Chicken infectious laryngotracheitis subunit vaccine and application thereof

Abstract

The invention provides a chicken infectious laryngotracheitis subunit vaccine and application thereof, and belongs to the technical field of vaccine preparation. The chicken infectious laryngotracheitis subunit vaccine provided by the invention is prepared from chicken infectious laryngotracheitis virus gB-A463P protein coded by a gB-A463P gene of which the 463th alanine of an optimized chicken infectious laryngotracheitis gB gene is further mutated into proline, and the amino acid sequence of the gB-A463P protein is shown as SEQ ID NO: 5. The subunit vaccine is prepared by adopting a genetic engineering means, only contains part of antigens of the ILTV and does not contain genetic materials, so that the risks of toxin expelling and toxin dispersing do not exist, and the safety can be effectively improved.

Description

Technical Field

[0001] The invention belongs to the technical field of vaccine preparation, and in particular relates to an infectious laryngotracheitis subunit vaccine and application thereof. Background Art

[0002] Infectious laryngotracheitis (ILT) is an acute contact respiratory infectious disease of chickens caused by infectious laryngotracheitis virus (ILTV). The clinical manifestations include mild or persistent runny nose, swelling around the eyelids, tearing, increased secretions and other conjunctivitis symptoms and coughing and other tracheitis symptoms. In severe cases, the infected chickens will cough up bloody exudates, causing respiratory obstruction, breathing difficulties and even suffocation and death.

[0003] At present, the main means of preventing and controlling ILT infection is vaccination. Vaccines mainly use attenuated vaccines. However, attenuated vaccines can lead to enhanced virulence or reversion after host passage, causing reinfection and disease, and adverse symptoms such as eye inflammation and decreased egg production in laying hens appear after clinical vaccination, and the safety needs to be improved. Based on the use of attenuated vaccines and existing deficiencies, some vaccine viruses and wild viruses on the market have undergone recombinant mutations, resulting in the inability of current vaccines to prevent and control epidemic strains. Genetically engineered subunit vaccines only contain some antigens of ILTV, do not contain genetic material, and do not have the risk of detoxification and spread of toxins. They are safe. Therefore, there is an urgent need to develop safe and efficient new vaccines to achieve the purpose of preventing and treating ILT. Summary of the invention

[0004] The invention provides an avian infectious laryngotracheitis subunit vaccine and use thereof. The subunit vaccine is prepared by means of genetic engineering, contains only partial antigens of ILTV and contains no genetic material, so there is no risk of detoxification or toxin dispersion, and safety can be effectively improved.

[0005] In order to achieve the above-mentioned object, the present invention provides an infectious laryngotracheitis subunit vaccine for avian influenza, which is prepared by using the infectious laryngotracheitis virus gB-A463P protein encoded by the gB-A463P gene of the optimized infectious laryngotracheitis gB gene, in which the alanine at position 463 is further mutated to proline, and the amino acid sequence of the gB-A463P protein is shown in SEQ ID NO:5.

[0006] Preferably, the nucleotide sequence of the gB-A463P gene is as shown in SEQ ID NO:6.

[0007] Preferably, the nucleotide sequence of the optimized infectious laryngotracheitis gB gene is shown as SEQ ID NO:4, and the amino acid sequence of the protein encoded thereby is shown as SEQ ID NO:3.

[0008] Preferably, it is prepared by the following steps:

[0009] A recombinant plasmid expressing the gB-A463P gene was constructed based on the optimized infectious laryngotracheitis gB gene;

[0010] The recombinant plasmid is used to transfect CHO-K1 cells, culture, screen, amplify and purify positive monoclonal cells, and then acclimate to obtain CHO-gB-A463P cells, thereby constructing a gB-A463P protein expressing a recombinant infectious laryngotracheitis virus;

[0011] An adjuvant is added to the recombinant infectious laryngotracheitis virus gB-A463P protein to obtain an infectious laryngotracheitis subunit vaccine.

[0012] Preferably, the obtained CHO-gB-A463P cells are classified and named as Chinese Hamster Ovary cells CHO-gB-A463P (Chinese Hamster 0vary), and were deposited in the China Center for Type Culture Collection on October 30, 2024, located at Wuhan University, Wuhan, China, with the deposit number CCTCC NO: C2024303.

