Cell for determining biological activity of anti-TGF (Transforming Growth Factor) beta superfamily protein antibody and application thereof

Abstract

The invention relates to a cell for determining the biological activity of an anti-TGF (Transforming Growth Factor) beta superfamily protein antibody and application of the cell, the cell is a mouse pituitary gland cell line, and the preservation number is CCTCC (China Center for Type Culture Collection) NO: C2023376. The cell line is highly sensitive to TGF [beta] family proteins, and the cell line can be used for quickly, effectively, simply and conveniently evaluating and screening the anti-TGF [beta] superfamily protein antibody at low cost.

Description

Technical Field

[0001] The present invention relates to the field of drug activity detection, and in particular to a mouse pituitary cell line and its application in the biological activity determination of antibodies against TGFβ superfamily proteins. Background Art

[0002] Inhibin is a water-soluble protein hormone secreted by animal gonads. It is a member of the transforming growth factor β superfamily (TGF-β) and is named for its strong inhibitory effect on the production and secretion of pituitary follicle-stimulating hormone (FSH).

[0003] The antigens prepared by coupling the α subunit of inhibin with some carrier proteins are used to prepare the corresponding inhibin antiserum (AIS) for injection into female animals. Passive immunization neutralizes endogenous inhibin, which can significantly increase the number of ovulations and the quality of oocytes in mice, sheep, pigs, cattle, horses and fish. However, AIS is a polyclonal antibody with complex components and large batch differences, which makes it difficult to meet the basic principle of drug quality control. In addition, the immunogen needs to be repeatedly injected into the animal each time it is prepared, which takes a long preparation cycle. Finally, the blood of the immunized animal needs to be drawn, which may lead to the abnormal death of the animal in the middle of the process, which is not in line with animal ethics. Therefore, in view of the potential application value of inhibin, it is necessary to develop anti-inhibin monoclonal antibodies.

[0004] However, whether in the early stages of anti-inhibin monoclonal antibody screening or in the production, testing, and release of druggable monoclonal antibodies, biological activity testing is an essential and critical task. The animal testing methods currently used for products of the same efficacy have differences in sensitivity among different species, difficulties in method verification, and ultimately, unstable product testing results, affecting product quality. The use of phosphorylation level detection methods in the field of biology has become increasingly widespread, and its characteristics of fast detection speed, high sensitivity, good stability, and a wide linear range are unmatched by animal testing and other methods. However, existing cell lines have been tested to be insensitive to inhibins, as shown by the lack of correlation between phosphorylation levels and changes in inhibin concentrations.

[0005] Therefore, the evaluation of the biological activity of anti-inhibin antibodies by detecting changes in phosphorylation levels requires the development of a suitable stable cell line. It is of great significance to develop a highly sensitive and stable cell line to TGFβ family proteins so that the activity of inhibin antibodies can be efficiently detected by using changes in phosphorylation levels. Summary of the invention

[0006] In order to address the deficiencies of the prior art, the object of the present invention is to provide a cell line that is highly sensitive and stable to TGFβ family proteins. In particular, the cell line is highly sensitive to TGFβ family proteins (such as BMP7, activin, inhibin), and the cell line can be used to quickly, effectively, simply and at low cost to evaluate and screen antibodies against TGFβ superfamily proteins and their ligands, in particular anti-inhibin antibodies.

[0007] To achieve the above object, one object of the present invention is to provide a mouse pituitary cell line MPC-23, whose accession number is CCTCC NO: C2023376.

[0008] Another object of the present invention is to provide a method for preparing the aforementioned mouse pituitary cell line, which comprises the following steps:

[0009] (1) taking pituitary tissue from a mouse, digesting it with trypsin, and obtaining digested cells; preferably, washing and mincing the brain cells before digesting them with trypsin; more preferably, centrifuging the digested cells, discarding the supernatant, and resuspending them to obtain resuspended digested cells;

[0010] (2) culturing the digested cells described in step (1) in a culture medium to obtain primary mouse pituitary cells; preferably, the culture medium is a DMEM culture medium containing about 10-20% fetal bovine serum;

[0011] (3) The primary mouse pituitary cells were subcultured to the 30th generation to obtain the aforementioned mouse pituitary cell line.

