As used herein, the term "RNA aptamer" refers to an aptamer composed of RNA. In some embodiments, the RNA aptamer is contained in the nucleotide sequence of the circRNA or linear precursor RNA. In other embodiments, the RNA aptamer is separated from the nucleotide sequence of the circRNA or linear precursor RNA.

[0214] Aptamers are typically capable of binding to a specific target with high affinity and specificity. Aptamers have several advantages over other binding proteins (e.g., antibodies). For example, aptamers can be fully engineered in vitro (e.g., via the SELEX aptamer selection method), can be produced by chemical synthesis, have desirable storage characteristics, and do not cause or hardly cause immunogenicity in therapeutic applications. See generally, Proske et al., (2005) Appl. Microbiol. Biotechnol [Applied Microbiology and Biotechnology] 69: 367-374.

[0215] Aptamers have historically been used to regulate gene expression by directly binding to ligands. These aptamers act similarly to regulatory proteins, forming a highly specific binding pocket for the target followed by a conformational change.

[0216] In some embodiments, RNA aptamers are synthetically derived. In some embodiments, RNA aptamers are naturally derived from prokaryotes and / or eukaryotes. In some embodiments, RNA aptamers are derived from hairpin RNA, tRNA, or riboswitches.

[0217] In some embodiments, the RNA aptamer is derived from a riboswitch. Riboswitches are regulatory RNA elements that can act as small molecule sensors to control gene transcription and translation. Several classes of riboswitches are known in the art. Exemplary riboswitches include B 12Riboswitch, TPP riboswitch, SAM riboswitch, guanine riboswitch, FMN riboswitch, lysine riboswitch, and PreQ1 riboswitch.

[0218] In some embodiments, RNA aptamers are split aptamers. Split aptamers are similar to split protein systems (e.g., β-galactosidase) and rely on two or more short nucleic acid chains that assemble into higher-order structures in the presence of a specific target. Debais et al., (2020) Nucleic Acids Res [Nucleic Acids Research] 48 (7): 3400-3422. An exemplary split aptamer is an ATP aptamer. Sassanfar and Szostak (1993) Nature [Natural] 364 (6437) -550-553. ATP aptamers are RNA aptamers that are divided into two RNA fragments by removing the loop of the closed stem and extending each fragment with additional nucleotides to compensate for the loss of stability. Neither of these two RNA fragments can bind to ATP alone, but in the presence of ATP, the binding ability is reactivated. Debiais et al., (2020) Nucleic Acids Res [Nucleic Acids Research] 48 (7): 3400-3422.

[0219] In other embodiments, the split aptamer is re-formed by circularization of a linear precursor RNA. In this context, the split aptamer comprises a 5' portion and a 3' portion. Each portion can be any length less than a complete, unsplit aptamer. The 5' portion and the 3' portion together form a complete, unsplit aptamer. For a linear precursor RNA comprising a 3' exon element and a 5' exon element, the 5' portion of the split aptamer is located at the 3' of the 5' exon element, and the 3' portion of the split aptamer is located at the 5' of the 3' exon element. For a linear precursor RNA that does not comprise a 5' exon element and a 3' exon element, the 5' portion of the split aptamer is located at the 3' of the 3' internal homology arm, and the 3' portion of the split aptamer is located at the 5' of the 5' internal homology arm.

[0220] In certain embodiments, the cleaved aptamer is reformed into a functional aptamer following circularization of the linear precursor RNA.

[0221] In some embodiments, the RNA aptamer is an X-aptamer. X-aptamers are engineered with a combination of natural and chemically modified nucleotides to improve binding affinity, specificity, and versatility. An exemplary embodiment of an X-aptamer is a PS2-aptamer. PS2-aptamers are RNA aptamers that contain dithiophosphate (i.e., PS2) substitutions at a single nucleotide of the RNA aptamer, thereby increasing the binding affinity of the aptamer from the nanomolar range to the picomolar range. Abeydeera et al., (2016) Nucleic Acids Res. [Nucleic Acids Research] 44(17):8052-8064.

[0222] In some embodiments, the RNA aptamer binds to a ligand. In some embodiments, the ligand is used in an affinity purification system. In some embodiments, the affinity ligand comprises protein A, protein G, streptavidin, glutathione (GSH), dextran (cross-linked dextran), cellulose (e.g., diethylaminoethylcellulose) or a fluorescent molecule. In some embodiments, the affinity ligand is immobilized on a chromatographic resin.

[0223] In some embodiments, the affinity ligand comprises protein A. DNA aptamers have previously been shown to target protein A. See, e.g., Stoltenburg et al., (2016) Sci Rep. 6:33812.

[0224] In some embodiments, the disclosed RNA aptamers bind to streptavidin. Aptamers that bind to streptavidin are disclosed, for example, in Srisawat and Engelke (2001) RNA 7(4):632-641. An exemplary RNA aptamer that binds to streptavidin is S1. In some embodiments, the RNA aptamer comprises the nucleotide sequence of UCAUGCAAGUGCGUAAGAUAGUCGCGGGCCGGGGGCGUAU (SEQ ID NO:90).

[0225] Also disclosed herein are RNA aptamers that bind to cross-linked dextran. Aptamers that bind to cross-linked dextran are described, for example, in Srisawat et al., (2001) Nucleic Acid Res 29(2):e4. An exemplary RNA aptamer that binds to cross-linked dextran (e.g., cross-linked dextran G-100) is cross-linked dextran D8. In some embodiments, the RNA aptamer comprises the nucleotide sequence of GUCCGAGUAAUUUACGUUUUGAUACGGUUGCGGAACUUGC (SEQ ID NO: 91).

[0226] Also disclosed herein are RNA aptamers that bind to glutathione (GSH). Aptamers that bind to glutathione are described, for example, in Bala et al. (2011). RNA Biology 8(1): 101-111. In some embodiments, the RNA aptamer is GSHapt 8.17 or GSHapt 5.39.

[0227] Also disclosed herein is an RNA aptamer that binds to 6xHis. 6xHis corresponds to an amino acid sequence of 6 consecutive histidine residues. The 6xHis sequence can be isolated and optionally immobilized on a chromatographic resin. Alternatively, the 6xHis sequence can exist as an N or C terminal tag on a polypeptide, optionally, wherein the 6xHis-tagged polypeptide is immobilized on a chromatographic resin. The aptamer that binds to 6xHis is described in, for example, Tsuji et al., (2009). Biochem Biophys Res Commun. [Biochemistry and Biophysics Research Communications] 386 (1): 227-231. In some embodiments, the RNA aptamer is shot47 or 47s. In some embodiments, the RNA aptamer comprises the nucleotide sequence of GGGUACGCUCAGGUAUAUUGGCGCCUUCGUGGAAUGUCAGUGCCUGGACGUGCAGU (SEQ ID NO: 84). In some embodiments, the RNA aptamer comprises the nucleotide sequence of GGGACGCUCACGUACGCUCACGUCCGAUCGAUACUGGUAUAUUGGCGCCUUCGUGGAAUGUCAGUGCCUGGACGUGCAGU (SEQ ID NO: 85). In some embodiments, the RNA aptamer comprises the nucleotide sequence of GGGUAUAUUGGCGCCUUCGUGGAAUGUCAGUGCCUGG (SEQ ID NO: 86). Also disclosed herein are RNA aptamers that bind to MS2 coat protein (MCP). In some embodiments, the RNA aptamer comprises a nucleotide sequence of GGCCAACAUGAGGAUCACCCAUGUCUGCAGGGCC (SEQ ID NO: 87). In some embodiments, the RNA aptamer comprises a nucleotide sequence of ACAUGAGGAUCACCCAUG (SEQ ID NO: 88). In some embodiments, the RNA aptamer comprises a nucleotide sequence of ACAUGAGGAUCACCCAUGU (SEQ ID NO: 89). In some embodiments, the aptamer-containing circular RNA or linear RNA precursor described herein binds to MCP immobilized on a chromatographic resin. M2 aptamers are further described in detail in Bertrand et al., (1998). Molecular cell, 2 (4), 437-445.

[0228] Also disclosed herein are RNA aptamers that are bound to fluorescent molecules. Examples of such aptamers are described, for example, in Paige et al., (2011) Science 333(6042):642-646. In some embodiments, the RNA aptamer comprises a nucleotide sequence of GAAGGGACGGUGCGGAGAGGAGA (SEQ ID NO:92). The RNA aptamer is named RNAMango and is bound to a fluorescent molecule thiazole orange (TO) such as TO1-biotin, as described in Dolgosheina et al., (2014) ACS Chemical Biology, 9(10):2412-2420.

[0229] In some embodiments, the RNA aptamer comprises the nucleotide sequence of AGCUUAUCCAUUGCAUCUCGGAUGAGCU (SEQ ID NO: 93). The RNA aptamer is named U1hp and binds to the spliceosomal protein U1A as described in Katsamba et al. (2001) J Biol Chem. 276(24):21476-81.