[0013] Preferably, the adjuvants are white oil and S-Ben-80.

[0014] Preferably, the content of gB-A463P protein in the infectious laryngotracheitis subunit vaccine is as high as 1178 μg / ml.

[0015] The present invention also provides a use of the infectious laryngotracheitis subunit vaccine according to any of the above technical solutions in the protection against infection by an isolated strain of infectious laryngotracheitis virus, characterized in that the isolated strain is YBFILTV1 strain, classified and named: Infectious Laryngotracheitis virus YBFILTVI (Infectious Laryngotracheitis virus), and was deposited in the China Center for Type Culture Collection on October 30, 2024, at Wuhan University, Wuhan, China, with a collection number of CCTCC NO: V202481.

[0016] As a preferred method, the virus content of the isolated strain YBFILTV1 strain during each attack and protection is 10 4.2 EID50.

[0017] Preferably, the amount of gB-A463P protein in the infectious laryngotracheitis subunit vaccine for each attack and protection is not less than 12 μg / bird.

[0018] The present invention also provides a biological identification kit, which at least contains the infectious laryngotracheitis virus gB-A463P protein described in the above scheme, whose amino acid sequence is shown in SEQ ID NO:5, to distinguish animals infected with wild virus and animals infected with the isolated strain YBFILTV1 described in the above scheme.

[0019] Compared with the prior art, the advantages and positive effects of the present invention are:

[0020] 1. The chicken infectious laryngotracheitis subunit vaccine provided by the present invention is prepared by further mutating the 463rd alanine near the main domain to proline on the basis of the optimized chicken infectious laryngotracheitis gB gene, and encoding the chicken infectious laryngotracheitis virus gB-A463P protein obtained by the gB-A463P gene. The above mutation stabilizes the spatial conformation of gB and has good stability and antigenicity. From the analysis of protein expression, the protein expression of the present invention is as high as 1178 μg / ml, and the dilution 11.8 times can still protect the test chickens from attacking the virus, which greatly reduces the production cost.

[0021] 2. The subunit vaccine (gB-A463P subunit vaccine) provided by the present invention has the best protection effect for the attack of isolated strains, while the gD subunit vaccine of the traditional Wanggang strain can only partially protect the prevalent strains. From the results of animal experiments, it can be seen that the gB-A463P subunit vaccine developed by the inventor can still produce higher antibodies after being stored for two months, indicating that the spatial conformation of the protein is stable, while the antibody of the unmutated amino acid decreases in 2 months, indicating that the optimized gB-A463P spatial epitope is not only immunogenic but also stable and easy to store. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 A diagram of DNA fragments recovered by enzyme digestion in the double enzyme digestion system provided in an embodiment of the present invention, wherein M: 250bp, 500bp, 750bp, 1000bp, 2000bp, 3000bp, 5000bp, 8000bp from top to bottom; Lane 1: pUC57-gB-NOPT recombinant plasmid digestion; Lane 2: pUC57-gB recombinant plasmid digestion; Lane 3: pUC57-gB-A463P recombinant plasmid digestion;

[0023] Figure 2This is a PCR diagram for identifying the recombinant plasmid provided in an embodiment of the present invention, wherein M: 250bp, 500bp, 750bp, 1000bp, 2000bp, 3000bp, 5000bp, 8000bp from top to bottom; Lane 1: pUC57-gB-NOPT recombinant plasmid PCR; Lane 2: pUC57-gB recombinant plasmid PCR; Lane 3: pUC57-gB-A463P recombinant plasmid PCR;

[0024] Figure 3 SDS-PAGE diagram of gB-NOPT, gB, and gB-A463P genes expressed in CHO cells provided in an embodiment of the present invention, wherein M: 15KDa, 25KDa, 35KDa, 40KDa, 55KDa, 70KDa, 100KDa, 130KDa, 180KDa from bottom to top; Lane 1: gB-NOPT supernatant; Lane 2: gB supernatant; Lane 3: gB-A463P supernatant; Lane 4: negative control supernatant;