[0012] Another object of the present invention is to provide a method for detecting the activity of an anti-TGFβ superfamily protein antibody or an anti-TGFβ superfamily protein analog antibody, comprising:

[0013] (1) mixing a TGFβ superfamily protein or a TGFβ superfamily protein analog with a corresponding anti-TGFβ superfamily protein antibody or an anti-TGFβ superfamily protein analog antibody to obtain a mixture 1 comprising the TGFβ superfamily protein or a TGFβ superfamily protein analog and the corresponding anti-TGFβ superfamily protein antibody or an anti-TGFβ superfamily protein analog antibody; preferably mixing at 4° C.-40° C.; preferably incubating for 5-30 min after mixing;

[0014] (2) taking the aforementioned mouse pituitary cell line and culturing it;

[0015] (3) contacting the mixture 1 obtained in step (1) with the mouse pituitary cell line in step (2), and incubating to obtain a mixture 2 comprising the TGFβ superfamily protein or TGFβ superfamily protein analog, the corresponding anti-TGFβ superfamily protein antibody or anti-TGFβ superfamily protein analog antibody and the mouse pituitary cell line cells; preferably incubating at 4-40°C, more preferably incubating at 37°C; preferably incubating for 5-60 min; preferably, contacting the mixture 2 with a BMP family protein or an activin family protein to obtain a mixture 3 comprising the mixture 2 and the BMP family protein or the activin family protein; preferably, the BMP family protein is BMP7 protein; preferably, incubating at 37°C for 30 min;

[0016] (4) contacting the mixture 2 or the mixture 3 in step (3) with a lysate to obtain a cell lysate of the mouse pituitary cell line;

[0017] (5) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (4);

[0018] (6) Determining the activity of the anti-TGFβ superfamily protein antibody or anti-TGFβ superfamily protein analog antibody according to the phosphorylation level of the Smad protein in step (5).

[0019] Another object of the present invention is to provide a method for detecting the activity of a TGFβ superfamily protein, a TGFβ superfamily protein fusion protein or a TGFβ superfamily protein analog, comprising:

[0020] (1) contacting a TGFβ superfamily protein, a TGFβ superfamily protein fusion protein or a TGFβ superfamily protein analog and optionally a BMP family protein or an activin family protein with the aforementioned mouse pituitary cell line, and incubating to obtain a mixture; preferably incubating at 4°C-40°C, more preferably at 37°C; preferably incubating for 5-60 min;

[0021] (2) contacting the mixture described in step (1) with a lysate to obtain a cell lysate of a mouse pituitary cell line;

[0022] (3) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (2);

[0023] (4) judging the activity of the TGFβ superfamily protein, the TGFβ superfamily protein fusion protein or the TGFβ superfamily protein analog according to the phosphorylation level of the Smad protein in step (3).

[0024] Another object of the present invention is to provide a method for screening anti-TGFβ superfamily protein antibodies or anti-TGFβ superfamily protein analogs antibodies using the aforementioned mouse pituitary cell line, which comprises:

[0025] (1) mixing a TGFβ superfamily protein or a TGFβ superfamily protein analog with a corresponding candidate antibody of an anti-TGFβ superfamily protein antibody or a candidate antibody of an anti-TGFβ superfamily protein analog to obtain a mixture 1 comprising the TGFβ superfamily protein or the TGFβ superfamily protein analog and the candidate antibody; preferably mixing at 4° C.-40° C.; preferably incubating for 5-30 min;

[0026] (2) taking the aforementioned mouse pituitary cell line and culturing it;

[0027] (3) contacting the mixture 1 obtained in step (1) with the mouse pituitary cell line in step (2), and incubating to obtain a mixture 2 comprising the TGFβ superfamily protein or TGFβ superfamily protein analog, the corresponding anti-TGFβ superfamily protein antibody or anti-TGFβ superfamily protein analog antibody and the mouse pituitary cell line cells; preferably incubating at 4-40°C, more preferably incubating at 37°C; preferably incubating for 5-60 min; preferably, contacting the mixture 2 with a BMP family protein or an activin family protein to obtain a mixture 3 comprising the mixture 2 and the BMP family protein or the activin family protein; preferably, the BMP family protein is BMP7 protein; preferably, incubating at 37°C for 30 min;

[0028] (4) contacting the mixture 2 or the mixture 3 in step (3) with a lysate to obtain a cell lysate of the mouse pituitary cell line;

[0029] (5) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (4);

[0030] (6) judging the activity of the anti-inhibin antibody according to the phosphorylation level of the Smad protein in step (5); if the candidate antibody of the anti-TGFβ superfamily protein antibody or the candidate antibody of the anti-TGFβ superfamily protein analog affects the activity of the TGFβ superfamily protein and changes the phosphorylation level of the Smad protein, then the candidate antibody is the anti-TGFβ superfamily protein antibody or the anti-TGFβ superfamily protein analog antibody.