[0230] In some embodiments, the RNA aptamer comprises an S1m aptamer, or a derivative or fragment thereof. In some embodiments, the S1m aptamer used according to the present disclosure is an aptamer described in Bachler et al. (1999) RNA 5(11):1509-1516; Srisawat and Engelke (2001) RNA 7(4):632-641; or Li and Altman. (2002) Nuc. Acids Res. [Nucleic Acids Research] 30(17):3706-3711. In some embodiments, the RNA aptamer comprises a nucleotide sequence of SEQ ID NO:65 or SEQ ID NO:66. In some embodiments, the RNA aptamer is encoded by a nucleotide sequence of SEQ ID NO:52 or SEQ ID NO:53.

[0231] In some embodiments, the RNA aptamer comprises an Sm aptamer.

[0232] In some embodiments, the RNA aptamer is about 30-200 nucleotides in length. In some embodiments, the RNA aptamer is about 50-200 nucleotides in length. In some embodiments, the RNA aptamer is about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 105, about 110, about 115, about 120, about 125, about 130, about 135, about 140, about 145, about 150, about 155, about 160, about 165, about 170, about 175, about 180, about 185, about 190, about 195, or about 200 nucleotides in length.

[0233] In some embodiments, an aptamer (e.g., an RNA aptamer) is not a histone stem loop. As used herein, the term "histone stem loop" refers to a stem loop RNA structure typically found in a histone-encoded mRNA. The histone stem loop is combined with a stem loop binding protein (SLBP) and is used to regulate histone expression during the cell cycle. The histone stem loop is further described in detail in Lopez et al., (RNA.14 (1): 1-10.2008) and WO 2013120498.

[0234] In some embodiments, the aptamer (e.g., RNA aptamer) is not an internal ribosome entry site (IRES). In some embodiments, the aptamer (e.g., RNA aptamer) does not bind to a ribosome or protein that regulates protein translation. In some embodiments, the aptamer (e.g., RNA aptamer) does not bind to protein eIF4G. In some embodiments, the aptamer (e.g., RNA aptamer) is capable of binding to a specific target (e.g., protein) immobilized on a surface (e.g., a protein immobilized on a surface, such as a cross-linked agarose or cross-linked dextran). A. Fitting position

[0235] RNA aptamers are disclosed herein, including aptamers at multiple positions relative to other elements present in a linear precursor RNA or subsequent circRNA. The position selection of RNA aptamers on a circRNA or linear precursor RNA can be evaluated relative to both the magnitude of regulation of translation and the basal expression level.

[0236] In some embodiments, the RNA aptamer in the circRNA is located: a) before the 3' exon element, b) between the 3' exon element and the 5' internal homology arm, c) between the 5' internal homology arm and the 5' spacer sequence, d) between the 5' spacer sequence and the IRES, e) between the protein coding region and the 3' spacer sequence, f) between the 3' spacer sequence and the 3' internal homology arm, g) between the 3' internal homology arm and the 5' exon element, h) after the 5' exon element, j) between the 3' exon and the IRES, and / or i) between the IRES and the 5' exon element.

[0237] In some embodiments, the RNA aptamer in the circRNA is located: a) before the 3' exon element, b) between the 3' exon element and the 5' internal homology arm, c) between the 5' internal homology arm and the 5' spacer sequence, d) between the 5' spacer sequence and the protein coding region, e) between the IRES and the 3' spacer sequence, f) between the 3' spacer sequence and the 3' internal homology arm, g) between the 3' internal homology arm and the 5' exon element, h) after the 5' exon element, i) between the 3' exon and the protein coding region, and / or j) between the protein coding region and the 5' exon element.

[0238] In some embodiments, the RNA aptamer in the linear precursor RNA is located: a) before the 5' external homology arm, b) between the 5' external homology arm and the 3' self-splicing PIE segment, c) between the 3' self-splicing PIE segment and the 5' internal homology arm, d) between the 5' internal homology arm and the 5' spacer sequence, e) between the 5' spacer sequence and the IRES, f) after the protein coding region, but before the 3' spacer sequence, g) between the 3' spacer sequence and the 3' internal homology arm, h) between the 3' internal homology arm and the 5' self-splicing PIE segment, i) between the 5' self-splicing PIE segment and the 3' external homology arm, and / or j) after the 3' external homology arm.

[0239] In some embodiments, the RNA aptamer in the linear precursor RNA is located: a) before the 5' external homology arm, b) between the 5' external homology arm and the 3' self-splicing PIE fragment, c) between the 3' self-splicing PIE fragment and the 5' internal homology arm, d) between the 5' internal homology arm and the 5' spacer sequence, e) between the 5' spacer sequence and the protein coding region, f) after the IRES, but before the 3' spacer sequence, g) between the 3' spacer sequence and the 3' internal homology arm, h) between the 3' internal homology arm and the 5' self-splicing PIE fragment, i) between the 5' self-splicing PIE fragment and the 3' external homology arm, and / or j) after the 3' external homology arm.

[0240] In some embodiments, the RNA aptamer need not bind directly to the circRNA or linear precursor RNA. In some embodiments, the RNA aptamer is attached to a linker. See, e.g., Elenko et al., (2009) J Am Chem Soc [Journal of the American Chemical Society] 131(29): 9866-9867.

[0241] In some embodiments, RNA aptamers can be removed from circRNA or linear precursor RNA after affinity purification. This can be achieved, for example, using DNA oligonucleotides hybridized to RNA aptamers or RNA scaffolds. The resulting duplex can then be cleaved with an enzyme (e.g., RNase H). See, for example, Batey RT. (2014). Curr Opin Struct Biol. [Contemporary Structural Biology Perspectives] 26: 1–8. B. Aptamer copy number

[0242] Increasing the number of aptamer copies can allow the aptamers to form larger three-dimensional structures (ie, enhancing the number of available affinity ligand binding sites or generating unique ligand binding sites). Strategic arrangement of aptamer copies can allow for increased affinity for cognate affinity ligands.

[0243] In some embodiments, the circRNA or linear precursor RNA used in the disclosed methods and compositions comprises multiple copies of an aptamer. Previous reports have shown that the use of a single small molecule binding aptamer in the 5'-UTR can achieve 8-fold translational inhibition upon ligand addition, but the use of three aptamers results in 37-fold inhibition. Kotter et al., (2009). Nucleic Acids Res. [Nucleic Acids Research] 37(18): e120. In some embodiments, the number of copies of the aptamer introduced into the circRNA or linear precursor RNA is one, two, three, four, five, six, seven, eight, nine, ten or more.

[0244] In some embodiments, the RNA aptamer comprises multiple copies of the aptamer sequence. In some embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO:65.

[0245] In some embodiments, the copies of the aptamer are in a repeating tandem configuration. The 4XS1m aptamer disclosed herein is an example of a multi-copy aptamer in a repeating tandem configuration. IV. RNA Scaffold

[0246] In some embodiments, the circular RNA and linear RNA precursor compositions disclosed herein include RNA aptamers embedded in RNA scaffolds. As used herein, the term "RNA scaffold" refers to a non-coding RNA molecule that can be assembled into a predefined structure, and the predefined structure produces a spatial framework to organize, protect or enhance the characteristics of a functional module of interest. Exemplary functional modules can be nucleic acids (e.g., aptamers) or proteins. In some embodiments, RNA scaffolds suitable for use according to the present disclosure can be associated with RNA without destroying the RNA structure. In addition, suitable RNA scaffolds allow the embedding of RNA aptamers without destroying the RNA structure. In some embodiments, the RNA scaffold used according to the present disclosure can be any RNA scaffold that has no significant negative impact on RNA expression or translation.

[0247] The predefined structure of the RNA scaffold contains RNA-specific sequence motifs for self-assembly, such as base pairing between hairpin stems (kissing loops) and / or chemical modifications, Myhrvold and Silver (2015) Nat Struct Mol Bio [Natural Structure and Molecular Biology] 22(1):8-10. RNA-specific sequence motifs can form secondary (i.e., two-dimensional) and / or tertiary (i.e., three-dimensional) structures. In some embodiments, the RNA scaffold comprises at least one secondary structural motif. In some embodiments, the RNA scaffold comprises at least one tertiary structural motif. Common secondary and / or tertiary RNA structural motifs include open and stacked three-way junctions, four-way junctions, four-way junctions similar to Holliday structures, stem loops (i.e., hairpin loops), internal loops (i.e., internal loops), bulges, four loops, multi-branched loops, pseudoknots and knots, 90° kinks, and pseudo-torsion angles. Shanna et al., (2021) Molecules [Molecules] 26(5):1422.