[0025] Figure 4 The western blot diagram of the specific binding of the optimized gB and gB-A463P provided in the embodiment of the present invention to the positive serum of avian infectious laryngotracheitis virus, wherein M: 15KDa, 25KDa, 35KDa, 40KDa, 55KDa, 70KDa, 100KDa, 130KDa, 180KDa from bottom to top; Lane 1: negative control; Lane 2: gB supernatant; Lane 3: gB-A463P supernatant. DETAILED DESCRIPTION

[0026] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0027] Example 1 Amplification and sequence analysis of infectious laryngotracheitis gB gene

[0028] In 2024, typical symptoms of infectious laryngotracheitis appeared in a chicken flock that had been injected with the existing avian infectious laryngotracheitis vaccine in a chicken farm. The larynx and trachea of ​​the diseased chickens were collected and added with an appropriate amount of sterilized PBS (0.01mol / L, pH7.0-7.2) for grinding. After repeated freezing and thawing for 3 times, the supernatant was centrifuged at 4000r / min for 15min. After filtering the supernatant with a 0.22μm filter, it was inoculated with 5 10-11-day-old SPF chicken embryos through the chorioallantoic membrane, 0.2ml per embryo, and incubated at 36-37℃. Chicken embryos that died within 96 hours were discarded, and the allantoic fluid and chorioallantoic membrane of the chicken embryos were collected after culturing for 120 hours. The collected chorioallantoic membrane and allantoic fluid were mixed and ground at a ratio of 1:1, and the mixture was filtered after repeated freezing and thawing for 3 times. After dilution, SPF chicken embryos were inoculated in the same way for blind propagation for 1 generation. Chicken embryos that died within 96 hours were discarded, and the lesions were observed after culturing for 120 hours (the chorioallantoic membrane was obviously thickened and had grayish-white spots). The virus liquid was processed according to the above method and named YBFILTV1 strain (isolated strain), classified and named: Avian infectious bronchitis virus YBFILTVI, and was deposited in the China Center for Type Culture Collection on October 30, 2024, with the deposit number of CCTCC NO: V202481.

[0029] 1.1 Amplification of gB of infectious laryngotracheitis

[0030] Primers were designed and synthesized based on the gB gene sequence published in NCBI. The sequence information of the primers is as follows:

[0031] gB1: 5'-ATGCAATCCTACATCGCCGTGAA-3';

[0032] gB2: 5'-TTATTCGTCTTCGCTCTTCTG-3'.

[0033] The nucleic acid of the virus liquid was extracted and used as a template. The primers gB1 and gB2 were used to amplify the target fragment by PCR. The nucleotide sequence of gB was SEQ ID NO: 1, and the amino acid sequence was deduced to be SEQ ID NO: 2 based on the sequencing results.

[0034] Comparison analysis was performed with the gB protein of the Wanggang strain (JX458823.1) of chicken infectious laryngotracheitis virus published in NCBI, and the result was: gB amino acid homology was about 99%, and multiple sites had mutations, including the 40th (I became N), the 41st (I became N), the 57th (S became P), the 360th (N became R), the 421st (Y became K), the 496th (R became K), the 538th (I became S), the 551st (V became M), the 578th (A became I), the 587th (D became A), the 641st (E became I), the 707th (S became F), and the 755th (G became V). From the analysis of the gB protein sequence, the gB gene of the isolated strain had undergone multiple amino acid mutations and mutations, which means that the isolated strain is a new epidemic strain.

[0035] Example 2 Optimization of the infectious laryngotracheitis gB gene

[0036] The gene antigenic sites of the structural protein gB of the YBFILTV1 strain were analyzed; the transmembrane region and non-essential regions of the gB gene were removed, and codon optimization was performed at the same time. The optimized amino acid sequence was SEQ ID NO: 3 and the nucleotide sequence was SEQ ID NO: 4. In order to stabilize the spatial epitope of the protein, the alanine at position 463 near the main structural domain of gB was mutated to proline on the basis of SEQ ID NO: 3, and its amino acid sequence was SEQ ID NO: 5 and the nucleotide sequence was SEQ ID NO: 6. The optimized gene was synthesized by Shanghai Shenggong Biotechnology Co., Ltd. and connected to the pUC57 plasmid.