[0248] RNA scaffolds can be derived from nature (e.g., attenuators, tRNAs, riboswitches, terminators) or artificially engineered to form secondary or tertiary RNA structures. Delebecque et al., (2012) Nat Protoc [Natural Protocol] 7 (10): 1797-1807. Typically, in order to retain the predefined structure of the RNA scaffold, the RNA loop (e.g., hairpin loop) of the RNA scaffold is the target region for embedding the functional module of interest. See, for example, US 20050282190 A1. However, the predefined structure of the RNA scaffold can be modified to have additional desired properties. For example, the predefined RNA scaffold structure can be modified to resist one or both of exonuclease digestion and endonuclease digestion.

[0249] In some embodiments, the circular RNA or linear precursor RNA composition disclosed herein comprises an RNA aptamer embedded in a transfer RNA (tRNA). The transfer RNA (tRNA) scaffold is an attractive labeling candidate in an affinity purification system because the tRNA folds into a canonical, stable clover-leaf structure that resists unfolding and can protect RNA fusion from nuclease degradation. It has been shown that embedding an aptamer in the anticodon loop of the tRNA scaffold promotes proper folding. See generally Ponchon and Dardel (2007) Nat. Methods [Natural Methods] 4 (7): 571-576; Ponchon et al., (2013) Nucleic Acids Res. [Nucleic Acids Research] 41: e150. It has been shown that the use of RNA aptamers embedded in tRNA scaffolds successfully reduced transcription-specific RNA binding proteins from cell lysates. Iioka H et al., (2011) Nuc. Acids Res. [Nucleic Acids Research] 39 (8): e53.

[0250] In some embodiments, the circRNA or linear precursor RNA composition disclosed herein comprises an RNA aptamer embedded in a tRNA comprising the nucleotide sequence of SEQ ID NO:67.

[0251] In some embodiments, the RNA aptamer is embedded in the tRNA hairpin loop of the tRNA. In some embodiments, the RNA aptamer is embedded in the tRNA anticodon loop. In some embodiments, the RNA aptamer is embedded in the tRNA D loop. In some embodiments, the RNA aptamer is embedded in the tRNA T loop.

[0252] Other exemplary RNA scaffolds include ribosomal RNA (rRNA) and ribozymes. In some embodiments, the RNA aptamer is embedded in the ribosomal RNA. In some embodiments, the RNA aptamer is embedded in the ribozyme. In some embodiments, the ribozyme is catalytically inactive. V. Affinity Purification of RNA

[0253] In one aspect, disclosed herein are methods for purifying circular RNA samples.

[0254] In some embodiments, the disclosed methods for purifying circular RNA comprise the following steps: (a) contacting a sample comprising the circular RNA disclosed herein with an affinity ligand immobilized on a chromatography resin, wherein the RNA aptamer comprises a binding affinity for the affinity ligand; (b) eluting the circular RNA from the chromatography resin; and (c) purifying the circular RNA from the sample.

[0255] In some embodiments, the disclosed methods for purifying a linear precursor RNA comprise the following steps: (a) contacting a sample comprising the linear precursor RNA disclosed herein with an affinity ligand immobilized on a chromatography resin, wherein the RNA aptamer comprises a binding affinity for the affinity ligand; (b) eluting the linear precursor RNA from the chromatography resin; and (c) purifying the linear precursor RNA from the sample.

[0256] In some embodiments, the disclosed methods include one or more washing steps between the contacting step (a) and the eluting step (b).

[0257] In some embodiments, the disclosed method for purifying circular RNA comprises the following steps: (a) contacting a sample comprising the circular RNA with an affinity ligand immobilized on a chromatography resin; (b) eluting the circular RNA from the chromatography resin; and (c) isolating the circular RNA from the sample, wherein the circular RNA comprises a protein coding region and at least one RNA aptamer, wherein the RNA aptamer comprises a binding affinity for the affinity ligand.

[0258] In some embodiments, the disclosed method for purifying a linear precursor RNA comprises the following steps: (a) contacting a sample comprising the linear precursor RNA with an affinity ligand immobilized on a chromatographic resin; (b) eluting the linear precursor RNA from the chromatographic resin; and (c) isolating the linear precursor RNA from the sample, wherein the linear precursor RNA comprises a protein coding region and at least one RNA aptamer, wherein the RNA aptamer comprises a binding affinity for the affinity ligand.

[0259] In some embodiments, the disclosed methods render the circular RNA or linear precursor RNA greater than or equal to 90% pure. In some embodiments, the disclosed methods render the circular RNA and nicked circular RNA greater than or equal to 90% pure.

[0260] Affinity chromatography is a purification method that can be used with the circRNA or linear precursor RNA compositions and methods disclosed herein. The RNA aptamers disclosed herein include binding affinity for the selected affinity ligand. The selected affinity ligand is fixed (e.g., cross-linked) on a chromatographic resin. Therefore, the circRNA or linear precursor RNA containing RNA aptamers is bound to the resin containing the affinity ligand. The chromatographic resin material is preferably present in a column, wherein the sample containing RNA is loaded on the top of the column, and the eluent is collected at the bottom of the column.

[0261] The chromatographic resin can be any material known to be used as a stationary phase in a chromatographic method. The type of molecule used as an affinity ligand that interacts with the RNA aptamers disclosed herein can be of various types. Non-exhaustive examples of affinity ligands are antibodies, proteins, oligonucleotides, dyes, borate groups, or chelated metal ions. The stationary phase can be composed of organic and / or inorganic materials.

[0262] The most widely used stationary phase materials are hydrophilic carbohydrates, such as cross-linked agarose and synthetic copolymer materials. These materials can include derivatives of cellulose, polystyrene, synthetic polyamino acids, synthetic polyacrylamide gels or glass surfaces. Further examples of materials that can be used as chromatographic resins are polystyrene divinyl benzene, silica gel, silica gel modified with non-polar residues or other materials suitable for gel chromatography or other chromatographic methods, such as dextran, cross-linked dextran, agarose, dextran / agarose mixtures and other materials known in the art.

[0263] The chromatography resin can be functionalized with an affinity ligand that has binding affinity for the RNA aptamer. In some embodiments, the resin can be an agarose medium or a membrane functionalized with phenyl groups (e.g., Phenyl Sepharose from GE Healthcare). TM or phenyl membranes from Sartorius), Tosoh hexyl, Capto phenyl, phenyl Sepharose with low or high substitution TM 6Fast Flow, Phenyl Sepharose TM HighPerformance, Sinki Sepharose TM High Performance (GE Healthcare); Fractogel TM EMD Propyl or Fractogel TM EMD Phenyl (E.Merck, Germany); Macro-Prep TM Methyl or Macro-Prep TM Tert-Butyl column (Bio-Rad, CA); WP HI-Propyl (C3) TM (JT Baker, New Jersey) or Toyopearl TMether, phenyl or butyl (TosoHaas, Pennsylvania). ToyoScreen PPG, ToyoScreen Phenyl, ToyoScreen Butyl and ToyoScreen Hexyl are based on rigid methacrylic polymer beads. GE HiScreen Butyl FF and HiScreen Octyl FF are based on high flow agarose based beads. Preferred are Toyopearl Ether-650M, Toyopearl Phenyl-650M, Toyopearl Butyl-650M, Toyopearl Hexyl-650C (TosoHaas, Pennsylvania), POROS-OH (ThermoFisher) or methacrylate based monolithic columns such as CIM-OH, CIM-SO3, CIM-C4 A and CIM C4 HDL, which contain OH, sulfate or butyl ligands, respectively (BIA separation).

[0264] In some embodiments, the chromatography resin comprises protein A as an affinity ligand. Exemplary protein A resins include Byzen Pro Protein A resin (MilliporeSigma; 18887), Dynabeads Protein A magnetic beads (Thermo Fisher Scientific; 10001D), Pierce Protein A Agarose (Thermo Fisher Scientific; 20334), Pierce Protein A / GPlus Agarose (Thermo Fisher Scientific; 20423), Pierce Protein A Plus UltraLink (Thermo Fisher Scientific; 53142), Pierce Recombinant Protein A Agarose (Thermo Fisher Scientific), POROS MabCapture A Select (Thermo Fisher Scientific).

[0265] In some embodiments, the chromatographic resin comprises streptavidin as an affinity ligand. Exemplary streptavidin resins include streptavidin-agarose from Streptomyces avidinii (Millipore Sigma; S1638), Pierce Streptavidin Plus UltaLink resin (Thermo Fisher Scientific; 53117), Pierce High Capacity Streptavidin Agarose (Thermo Fisher Scientific; 20357), Streptavidin 6HC Agarose Resin (Abbott Laboratories (ABT); STV6HC-5), Streptavidin Resin-Amintra (Abcam; ab270530).