[0037] Example 3 Construction of recombinant plasmid expressing gB gene

[0038] 3.1 Construction of 14.4-gBNOPT, 14.4-gB, and 14.4-gBA463P recombinant plasmids

[0039] 3.1.1 Enzyme digestion reaction

[0040] 3.1.1.1 Mark the 1.5mL EP tubes to be used, add samples and mix them according to the following table. The reaction system is 50μL, and the sample addition is as shown in the following table:

[0041]

[0042]

[0043] 3.1.1.2 Place the 1.5 mL EP tube in step 3.1.1.1 in a 37°C constant temperature water bath for 2-3 hours.

[0044] 3.1.2 Gel recovery of double enzyme digestion products

[0045] Take out the double enzyme digestion system, perform agarose gel electrophoresis, and recover the DNA fragments ( Figure 1 ).

[0046] (1) Label the sample collection EP tube, adsorption column, and collection tube.

[0047] (2) Weigh the marked empty EP tube and record the value.

[0048] (3) Carefully cut the single target DNA band from the agarose gel using a scalpel on a gel cutter and place it into a clean 1.5 mL centrifuge tube.

[0049] (4) Add 600 μL PC buffer to the 1.5 mL centrifuge tube in step (3) and place in a 50°C water bath for about 5 min, during which time the centrifuge tube is gently inverted up and down to ensure that the gel is fully dissolved.

[0050] (5) Column equilibration: Add 500 μL of equilibration solution BL to the adsorption column CB2 (the adsorption column is pre-placed in the collection tube), centrifuge at 12,000 rpm for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0051] (6) Add the solution obtained in step (5) to the adsorption column CB2, let it stand for 2 minutes, centrifuge at 10,000 rpm for 30 seconds, pour out the waste liquid in the collection tube, and then place the adsorption column CB2 into the collection tube.

[0052] (7) Add 600 μL of PW buffer, a rinse solution, to the adsorption column, let it stand for 3 min, centrifuge at 10,000 rpm for 30 s, pour out the waste liquid in the collection tube, and place the adsorption column CB2 in the collection tube.

[0053] (8) Repeat step (7).

[0054] (9) Centrifuge the empty adsorption column at 12,000 rpm for 2 min to remove as much rinse solution as possible. Leave the adsorption column at room temperature for 10 min to dry thoroughly.

[0055] (10) Place the adsorption column CB2 in a collection tube, and drop 50 μL of elution buffer (preheated at 65 °C) into the middle of the adsorption membrane. Let stand for 3 min, and centrifuge at 12,000 rpm for 2 min.

[0056] (11) Take out the centrifuge tube in step (10) from the centrifuge, discard the adsorption column CB2 in the middle, cover the centrifuge tube with a lid, and retain the DNA sample in the centrifuge tube.

[0057] (12) Store the DNA sample in step 11 at 4°C and prepare agarose gel electrophoresis to identify the recovered DNA fragments.

[0058] 3.1.3 Ligation reaction

[0059] (1) Label the 0.2 mL centrifuge tubes you will use.

[0060] (2) Add 20 μL of the reaction system in the following table to a well-labeled 0.2 mL tube:

[0061] Sample ingredient name Volume (μL) <![CDATA[dd H2O]]> Refill to 20 10X buffer 2 Linearized vector pEE14.4 50~200ng Insert DNA fragment (gBNOPT, gB, gBA463P) 20~200ng T4 DNA Ligase 1

[0062] (3) After adding the sample, gently pipette several times to mix the components.

[0063] (4) Place the 0.2 mL centrifuge tube at 37°C for 30 min. After the reaction is complete, immediately place the tube in an ice water bath to cool for 5 min.

[0064] (5) The reaction product of step (4) can be directly used for transformation experiments, or it can be stored at -20°C and thawed and transformed when needed.

[0065] 3.1.4 Conversion reaction

[0066] (1) Quickly add 10 μL of ligation reaction solution to 100 μL of competent cells, pipette to mix, and incubate on ice for 30 min.

[0067] (2) After step (1) is completed, remove the sample tube, place it in a 42°C water bath for 100 seconds, and then immediately place it in an ice bath for 2 minutes.

[0068] (3) After step (2) is completed, take out the sample tube, add 600 μL of liquid LB medium to the sample tube in an ultra-clean workbench, and then place the sample tube in a 37°C constant temperature shaker at 220 rpm for 1 h.

[0069] (4) Prepare transformation plates. Prepare LB resistance plates for transformation based on the resistance of the plasmid.