[0266] In some embodiments, the chromatographic resin comprises glutathione (GSH) as an affinity ligand. Exemplary GSH resins include glutathione resin (GenScript; L00206), Pierce glutathione agarose (Thermo Fisher Scientific; 16102BID), glutathione Sepharose 4B GST-labeled protein resin 9Cytiva; 17075605); glutathione affinity resin-Amintra (Abcam; ab270237). VI. Vector

[0267] In one aspect, disclosed herein are vectors comprising the linear precursor RNA disclosed herein. Nucleic acid sequences encoding proteins of interest (e.g., protein coding regions encoding therapeutic polypeptides) can be cloned into many types of vectors. For example, nucleic acids can be cloned into vectors including, but not limited to, plasmids, phagemids, phage derivatives, animal viruses, and cosmids. Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, sequencing vectors, and vectors optimized for in vitro transcription.

[0268] In one embodiment, the vector is used to express a linear precursor RNA in a host cell. In another embodiment, the vector is used as a template for IVT. The construction of optimally translated IVT RNA suitable for therapeutic use is disclosed in detail in Sahin et al. (2014). Nat. Rev. Drug Discov. [Nature Review: Drug Discovery] 13, 759-780; Weissman (2015). Expert Rev. Vaccines [Vaccine Expert Review] 14, 265-281.

[0269] In some embodiments, the vector disclosed herein comprises, from 5' to 3', the following: a) a 5' external homology arm, b) a 5' self-splicing PIE fragment, c) a 5' internal homology arm, d) a 5' spacer sequence, e) an internal ribosome entry site (IRES), f) a protein coding region, g) a 3' spacer sequence, h) a 3' internal homology arm, i) a 3' self-splicing PIE fragment, and j) a 3' external homology arm, wherein an RNA aptamer is present at one or both of the 5' end or the 3' end of any one of elements a)-j).

[0270] In some embodiments, the vector disclosed herein further comprises a polynucleotide sequence 5'UTR, a polynucleotide sequence 3'UTR, a polynucleotide sequence encoding a poly A sequence and / or a polyadenylation signal.

[0271] A variety of RNA polymerase promoters are known in the art. In one embodiment, the promoter is a T7 RNA polymerase promoter. Other useful promoters include, but are not limited to, T3 and SP6 RNA polymerase promoters. The consensus nucleotide sequences for T7, T3, and SP6 promoters are known in the art.

[0272] Also disclosed herein are host cells (eg, mammalian cells, eg, human cells) comprising a vector or RNA composition disclosed herein.

[0273] The polynucleotides can be introduced into the target cells using any of a variety of different methods, e.g., commercially available methods including, but not limited to, electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany), (ECM 830 (BTX) (Harvard Instruments, Boston, Mass.) or Gene Pulser II (BioRad, Denver, Colo.), Multiporator (Eppendort, Hamburg, Germany), cationic liposome-mediated transfection using lipofection, polymer encapsulation, peptide-mediated transfection, biolistic particle delivery systems (e.g., "gene guns") (see, e.g., Nishikawa et al. (2001). Hum Gene Ther. [Human Gene Therapy] 12(8):861-70 or TransIT-RNA transfection kit (Mirus, Madison, Wisconsin)).

[0274] Chemical means for introducing polynucleotides into host cells include colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems (including oil-in-water emulsions, micelles, mixed micelles, and liposomes). An exemplary colloidal system for use as an in vitro and in vivo delivery vehicle is a liposome (e.g., an artificial membrane vesicle).

[0275] Regardless of the method used to introduce exogenous nucleic acid into a host cell or otherwise expose the cell to an inhibitor of the present invention, a variety of assays can be performed to confirm the presence of circRNA or linear precursor RNA sequences in the host cell. Such assays are well known to those skilled in the art. VII. Pharmaceutical Compositions

[0276] RNA purified according to the present invention can be used as a component in a pharmaceutical composition, for example, for use as a vaccine. These compositions will typically include RNA and a pharmaceutically acceptable carrier. The pharmaceutical composition of the present invention may also include one or more additional components, such as small molecule immunopotentiators (e.g., TLR agonists). The pharmaceutical composition of the present invention may also include a delivery system for RNA, such as liposomes, oil-in-water emulsions or microparticles. In certain embodiments, the pharmaceutical composition includes lipid nanoparticles (LNP). In one embodiment, the composition includes nucleic acid molecules encoding antigens encapsulated in LNP. In certain embodiments, LNP includes at least one cationic lipid. In certain embodiments, LNP includes cationic lipids, polyethylene glycol (PEG) conjugated (PEGylated) lipids, cholesterol-based lipids and auxiliary lipids.

[0277] In order to better understand the present invention, the following examples are described. These examples are only for illustrative purposes and are not to be construed as limiting the scope of the present invention in any way. Examples

[0278] The foregoing description of the particular embodiments will disclose the general nature of the present disclosure so fully that others can easily modify and / or adjust such particular embodiments for a variety of applications by applying knowledge within the technical scope of the art without undue experimentation and without departing from the overall concept of the present disclosure. Therefore, based on the teachings and guidance given herein, such adjustments and modifications are intended to be included in the meaning and range of equivalents of the disclosed embodiments. It should be understood that the terms or terms herein are for the purpose of description rather than limitation, and therefore the terms or terms of this specification will be interpreted by those skilled in the art based on the teachings and guidance. Example 1: Design of aptamer-tagged circular RNA

[0279] Previous studies have demonstrated that aptamer-tagged mRNA can be used for purification of linear RNA species. See WO2023031856A1, which is incorporated herein by reference in its entirety.

[0280] As described herein, the following examples disclose the design of aptamer-tagged circular RNA (circRNA) or aptamer-tagged linear precursor RNA for the production of circRNA.

[0281] The work described below uses S1m aptamer or tRNA-S1m aptamer, each of which is capable of binding to streptavidin. The DNA nucleotide sequences encoding S1m aptamer and tRNA-S1m aptamer are shown below. The sequences of the S1m aptamer and tRNA-S1m aptamer present in the circular RNA and / or linear precursor RNA are as follows:

[0282] Figure 1 Schematic diagram of an experiment depicting aptamer-tagged linear precursors or aptamer-tagged circRNAs tested in streptavidin Sepharose bead affinity purification. The left panel shows the orientation of the aptamer-tagged linear precursor RNA relative to the flanking Anabaena PIE sequence. The Anabaena PIE sequence reacts under group I intron splicing conditions to synthesize the aptamer-tagged circRNA. The right panel shows that the presence of intact aptamers in the linear precursor RNA or circRNA species enables binding to the affinity matrix during purification.

[0283] DNA plasmids were designed to initially obtain linear precursor RNA and subsequent circRNA.

[0284] Figure 2A A plasmid map encoding the 4xS1m aptamer, linear precursor RNA, and Anabaena PIE sequence for RNA circularization is depicted. The plasmid elements are arranged in the following 5' to 3' order: T7 promoter, 5' external homology arm, 3' Anabaena intron / exon fragment, 5' internal homology arm, 5' poly AC spacer, CVB3 IRES, protein coding region, 3' poly AC spacer, 4xS1m aptamer, 3' internal homology arm, 5' Anabaena intron / exon fragment, and 3' external homology arm.

[0285] Figure 2B A plasmid map encoding the tRNA-S1m aptamer, linear precursor RNA, and Anabaena PIE sequence for RNA circularization is depicted. The plasmid elements are arranged in the following 5' to 3' order: T7 promoter, 5' external homology arm, 3' Anabaena intron / exon fragment, 5' internal homology arm, 5' poly-AC spacer, CVB3 IRES, protein coding region, 3' poly-AC spacer, 3' internal homology arm, 5' Anabaena intron / exon fragment, 3' external homology arm, and tRNA-S1m aptamer.

[0286] Figure 2C A control plasmid map encoding a linear precursor RNA and a PIE sequence for RNA circularization but not encoding an aptamer is depicted. The plasmid elements are arranged in the following 5' to 3' order: T7 promoter, 5' external homology arm, 3' Anabaena intron / exon fragment, 5' internal homology arm, 5' poly AC spacer, CVB3 IRES, protein coding region, 3' poly AC spacer, 3' internal homology arm, 5' Anabaena intron / exon fragment, and 3' external homology arm.

[0287] Figure 2A-2CEach construct described in is driven by the T7 promoter, and each plasmid contains a HindIII restriction site.

[0288] Subsequent examples tested the production and functionality of aptamer-tagged circRNA constructs in streptavidin Sepharose bead affinity purification. Example 2: Generation of aptamer-tagged circRNA from aptamer-tagged linear precursor RNA

[0289] Linear precursor RNA was synthesized by linearizing the plasmid described in Example 1 using restriction endonuclease HindIII to obtain cDNA template for IVT template. The linearized template DNA was loaded into the IVT reaction of the experimental group (4xS1m aptamer-labeled and tRNAxS1m aptamer-labeled linear precursor RNA) and the control group, using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) according to the manufacturer's instructions.

[0290] After the IVT reaction, the sample was treated with DNase I (NEB) for 15 min. After DNase treatment, circRNA was generated from linear precursor RNA by adding 2 mM GTP to the IVT product and incubating at 55° C. for 15 min (i.e., cyclization conditions). RNA samples were then purified using LiCl precipitation and resuspended in 100 μl DEPC H2O.

[0291] After the circularization conditions, three RNA species are expected to appear in each sample: (1) aptamer-tagged circRNA, (2) residual aptamer-tagged linear precursor RNA that was not successfully circularized, and (3) nicked aptamer-tagged circRNA. As previously reported, nicked aptamer-tagged circRNA may be mediated by magnesium-catalyzed autohydrolysis, which reduces the yield of circRNA and is a defect that needs further optimization and improvement. Wesselhoeft et al., (2018), Nat Commun., 9(1):2629; Wesselhoeft et al., (2019), Mol Cell., 74(3):508-520; Li and Breaker, (1999), J. Am. Chem. Soc. 121(23):5364-5372. Example 3: Streptavidin Sepharose Bead Affinity Purification and CircRNA Quantification

[0292] Samples subjected to the circularization conditions of Example 2 were tested using the Sepharose bead affinity purification strategy and RNA recovery was quantified.

[0293] The following steps disclose the method for preparing samples and the binding conditions involved: (1) Preparation of streptavidin Sepharose beads. To remove the bead storage solution, 20 μL of streptavidin Sepharose beads (per sample) were spun at 0.8×g for 1 minute at 4° C. Subsequently, the beads were resuspended in 20 μL of binding buffer and incubated on ice for 15 minutes. (2) Preparation of samples containing RNA aptamer-tagged circRNAs and incubation conditions. 2.5 μg of each sample was resuspended in 10 μL of binding buffer. Refolding was performed to allow the aptamer to have the expected secondary structure by heating at 56° C. for 5 min, 37° C. for 10 min, and incubation at room temperature for 5 minutes. Take 2 μL of sample, then bind it to Sepharose beads, and use it as a control for input concentration. 10 μL of refolded aptamer (2.5 μg) was added to Sepharose beads, incubated, and rotated at 4° C. for 2 hours. The beads were washed twice with 100 μL of binding buffer. (3) Elution of RNA aptamers from beads. Elution was performed with 250 μL of phenol-based reagent as follows: 50 μL of cold chloroform was added to the sample and shaken vigorously for 10 seconds. The sample was then spun at 12,000 x g for 15 minutes at 4°C. The top aqueous phase containing RNA (approximately 125 μL) was directly transferred to a Monarch cleanup column and followed the manufacturer's instructions, and finally eluted from the Monarch column in 40 μL of DEPC H2O. (4) Quantification of RNA recovery. The RNA concentration after streptavidin affinity purification was quantified on a spectrophotometer (nanodrop). The eluted fraction, unbound fraction, and wash fraction were electrophoresed on a 2% EX agarose gel on an E-Gel Power Snap electrophoresis system to visualize the RNA species present in each fraction (aptamer-tagged circRNA, aptamer-tagged linear precursor RNA, and nicked RNA). As Figure 3 As shown, the molecular weight of putative circRNAs is higher than that of heavier linear precursor RNAs.

[0294] like Figure 3 As shown, 4xS1m and tRNA-S1m aptamer-tagged circRNAs were successfully affinity purified with streptavidin Sepharose beads relative to the no-aptamer control sample (see lanes 3-5 containing eluted samples) and the unbound fraction (compare lanes 3-5 with lanes 6-11). As predicted in Example 2, Figure 3 It was also shown that the circularization conditions produced three distinct RNA species (labeled "circular," "precursor," and "nicked" on the agarose gel), indicating that the aptamer does not interfere with the circularization of the linear precursor RNA.

[0295] The amount of RNA recovered from each sample after streptavidin-Sepharose bead affinity purification was also quantified. The results are shown in Figure 4 In the bar graph, an additional aptamer-tagged linear precursor RNA control is also shown. Relative to the input control sample, affinity purified 4xS1m aptamer-tagged circRNA produced approximately 50% RNA recovery, while tRNAxS1m-tagged circRNA produced approximately 60% RNA recovery. In contrast, the affinity purified control produced approximately less than 5% RNA recovery. This result suggests that introducing an aptamer tag into a circRNA (e.g., 4xS1m or tRNAxS1m aptamer tag) can potentially be used to improve the affinity purification efficiency of circRNA. Example 4: Negative selection protocol for recovery of circRNA

[0296] In Examples 1-3, the aptamer-containing constructs were designed to be present in both the linear precursor RNA and the aptamer-tagged circRNA (see Figure 1 ). However, for optimal purification of aptamer-tagged circRNAs, removal of linear precursor RNAs is necessary. Therefore, linear precursor RNAs were designed to develop negative selection strategies for affinity purification, such as Figure 6 shown.

[0297] Under negative selection, Figure 6 As shown, the aptamer is located in the linear precursor RNA at a position that will be removed after cyclization (i.e., the circRNA will not contain the aptamer). In this configuration, the linear precursor RNA binds to the affinity matrix, but the circRNA does not bind to the affinity matrix.

[0298] Several linear precursor RNAs were designed, and the aptamers were located in the 3' intron region. After IVT and circularization, the circularization reaction mixture was incubated with streptavidin Sepharose beads as described above. The unbound fraction, wash fraction, and elution fraction were collected. 4xS1m aptamer-labeled linear precursor RNA (pML49), tRNA-S1m (tS1m) aptamer-labeled linear precursor RNA (pML50 and pML51), no aptamer control (pML47), 4xS1m aptamer-labeled circRNA (pML26), and tRNA-S1m aptamer-labeled circRNA (pML38) were purified. The amount of recovered RNA measured is expressed as a percentage of the input (i.e., the input is the total RNA in the sample). As Figure 7As shown, the negative selection constructs (pML49, pML50, pML51) showed binding intermediate between the no-aptamer control (pML47) and the circRNAs with aptamer design (pML26 and pML38), indicating that the RNA fractions in the unbound fractions and wash fractions of the negative selection constructs were the desired circRNAs.

[0299] These results were further analyzed by taking agarose gel images of the different samples. Figure 8A-8D As shown, circRNA and nicked RNA species were mainly present in the unbound and wash fractions, whereas linear precursor RNA was present in the eluted fraction of the negative selection construct. Figure 9A-9C Capillary electrophoresis assays were also performed to identify the various RNA species as shown.

[0300] The position of the aptamer in the linear precursor was tested. The tS1m aptamer was placed at the 3' end of the linear precursor RNA (pML123), the 5' end of the linear precursor RNA (pML128), and both the 5' and 3' ends of the linear precursor RNA (pML125). Each linear precursor RNA contained an ORF encoding human erythropoietin (EPO), a gene containing more than 500 nucleotides. Figure 12A-12B As shown, the position or number of tS1m aptamers on the linear precursor did not negatively affect the purification of the circRNA. A summary of the purification of the pML125 construct is provided in Table 1 below. Fig. 12A When one of the introns in the PCR contains an aptamer, these introns are derived from homologous regions that co-purify with the catalytic intron.

[0301] Table 1 - Summary of purification Example 5: Positive selection scheme for recycling circRNA

[0302] In Examples 1-3, the aptamer-containing constructs were designed to be present in both the linear precursor RNA and the aptamer-tagged circRNA (see Figure 1 ). However, for optimal purification of aptamer-tagged circRNAs, removal of linear precursor RNAs is necessary. Therefore, linear precursor RNAs were designed to develop positive selection strategies for affinity purification, such as Figure 5 shown.

[0303] Under positive selection, Figure 5As shown, the linear precursor RNA will be constructed to contain a split aptamer, wherein the 3' and 5' halves of the aptamer will be located at the 5' and 3' flanking ends of the linear precursor RNA, respectively. The linear precursor RNA will not be affinity purified because the complete aptamer is required for binding to the affinity matrix. After the linear precursor RNA is cyclized, the complete aptamer will be formed, thereby allowing the linear precursor RNA to bind to the affinity matrix.