[0070] (5) Plate coating: Take out the sample tube in step (3), centrifuge at 8,000 rpm for 2 min at room temperature, remove 600 μL of supernatant, use the remaining supernatant to resuspend the bacteria at the bottom of the tube, place the resuspended bacterial solution in the center of the corresponding transformation plate, and use a bacterial spreading stick to evenly spread the bacterial solution in the center of the transformation plate.

[0071] (6) Place the plate prepared in step (5) upright in a biochemical constant temperature incubator and culture at 37°C for 1 hour. Then, invert the transformation plate and culture for 15 hours.

[0072] (7) Observe and record the transformation results.

[0073] 3.1.5 Plasmid extraction and PCR identification

[0074] 3.1.5.1 Plasmid extraction

[0075] (1) Use a 10 μL pipette tip to pick a single clone from the transformation plate and transfer it to 5 ml of LB liquid medium containing ampicillin resistance. Incubate the culture at 37°C, 220 rpm, and shake overnight.

[0076] (2) Pipette the bacterial solution into a 1.5 mL EP tube and centrifuge at room temperature, 12,000 rpm, for 2 min, and discard the supernatant.

[0077] (3) Add 250 μL of plasmid extraction reagent P1 buffer to the EP tube in step (2) to thoroughly suspend the bacteria.

[0078] (4) Add 250 μL of P2 buffer to the solution in step (3), and immediately gently invert the centrifuge tube 5-10 times to mix. Let stand at room temperature for 2-4 minutes.

[0079] (5) Add 350 μL of P3 buffer to the solution in step (4), and immediately gently invert the centrifuge tube 5-10 times to mix. Let stand at room temperature for 2-4 minutes.

[0080] (6) Centrifuge the solution from step (5) at room temperature, 14,000 rpm, for 10 min.

[0081] (7) Transfer the supernatant solution from step (6) to the center of the adsorption column, centrifuge at room temperature, 12,000 rpm, 30 s, and discard the liquid in the collection tube.

[0082] (8) Add 500 μL of buffer DW1 to the center of the adsorption column and centrifuge at room temperature, 12,000 rpm, for 30 s. Discard the liquid in the collection tube.

[0083] (9) Add 500 μL of eluent to the center of the adsorption column, centrifuge at room temperature, 12,000 rpm, 30 s, and discard the liquid in the collection tube. Repeat once.

[0084] (10) Empty adsorption column, centrifuge at room temperature, 12,000 rpm, 2 min.

[0085] (11) Place the adsorption column in a clean 1.5 ml centrifuge tube, add 30 μL of elution buffer to the center of the adsorption membrane, let stand at room temperature for 5 min, centrifuge at room temperature, 12,000 rpm, for 2 min, and store the DNA solution in the tube at 4°C.

[0086] 3.1.5.2 PCR identification

[0087] gB (gBA463P) upstream primer: TTCGAAATGCAAAGTTATATCGCAG

[0088] gB (gBA463P) downstream primer: AAGCTTTTAATGGTGATGGTGGTG

[0089] gBNOPT upstream primer: TTCGAAATGCAATCCTACATCGCCGTG

[0090] gBNOPT downstream primer: AAGCTTTATTCGTCTTCGCTCTCTTCT

[0091] (1) Label the PCR tubes to be used, add samples and mix according to the following table. The reaction system is 25 μL:

[0092] Sample ingredient name Volume (μL) <![CDATA[dd H2O]]> Replenish to 25 2X Mix 12.5 Upstream primer (10 μM) 0.5 Downstream primer (10 μM) 0.5 Extracted plasmid template 0.5

[0093] (2) PCR amplification procedure:

[0094]

[0095] (3) Sequencing: Sequencing of the plasmids that were positive for PCR identification ( Figure 2 ) was sent to a sequencing company for sequencing.

[0096] Example 4 Transfection of CHO-K1 cells

[0097] (1) Preparation: Sterilize in a biosafety cabinet with ultraviolet light for 30 min; preheat F-12 culture medium to 37°C in a 37°C water bath.

[0098] (2) Add 2.5 μg recombinant DNA and P3000 to 125 μl OPTI-MEM culture medium and mix well. Add 3.75 μl Lipotectamine 3000 to 125 μl OPTI-MEM culture medium and mix well. Mix the liposomes and recombinant DNA and let stand at room temperature for 10 minutes.

[0099] (3) Take out the 6-well plate cells plated 24 hours ago from the 37°C incubator, discard the supernatant culture medium, wash the cells three times with pre-warmed OPTI-MEM culture medium, and discard the OPTI-MEM culture medium.

[0100] (4) Add 2 ml of F-12 culture medium containing 10% fetal bovine serum and 1% double antibody to each cell well.

[0101] (5) Gently add the mixture of recombinant DNA and liposomes to each well of cells, gently mix, and culture in a cell culture incubator at 37°C, 5% CO2.

[0102] (6) 72 hours after transfection, the supernatant was collected for protein detection, and the cells were added with G418 for pressure screening.

[0103] (7) After 144 hours, the monoclonal cells were detected and the positive cells were amplified. The positive cells were digested and transferred from the 96-well plate to the 24-well plate, digested and transferred to the 6-well plate after 48 hours, digested and transferred to the small gram after 48 hours, and preserved, and the CHO-gB-A463P cells were successfully domesticated. The classification and naming of the obtained CHO-gB-A463P cells are: Chinese Hamster Ovary Cell CHO-gB-A463P, which was deposited in the China Center for Type Culture Collection on October 30, 2024, with the deposit number of CCTCC NO: C2024303.

[0104] Example 5: Constructing cell lines expressing the proteins shown in Table 1 according to the above example method

[0105] Table 1

[0106]

[0107] Example 6 Protein purification and detection

[0108] 6.1 Expression and identification of recombinant gB protein in CHO cells

[0109] The cells selected in Example 4 were continuously passaged and domesticated into suspension cells. The suspension cells were cultured at 37°C for 240 hours, and the supernatant was collected for SDS-PAGE protein analysis. The results showed that the gB-NOPT gene was not expressed in CHO cells, while the optimized gB and gB-A463P genes were expressed in CHO cells ( Figure 3 ).

[0110] 6.2 Protein content detection The total protein content of the harvested supernatant was measured using a Bradford protein detection kit, the protein purity was detected by SDS-PAGE, and the target protein content was calculated.

[0111] Table 2 Protein content detection information

[0112] Name of expressed protein Total protein content purity Target protein content B 1233μg / ml 90％ 1110μg / ml gB-A463P 1324μg / ml 89％ 1178μg / ml

[0113] 6.3 Chromatographic purification of recombinant gB protein

[0114] The collected supernatants of gB and gB-A463P were subjected to affinity chromatography using GE Ni Sepharose excel medium. The collected supernatants were centrifuged at 5000 rpm for 5 min and used as the loading solution.

[0115] 6.3.1 Wash the medium with 5 column volumes of distilled water.

[0116] 6.3.2 Wash the medium with 5 column volumes of equilibration buffer.

[0117] 6.3.3 Loading: 4 mg protein can be loaded per ml on the column.

[0118] 6.3.4 Wash the medium with 20 column volumes of wash buffer.

[0119] 6.3.5 Elute the protein with 5 column volumes of elution buffer.

[0120] 6.4 Western blot test

[0121] The protein prepared in 6.3 was subjected to SDS-PAGE, and the target protein band was transferred to the PVDF membrane using the semi-dry method at 20 volts for 30 minutes. The transfer membrane was blocked with blocking solution overnight, washed 3 times with PBST, and treated with 1:500 diluted chicken infectious laryngotracheitis virus positive serum at 37℃ for 1.5h, washed 3 times with PBST, and treated with 1:1000 diluted HRP-labeled goat anti-chicken enzyme-labeled antibody at 37℃ for 1.5h, washed 3 times with PBST, and treated with substrate solution for 5min. The color was developed in chemiDOC. The results showed that the optimized gB and gB-A463P could specifically bind to chicken infectious laryngotracheitis virus positive serum ( Figure 4 ), indicating that the expressed gB and gB-A463P proteins have good immunogenicity.