[0304] A cDNA template will be generated and IVT will be used to generate a linear precursor RNA construct. The construct will vary the type of aptamer and its spatial configuration in the linear precursor RNA (see Figure 5 Table 2 shows a list of potential aptamer orientations for tRNA-S1m and 4xS1m aptamers in linear precursor RNA. After completing the cyclization conditions, the constructs were affinity purified using streptavidin Sepharose beads and quantified as described in Example 3. Each construct will be evaluated based on RNA recovery relative to the input control sample. Example 6: Scale-up of circRNA purification

[0305] The total input of linear precursor was scaled up to determine whether the aptamer purification strategy could robustly purify circRNA. First, the template pML50 was modified by replacing the T7 RNA polymerase promoter with the SP6 promoter. An IVT reaction was performed to generate the linear precursor, and the circularization reaction was performed with an initial 1 mg amount of RNA. Fig.10 As shown, 1 mg scale circularization followed by streptavidin purification yielded highly pure circRNA in both the unbound and wash fractions. After the 1 mg scale purification, a larger 12 mg scale purification was attempted. In this assay, 3 rounds of purification were performed to increase the purity. Fig.11A As shown in Figure 2, even if the starting amount of RNA is high, circRNA can be effectively purified regardless of whether it is purified through 1, 2, or 3 rounds. Fig. 11B As shown, multiple rounds of purification produced circRNAs of higher purity. Example 7: Purification of large circRNA

[0306] The circRNA purification strategy described above was attempted with circRNAs encoding relatively small proteins (GFP and EPO). To test the efficacy of the aptamer purification strategy for large circRNAs, six different circRNAs were generated with ORF sizes of 1032, 1035, 1725, 1728, 2172, and 2175 nucleotides. The full lengths of the six circRNAs were 1952, 2645, and 3092 nucleotides. Fig.13As shown, six different constructs were purified by the negative selection purification protocol, where one or more aptamers were included in the linear precursor but lost during the circularization reaction. The data indicate that large circRNAs were purified efficiently. Example 8: Activity of circRNA containing aptamers

[0307] Next, the circRNA was tested to ensure that the encoded protein was expressed. The pML50 circRNA encoding GFP was used and purified via a negative selection protocol, where the linear precursor RNA (but not the circRNA) contained the aptamer. The circRNA encoding GFP was transfected into Hela cells at different μg of RNA / million cells. Fig.14 As shown, both purified and unpurified circRNAs showed GFP expression relative to the negative control, while purified circRNAs showed higher expression relative to unpurified circRNAs.

[0308] Other embodiments of the disclosure will be apparent to those skilled in the art from consideration of the specification and practice disclosed herein. The specification and examples are intended to be considered exemplary only, with the true scope and spirit of the disclosure being indicated by the following claims.

[0309] All patents and publications cited herein are incorporated by reference in their entirety. sequence Table 2. Nucleotide sequences encoding linear precursor RNA Table 3. DNA sequences encoding linear RNA precursors and circular RNA elements Table 4. RNA sequences of linear RNA precursors and circular RNA elements

Claims

1. A circular RNA comprising a protein coding region and at least one RNA aptamer.

2. The circular RNA of claim 1, wherein the at least one RNA aptamer is bound to an affinity ligand.

3. The circular RNA as claimed in claim 2, wherein the affinity ligand comprises protein A, protein G, streptavidin, glutathione, dextran, a fluorescent molecule or 6xHis.

4. The circular RNA of claim 2 or 3, wherein the affinity ligand comprises streptavidin.

5. The circular RNA of any one of claims 2 to 4, wherein the affinity ligand is immobilized on a chromatography resin. 6 . The circular RNA according to claim 1 , wherein the RNA aptamer is S1m, Sm, or a derivative or fragment thereof.

7. The circular RNA of any one of claims 1-6, wherein the circular RNA comprises one to four RNA aptamers.

8. The circular RNA of any one of claims 1-7, wherein the RNA aptamers are identical.

9. The circular RNA of any one of claims 1-7, wherein at least one of the RNA aptamers is different.

10. The circular RNA of any one of claims 1-9, wherein the RNA aptamer is synthetically derived.

11. The circular RNA of any one of claims 1 to 9, wherein the RNA aptamer is a split aptamer or an X-aptamer.

12. The circular RNA of any one of claims 1 to 9, wherein the RNA aptamer is naturally derived.

13. The circular RNA of any one of claims 1-12, wherein the RNA aptamer is derived from a hairpin RNA, a tRNA, or a riboswitch.

14. The circular RNA of any one of claims 1 to 12, wherein the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 65 or 66.

15. The circular RNA of any one of claims 1-14, wherein the RNA aptamer has a length of about 30-200 nucleotides.

16. The circular RNA of any one of claims 1-15, wherein the RNA aptamer has a length of about 50-200 nucleotides.

17. The circular RNA of any one of claims 1-16, wherein the RNA aptamer is not a histone stem-loop.

18. The circular RNA of any one of claims 1 to 17, wherein the RNA aptamer does not bind to eIF4G.

19. The circular RNA of any one of claims 1-18, wherein the RNA aptamer is embedded in an RNA scaffold.

20. The circular RNA of claim 19, wherein the RNA scaffold comprises at least one secondary structural motif.

21. The circular RNA of claim 20, wherein the secondary structure motif is a tetraloop, a pseudoknot or a stem-loop.

22. The circular RNA of any one of claims 19-21, wherein the RNA scaffold comprises at least one tertiary structure.

23. The circular RNA of claim 22, wherein the secondary structural motif and / or the tertiary structure is nuclease-resistant.

24. The circular RNA of any one of claims 19-23, wherein the RNA scaffold comprises a transfer RNA (tRNA).

25. The circular RNA of claim 24, wherein the RNA aptamer is embedded in the tRNA hairpin loop of the tRNA.

26. The circular RNA of claim 24, wherein the RNA aptamer is embedded in the tRNA anticodon loop of the tRNA.

27. The circular RNA of claim 24, wherein the RNA aptamer is embedded in the tRNA D-loop of the tRNA.

28. The circular RNA of claim 24, wherein the tRNA into which the RNA aptamer is embedded comprises the nucleotide sequence of SEQ ID NO:

67.

29. The circular RNA of any one of claims 1-28, wherein an internal ribosome entry site (IRES) is located at the 5' end of the protein coding region.

30. The circular RNA of any one of claims 1-28, wherein IRES is located at the 3' end of the protein coding region.

31. The circular RNA of any one of claims 1-30, wherein the IRES is derived from coxsackievirus B3 (CVB3), encephalomyocarditis virus (EMCV), a dicistrovirus, hepatitis C virus (HCV), poliovirus (PV), enterovirus 71 (EV71), human rhinovirus (HRV), foot-and-mouth disease virus (FMDV), or a synthetic IRES.

32. The circular RNA of any one of claims 1-31, wherein the IRES comprises the polynucleotide sequence of SEQ ID NO:

75.

33. The circular RNA of any one of claims 1-32, wherein the protein coding region encodes at least one polypeptide or peptide.

34. The circular RNA of claim 33, wherein the polypeptide is a biologically active polypeptide, a therapeutic polypeptide or an antigenic polypeptide.

35. The circular RNA of any one of claims 1-34, wherein the circular RNA comprises at least one 5' internal homology arm and at least one 3' internal homology arm.

36. The circular RNA of claim 35, wherein the 5' internal homology arm has a length of about 5 to about 50 nucleotides.

37. The circular RNA of claim 35 or 36, wherein the 5' internal homology arm comprises the nucleotide sequence of SEQ ID NO:

70.

38. The circular RNA of any one of claims 35-37, wherein the 3' internal homology arm has a length of about 5 to about 50 nucleotides.

39. The circular RNA of any one of claims 35-38, wherein the 3' internal homology arm comprises the nucleotide sequence of SEQ ID NO:

71.

40. The circular RNA of any one of claims 1-39, wherein the circular RNA comprises at least one 3' exonic element.

41. The circular RNA of claim 40, wherein the 3' exonic element comprises the nucleotide sequence of SEQ ID NO:

81.

42. The circular RNA of any one of claims 1-41, wherein the circular RNA comprises at least one 5' exonic element.

43. The circular RNA of claim 42, wherein the 5' exonic element comprises the nucleotide sequence of SEQ ID NO:

83.

44. The circular RNA of any one of claims 1-43, wherein the circular RNA comprises at least one spacer sequence.

45. The circular RNA of claim 44, wherein the spacer sequence has a length of about 5 to about 75 nucleotides.

46. ​​The circular RNA of claim 44 or 45, wherein the spacer sequence comprises the nucleotide sequence of SEQ ID NO: 78 or 79.

47. The circular RNA of any one of claims 44-46, wherein the spacer sequence is located at one or both of the 5' end and the 3' end of any of the following elements: the protein coding region, the IRES, the 5' internal homology arm, the 3' internal homology arm, the 5' exon element, and the 3' exon element.

48. The circular RNA of any one of claims 44-47, wherein the circular RNA comprises the following elements from 5' to 3': a) the 3' exon element, b) the 5' internal homology arm, c) the spacer sequence, d) the IRES, e) the protein coding region, f) the spacer sequence, g) the 3' internal homology arm, and h) the 5' exon element.

49. The circular RNA of any one of claims 44-47, wherein the circular RNA comprises the following elements from 5' to 3': a) the 3' exon element, b) the 5' internal homology arm, c) the spacer sequence, d) the protein coding region, e) the IRES, f) the spacer sequence, g) the 3' internal homology arm, and h) the 5' exon element.

50. The circular RNA of claim 48 or 49, wherein the at least one RNA aptamer is located at the 5' end or the 3' end of any one of elements a)-h).

51. The circular RNA of any one of claims 1-50, wherein the circular RNA contains at least one 5' untranslated region (5'UTR), at least one 3' untranslated region (3'UTR) and / or at least one polyadenylation (poly A) sequence.

52. The circular RNA of claim 51, wherein the 5'UTR, the 3'UTR and / or the poly A sequence is a spacer sequence.

53. The circular RNA of any one of claims 44-52, wherein the at least one RNA aptamer is located: a) before the 3' exon element, b) between the 3' exon element and the 5' internal homology arm, c) between the 5' internal homology arm and the 5' spacer sequence, d) between the 5' spacer sequence and the IRES, e) between the protein coding region and the 3' spacer sequence, f) between the 3' spacer sequence and the 3' internal homology arm, g) between the 3' internal homology arm and the 5' exon element, h) after the 5' exon element, i) between the 3' exon and the IRES, and / or j) between the IRES and the 5' exon element.

54. The circular RNA of any one of claims 44-52, wherein the at least one RNA aptamer is located: a) before the 3' exon element, b) between the 3' exon element and the 5' internal homology arm, c) between the 5' internal homology arm and the 5' spacer sequence, d) between the 5' spacer sequence and the protein coding region, e) between the IRES and the 3' spacer sequence, f) between the 3' spacer sequence and the 3' internal homology arm, g) between the 3' internal homology arm and the 5' exon element, h) after the 5' exon element, i) between the 3' exon and the protein coding region, and / or j) between the protein coding region and the 5' exon element.

55. The circular RNA of any one of claims 1-54, wherein the circular RNA comprises at least one chemical modification.

56. The circular RNA of claim 55, wherein the chemical modification is pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thiol-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, 2'-O-methyluridine or N6-methyladenosine.

57. The circular RNA of claim 55, wherein the chemical modification is pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, N6-methyladenosine, or a combination thereof.

58. The circular RNA of claim 55, wherein the chemical modification is N1-methylpseudouridine.

59. A linear precursor RNA comprising at least a self-splicing ribozyme and a protein coding region, wherein the linear precursor RNA comprises at least one RNA aptamer.

60. The linear precursor RNA of claim 59, wherein the at least one RNA aptamer is bound to an affinity ligand.

61. The linear precursor RNA of claim 60, wherein the affinity ligand comprises protein A, protein G, streptavidin, glutathione, dextran, a fluorescent molecule or 6xHis.

62. The linear precursor RNA of claim 60 or 61, wherein the affinity ligand comprises streptavidin.

63. The linear precursor RNA of any one of claims 60-62, wherein the affinity ligand is immobilized on a chromatography resin.

64. The linear precursor RNA of any one of claims 59-63, wherein the RNA aptamer is S1m, Sm, or a derivative or fragment thereof.

65. The linear precursor RNA of any one of claims 59-64, wherein the circular RNA comprises one to four RNA aptamers.

66. The linear precursor RNA of any one of claims 59-65, wherein the RNA aptamers are identical.

67. The linear precursor RNA of any one of claims 59-65, wherein at least one of the RNA aptamers is different.

68. The linear precursor RNA of any one of claims 59-67, wherein the RNA aptamer is synthetically derived.

69. The linear precursor RNA of any one of claims 59-67, wherein the RNA aptamer is a split aptamer or an X-aptamer.

70. The linear precursor RNA of any one of claims 59-67, wherein the RNA aptamer is naturally derived.

71. The linear precursor RNA of any one of claims 59-70, wherein the RNA aptamer is derived from a hairpin RNA, a tRNA, or a riboswitch.

72. The linear precursor RNA of any one of claims 59-71, wherein the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 65 or 66.

73. The linear precursor RNA of any one of claims 59-72, wherein the RNA aptamer is about 30-200 nucleotides in length.

74. The linear precursor RNA of any one of claims 59-73, wherein the RNA aptamer is about 50-200 nucleotides in length.

75. The linear precursor RNA of any one of claims 59-74, wherein the RNA aptamer is not a histone stem-loop.

76. The linear precursor RNA of any one of claims 59-75, wherein the RNA aptamer does not bind to eIF4G.

77. The linear precursor RNA of any one of claims 59-76, wherein the RNA aptamer is embedded in an RNA scaffold.

78. The linear precursor RNA of claim 77, wherein the RNA scaffold comprises at least one secondary structural motif.

79. The linear precursor RNA of claim 78, wherein the secondary structural motif is a tetraloop, a pseudoknot or a stem-loop.

80. The linear precursor RNA of any one of claims 77-79, wherein the RNA scaffold comprises at least one tertiary structure.

81. The linear precursor RNA of claim 80, wherein the secondary structural motif and / or tertiary structure is nuclease-resistant.

82. The linear precursor RNA of any one of claims 77-81, wherein the RNA scaffold comprises a transfer RNA (tRNA).

83. The linear precursor RNA of claim 82, wherein the RNA aptamer is embedded in the tRNA hairpin loop of the tRNA.

84. The linear precursor RNA of claim 82, wherein the RNA aptamer is embedded in the tRNA anticodon loop of the tRNA.

85. The linear precursor RNA of claim 82, wherein the RNA aptamer is embedded in the tRNA D-loop of the tRNA.

86. The linear precursor RNA of claim 82, wherein the tRNA having an embedded RNA aptamer comprises the nucleotide sequence of SEQ ID NO:

67.

87. The linear precursor RNA of any one of claims 59-86, wherein the self-splicing ribozyme comprises at least two catalytic subunits.

88. The linear precursor RNA of claim 87, wherein the catalytic subunit of the self-splicing ribozyme is derived from a group I intron or group II intron RNA transcript or a fragment thereof.

89. The linear precursor RNA of claim 87 or 88, wherein the catalytic subunit of the self-splicing ribozyme is derived from a replaced intron-exon (PIE) sequence from the cyanobacterium Anabaena pre-tRNA-Leu gene, the T4 bacteriophage Td gene, or the Tetrahymena pre-rRNA.

90. A linear precursor RNA as described in any one of claims 87-89, wherein the catalytic activity of the two subunits produces a circularized RNA.

91. The linear precursor RNA of any one of claims 59-90, wherein the linear precursor RNA comprises the following elements from 5' to 3': a) a 5' external homology arm, b) a 3' self-splicing PIE fragment, c) a 5' internal homology arm, d) a 5' spacer sequence, e) an internal ribosome entry site (IRES), f) a protein coding region, g) a 3' spacer sequence, h) a 3' internal homology arm, i) a 5' self-splicing PIE fragment, and j) a 3' external homology arm, wherein the RNA aptamer is present at one or both of the 5' end or the 3' end of any one of elements a)-j).

92. The linear precursor RNA of any one of claims 59-90, wherein the linear precursor RNA comprises the following elements from 5' to 3': a) a 5' external homology arm, b) a 3' self-splicing PIE fragment, c) a 5' internal homology arm, d) a 5' spacer sequence, e) a protein coding region, f) an IRES, g) a 3' spacer sequence, h) a 3' internal homology arm, i) a 5' self-splicing PIE fragment, and j) a 3' external homology arm, wherein the RNA aptamer is present at one or both of the 5' end or the 3' end of any one of elements a)-j).

93. The linear precursor RNA of claim 91 or 92, wherein the 5' outer homology arm and the 3' outer homology arm are each independently about 5 to about 50 nucleotides in length.

94. The linear precursor RNA of any one of claims 91-93, wherein the 5' outer homology arm and the 3' outer homology arm comprise the nucleotide sequence of SEQ ID NO: 69 or SEQ ID NO:

72.

95. The linear precursor RNA of any one of claims 91-94, wherein the 5' self-splicing PIE fragment comprises the nucleotide sequence of SEQ ID NO:

74.

96. The linear precursor RNA of any one of claims 91-95, wherein the 5' internal homology arm has a length of about 5 to about 50 nucleotides.

97. The linear precursor RNA of any one of claims 91-96, wherein the 5' internal homology arm comprises the nucleotide sequence of SEQ ID NO:

70.

98. The linear precursor RNA of any one of claims 91-97, wherein the length of the 5' spacer and the 3' spacer is each independently about 5 to 75 nucleotides.

99. The linear precursor RNA of any one of claims 91-98, wherein the 5' spacer and the 3' spacer comprise the nucleotide sequence of SEQ ID NO:78 or SEQ ID NO:

79.