[0122] 6.5 Indirect immunofluorescence After the cells were fixed, transparent, and blocked, His-tagged monoclonal antibodies were added, incubated at 37°C for 2 hours, washed 3 times with PBS, and incubated at 37°C for 1 hour with green fluorescent secondary antibodies. The cells were observed using an inverted fluorescence microscope and photographed for preservation. The results showed that CHO cells transfected with the gB gene before optimization had no specific fluorescence, while CHO cells transfected with the optimized gB and gB-A463P had strong specific fluorescence, with gB-A463P being the brightest, followed by gB.

[0123] Example 7 Vaccine preparation, effect detection, and protein shelf life test

[0124] 1. Vaccine preparation

[0125] (1) Preparation of Oil Phase 95 parts of veterinary white oil and 1 part of aluminum stearate were placed in an oil phase preparation tank and heated to 80°C. Then 5 parts of Siben-80 were added and the temperature was maintained at 115°C for 30 minutes. The mixture was cooled and then used for later use.

[0126] (2) Preparation of aqueous phase The gD protein of patent application number 2023109250251, the gB purified in 4.3 above, and the gBA463P protein solution were mixed with sterile saline in appropriate proportions, so that the protein content in each 0.2 ml aqueous phase was not less than 20ug / ml. Take 5 parts of sterilized Tween-80, add it to the liquid preparation tank, add 95 parts of the mixed antigen solution at the same time, start the stirring motor and stir for 20 to 30 minutes to completely dissolve the Tween-80.

[0127] (3) Emulsification: Take 1.5 parts of the oil phase and put it in a high-speed shearing machine. Start the motor to slowly rotate and stir. At the same time, slowly add 1 part of the water phase and emulsify at 10,000 r / min for 5 minutes. After emulsification, take 10 ml and centrifuge at 3,000 r / min for 15 minutes. The water phase precipitated at the bottom of the tube should not exceed 0.5 ml.

[0128] 2. Vaccine efficacy test

[0129] The immunogenicity results of chickens were tested using 50 SPF chickens aged 21 to 35 days, which were randomly divided into 5 groups, with 10 chickens in each group. Group 1 received 0.3 ml of gB vaccine subcutaneously in the neck, Group 2 received 0.3 ml of gB-A463P vaccine subcutaneously in the neck (the dosage of gB-A463P protein for each chicken was 12 ug), Group 3 received 0.3 ml of gD vaccine subcutaneously in the neck, Group 4 received commercial fowlpox-gB vaccine, and Group 5 was not immunized as a control. 21 days after immunization, blood was collected from all chickens for antibody detection using the Dutch Infectious Laryngotracheitis Antibody Detection Kit, and at the same time, 0.2 ml of the YBFILTV1 strain of avian infectious laryngotracheitis virus (containing 10 μg of avian influenza virus) was injected into the larynx and trachea of ​​each chicken. 4.2 EID50), and the challenge was followed for 14 days. The results are shown in Table 3.

[0130] Table 3 Serum antibody titer and challenge protection results

[0131]

[0132] Note: Titer>1071 is positive.

[0133] From the data in Table 3, it can be seen that 9 / 10 of the antibodies in the gB subunit group were positive, 10 / 10 of the antibodies in the gB-A463P subunit group were positive, 10 / 10 of the antibodies in the gD subunit group were positive, and 6 / 10 of the antibodies in the commercial fowlpox-gB vaccine group were positive. After the challenge, all the controls became ill, 9 / 10 of the gB subunit group were protected, 10 / 10 of the gB-A463P subunit group were protected, 7 / 10 of the gD subunit group were protected, and only 4 / 10 of the commercial fowlpox-gB vaccine group were protected.

[0134] 3. Protein shelf life test

[0135] The semi-finished product stored for 2 months was used to prepare the vaccine according to the method in Example 7. 30 SPF chickens aged 21 to 35 days were randomly divided into 3 groups, with 10 chickens in each group. 0.3 ml of gB vaccine was subcutaneously administered to each chicken in the neck of the first group, 0.3 ml of gB-A463P vaccine was subcutaneously administered to each chicken in the neck of the second group, and the third group was not immunized as a control. 21 days after immunization, blood was collected from all chickens for antibody detection using the Dutch Baisen Infectious Laryngotracheitis Antibody Detection Kit, and at the same time, 0.2 ml (containing 10 4.2 EID50), and the challenge was followed for 14 days. The results are shown in Table 4.

[0136] Table 4 Serum antibody titer and challenge protection results

[0137]

[0138] Note: Titer>1071 is positive.

[0139] As shown in Table 4, 6 / 10 of the antibodies in the gB subunit group were positive, and 10 / 10 of the antibodies in the gB-A463P subunit group were positive. After the challenge, all the controls became ill, 7 / 10 of the gB subunit group were protected, and 10 / 10 of the gB-A463P subunit group were protected. This indicates that the optimized gB-A463P protein has good stability, while the protein gB is prone to reduced immunogenicity due to its unstable spatial conformation.

[0140] In summary, the gB-A463P subunit vaccine provided by the present invention has the best protection effect on the attack of the isolated strain (YBFILTV1 strain), while the gD subunit vaccine of the traditional Wanggang strain and the commercialized fowlpox-gB vaccine cannot provide complete protection against the epidemic strain. From the results of animal experiments, it can be seen that the gB-A463P subunit vaccine developed by the inventor can still produce higher antibodies after being stored for two months, indicating that the spatial conformation of the protein is stable, while the antibody of the unmutated amino acid decreases in 2 months, indicating that the optimized gB-A463P spatial epitope is not only immunogenic but also stable and easy to store.

Claims

1. A subunit vaccine for infectious laryngotracheitis, characterized in that: The gB-A463P protein of infectious laryngotracheitis virus of avian influenza virus is prepared by using the gB-A463P gene encoded by the optimized infectious laryngotracheitis gB gene, in which the alanine at position 463 is further mutated to proline. The amino acid sequence of the gB-A463P protein is shown in SEQ ID NO:

5.

2. The infectious laryngotracheitis subunit vaccine according to claim 1, characterized in that: The nucleotide sequence of the gB-A463P gene is shown in SEQ ID NO:

6.

3. The infectious laryngotracheitis subunit vaccine according to claim 1, characterized in that: The nucleotide sequence of the optimized infectious laryngotracheitis gB gene is shown in SEQ ID NO:4, and the amino acid sequence of the protein encoded thereby is shown in SEQ ID NO:

3.

4. The infectious laryngotracheitis subunit vaccine according to any one of claims 1 to 3, characterized in that Prepared by the following steps: A recombinant plasmid expressing the gB-A463P gene was constructed based on the optimized infectious laryngotracheitis gB gene; The recombinant plasmid is used to transfect CHO-K1 cells, culture, screen, amplify and purify positive monoclonal cells, and then acclimate to obtain CHO-gB-A463P cells, thereby constructing a gB-A463P protein expressing a recombinant infectious laryngotracheitis virus; An adjuvant is added to the recombinant infectious laryngotracheitis virus gB-A463P protein to obtain an infectious laryngotracheitis subunit vaccine.

5. The infectious laryngotracheitis subunit vaccine according to claim 4, characterized in that The obtained CHO-gB-A463P cells were classified and named: Chinese Hamster Ovary Cells CHO-gB-A463P, and were deposited in the China Center for Type Culture Collection on October 30, 2024, with the deposit number CCTCCNO: C2024303.

6. The infectious laryngotracheitis subunit vaccine according to any one of claims 1 to 5, characterized in that The content of gB-A463P protein in the chicken infectious laryngotracheitis subunit vaccine is as high as 1178 μg / ml.

7. Use of the infectious laryngotracheitis subunit vaccine according to any one of claims 1 to 6 in the protection against the challenge of infectious laryngotracheitis virus isolated strains, characterized in that: The isolated strain is YBFILTV1 strain, classified and named: Chicken infectious bronchitis virus YBFILTVI. It was deposited in the China Center for Type Culture Collection on October 30, 2024, with the preservation number CCTCC NO: V202481.

8. The use according to claim 7, characterized in that The virus content of the isolated strain YBFILTV1 strain was 10 4.2 EID50.

9. The use according to claim 7, characterized in that: The dosage of gB-A463P protein in the infectious laryngotracheitis subunit vaccine for each attack and protection is not less than 12 μg / bird.

10. A bio-identification kit, characterized in that: The method comprises at least the infectious laryngotracheitis virus gB-A463P protein as described in claim 1, whose amino acid sequence is shown in SEQ ID NO: 5, so as to distinguish animals infected with wild virus and animals infected with the isolated virus strain YBFILTV1 as described in claim 7.

Images