100. The linear precursor RNA of any one of claims 91-99, wherein the 3' self-splicing PIE fragment comprises the nucleotide sequence of SEQ ID NO:

73.

101. The linear precursor RNA of any one of claims 91-100, wherein the IRES is derived from Coxsackievirus B3 (CVB3), encephalomyocarditis virus (EMCV), a dicistrovirus, hepatitis C virus (HCV), poliovirus (PV), enterovirus 71 (EV71), human rhinovirus (HRV), foot-and-mouth disease virus (FMDV), or a synthetic IRES.

102. The linear precursor RNA of any one of claims 91-101, wherein the IRES comprises the nucleotide sequence of SEQ ID NO:

75.

103. The linear precursor RNA of any one of claims 59-101, wherein the linear precursor RNA comprises at least one 5' untranslated region (5'UTR), at least one 3' untranslated region (3'UTR) and / or a polyadenylation (poly A) sequence.

104. The linear precursor RNA of any one of claims 59-103, wherein the protein coding region encodes at least one polypeptide.

105. The linear precursor RNA of claim 104, wherein the polypeptide is a biologically active polypeptide, a therapeutic polypeptide or an antigenic polypeptide.

106. The linear precursor RNA of any one of claims 59-103, wherein the RNA aptamer is a split aptamer comprising a 5' portion and a 3' portion.

107. The linear precursor RNA of claim 106, wherein the 5' portion of the split aptamer is located 3' to the 5' exonic element, and the 3' portion of the split aptamer is located 5' to the 3' exonic element.

108. The linear precursor RNA of claim 106 or 107, wherein the 5' portion of the split aptamer is located 3' to the 3' internal homology arm, and the 3' portion of the split aptamer is located 5' to the 5' internal homology arm.

109. The linear precursor RNA of any one of claims 106-108, wherein the cleaved aptamer is reformed into a functional aptamer after circularization of the linear precursor RNA.

110. The linear precursor RNA of any one of claims 91-109, wherein the at least one RNA adapter is located: a) before the 5' external homology arm, b) between the 5' external homology arm and the 3' self-splicing PIE fragment, c) between the 3' self-splicing PIE fragment and the 5' internal homology arm, d) between the 5' internal homology arm and the 5' spacer sequence, e) between the 5' spacer sequence and the IRES, f) after the protein coding region, but before the 3' spacer sequence, g) between the 3' spacer sequence and the 3' internal homology arm, h) between the 3' internal homology arm and the 5' self-splicing PIE fragment, i) between the 5' self-splicing PIE fragment and the 3' external homology arm, and / or j) after the 3' external homology arm.

111. The linear precursor RNA of any one of claims 91-109, wherein the at least one RNA adapter is located: a) before the 5' external homology arm, b) between the 5' external homology arm and the 3' self-splicing PIE fragment, c) between the 3' self-splicing PIE fragment and the 5' internal homology arm, d) between the 5' internal homology arm and the 5' spacer sequence, e) between the 5' spacer sequence and the protein coding region, f) after the IRES, but before the 3' spacer sequence, g) between the 3' spacer sequence and the 3' internal homology arm, h) between the 3' internal homology arm and the 5' self-splicing PIE fragment, i) between the 5' self-splicing PIE fragment and the 3' external homology arm, and / or j) after the 3' external homology arm.

112. The linear precursor RNA of any one of claims 91-109, wherein the linear precursor RNA comprises at least one chemical modification.

113. The linear precursor RNA of claim 112, wherein the chemical modification is pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thiol-1-methyl-1-deaza-pseudouridine, 2-thiol-1-methyl-pseudouridine, 2-thiol-5-aza-uridine, 2-thiol-dihydropseudouridine, 2-thiol-dihydrouridine, 2-thiol-pseudouridine, 4-methoxy-2-thiol-pseudouridine, 4-methoxy-pseudouridine, 4-thiol-1-methyl-pseudouridine, 4-thiol-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, 2'-O-methyluridine or N6-methyladenosine.

114. The linear precursor RNA of claim 112, wherein the chemical modification is pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, N6-methyladenosine, or a combination thereof.

115. The linear precursor RNA of claim 112, wherein the chemical modification is N1-methyl pseudouridine.

116. The linear precursor RNA of any one of claims 59-115, wherein the linear precursor RNA is synthesized using in vitro transcription (IVT).

117. A circular RNA comprising a protein coding region and at least one RNA aptamer, wherein the circular RNA is formed by the linear precursor RNA of any one of claims 59-116.

118. A circular RNA comprising a protein coding region, wherein the circular RNA is formed from the linear precursor RNA of any one of claims 59-116, and wherein the circular RNA lacks an RNA aptamer.

119. A nucleic acid encoding the linear precursor RNA of any one of claims 59-116.

120. A vector comprising the nucleic acid of claim 119.

121. A pharmaceutical composition comprising a circular RNA as described in any one of claims 1-58, 117 or 118, or a linear precursor RNA as described in any one of claims 59-116.

122. A method for producing circular RNA, the method comprising incubating a linear precursor RNA as described in any one of claims 59-116 under conditions that allow the linear precursor RNA to circularize.

123. The method of claim 122, wherein the linear precursor RNA is incubated with GTP and Mg2+.

124. The method of claim 122 or 123, wherein the linear precursor RNA is incubated with GTP and Mg2+ for a time sufficient to allow the linear precursor RNA to circularize.

125. The method of claim 123 or 124, wherein the GTP is present at a concentration of about 1 mM to about 15 mM.

126. The method of any one of claims 123-125, wherein the GTP is present at a concentration of about 2 mM.

127. The method of any one of claims 123-126, wherein the Mg2+ is present at a concentration of about 1 mM to about 50 mM.

128. The method of any one of claims 123-127, wherein the Mg2+ is present at a concentration of about 10 mM.

129. A method for producing a plurality of circular RNA molecules, the method comprising incubating a plurality of linear precursor RNA molecules under conditions that cause at least a portion of the linear precursor RNA molecules to circularize, wherein each linear precursor RNA molecule comprises the linear precursor RNA of any one of claims 59-116.

130. The method of claim 129, wherein at least about 30% of the linear precursor RNA molecules in the plurality are circularized.

131. A method for purifying circular RNA, the method comprising the steps of: (a) contacting a sample comprising the circular RNA of any one of claims 1 to 58 with an affinity ligand immobilized on a chromatography resin, wherein the RNA aptamer comprises a binding affinity for the affinity ligand; (b) eluting the circular RNA from the chromatography resin; and (c) purifying the circular RNA from the sample.

132. A method for purifying linear precursor RNA, the method comprising the steps of: (a) contacting a sample comprising the linear precursor RNA of any one of claims 59-116 with an affinity ligand immobilized on a chromatographic resin, wherein the RNA aptamer comprises a binding affinity for the affinity ligand; (b) eluting the linear precursor RNA from the chromatographic resin; and (c) purifying the linear precursor RNA from the sample.

133. The method of claim 131 or 132, comprising one or more washing steps between the contacting step (a) and the eluting step (b).

134. A method for purifying circular RNA, the method comprising the following steps: (a) contacting a sample comprising the circular RNA with an affinity ligand immobilized on a chromatography resin; (b) eluting the circular RNA from the chromatography resin; and (c) isolating the circular RNA from the sample, wherein the circular RNA comprises a protein coding region and at least one RNA aptamer, wherein the RNA aptamer comprises a binding affinity for the affinity ligand.

135. A method for purifying linear precursor RNA, the method comprising the following steps: (a) contacting a sample comprising the linear precursor RNA with an affinity ligand immobilized on a chromatographic resin; (b) eluting the linear precursor RNA from the chromatographic resin; and (c) isolating the linear precursor RNA from the sample, wherein the linear precursor RNA comprises a protein coding region and at least one RNA aptamer, wherein the RNA aptamer comprises a binding affinity for the affinity ligand.

136. A method for purifying circular RNA, the method comprising the following steps: (a) contacting a sample comprising a plurality of linear precursor RNA molecules and a plurality of circular RNA molecules with an affinity ligand immobilized on a chromatographic resin; and (b) isolating the circular RNA molecules from the sample, wherein the linear precursor RNA molecules comprise a protein coding region and at least one RNA aptamer, and wherein the RNA aptamer comprises binding affinity for the affinity ligand, and wherein the circular RNA molecules lack the RNA aptamer.

137. The method of claim 136, wherein the circular RNA molecules do not bind to the affinity ligand.

138. The method of any one of claims 131-137, wherein the circular RNA or linear precursor RNA is greater than or equal to 90% pure.

139. A method of treating or preventing a disease or disorder, the method comprising administering the pharmaceutical composition of claim 121 to a subject in need thereof.

140. A pharmaceutical composition comprising a plurality of circular RNA molecules, wherein at least about 90% of the circular RNAs comprise a protein coding region and at least one RNA aptamer.

Images