[0031] Another object of the present invention is to provide a method for screening TGFβ superfamily protein analogs or TGFβ superfamily protein fusion proteins using the aforementioned mouse pituitary cell line, which comprises:

[0032] (1) contacting a candidate drug of a TGFβ superfamily protein analog or a TGFβ superfamily protein fusion protein and optionally a BMP family protein or an activin family protein with the aforementioned mouse pituitary cell line, incubating to obtain a mixture, preferably mixing and incubating at 4°C-40°C, more preferably at 37°C; preferably incubating for 5-60 min;

[0033] (2) contacting the mixture described in step (1) with a lysate to obtain a cell lysate of a mouse pituitary cell line;

[0034] (3) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (2);

[0035] (4) judging the activity of the TGFβ superfamily protein fusion protein or the TGFβ superfamily protein analog according to the phosphorylation level of the Smad protein in step (3); if the candidate drug affects the phosphorylation level of the Smad protein and changes the phosphorylation level of the Smad protein, then the candidate drug is the TGFβ superfamily protein fusion protein or the TGFβ superfamily protein analog.

[0036] Another object of the present invention is to provide the use of the aforementioned mouse pituitary cell line in the preparation of a drug for detecting the activity of an anti-TGFβ superfamily protein antibody or an anti-TGFβ superfamily protein analog antibody.

[0037] Another object of the present invention is to provide the use of the aforementioned mouse pituitary cell line in the preparation of a drug for detecting the activity of a TGFβ superfamily protein or a TGFβ superfamily protein analog.

[0038] Another object of the present invention is to provide the use of the aforementioned mouse pituitary cell line in preparing a drug for screening antibodies against TGFβ superfamily proteins or antibodies against the TGFβ superfamily protein analogs.

[0039] Another object of the present invention is to provide the use of the aforementioned mouse pituitary cell line in preparing drugs for screening analogs of TGFβ superfamily proteins.

[0040] The experiments of the present invention prove that the mouse pituitary cell line MPC-23 highly expresses TGFβRIII, and after multiple passages, it can still highly express TGFβRIII; the cell line is highly sensitive to TGFβ family proteins (such as BMP7, activin A, inhibin); anti-inhibin monoclonal antibodies can relieve the inhibition of inhibin on the phosphorylation of Smad protein in MPC-23 cells, and its EC50 value is 0.75nM. The above experiments prove that the mouse pituitary cell line MPC-23 can be used as a stable cell line for evaluating and screening antibodies (especially anti-inhibin antibodies) against TGFβ superfamily proteins and their ligands. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 Shown are mouse pituitary cells cultured for 10 days.

[0042] Figure 2 Shown are mouse pituitary cells cultured for 24 days.

[0043] Figure 3 Shown are MPC-23 cells, mouse pituitary cells at passage P20.

[0044] Figure 4 Shown are MPC-23 cells, mouse pituitary cells at passage P30.

[0045] Figure 5 qPCR amplification curves of TGFβR3 and m-GAPDH are shown.

[0046] Figure 6 The qPCR amplification curves of TGFβRIII in pituitary cells of different mice are shown.

[0047] Figure 7 The figure shows the changes in phosphorylation levels of MPC-23 cells after BMP7 protein treatment.

[0048] Figure 8 The figure shows the changes in phosphorylation levels of MPC-23 cells after activin A protein treatment.

[0049] Fig. 9 The figure shows the differences in sensitivity of pituitary cells of different mice to BMP7 and inhibin A protein.

[0050] Fig.10 The graph shows the inhibition curve of Smad1 protein phosphorylation in MPC-23 (P30) cells by inhibin A.

[0051] Fig.11 A graph showing the relief of protein phosphorylation inhibition by anti-inhibin monoclonal antibodies. DETAILED DESCRIPTION

[0052] In the present disclosure, unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology and laboratory operation procedures used herein are terms and routine procedures widely used in the corresponding fields. At the same time, in order to better understand the present disclosure, the definitions and explanations of the relevant terms are provided below.

[0053] As used herein, the term "approximately" or "approximately" as applied to one or more target values ​​refers to a value similar to a reference value. In some embodiments, unless otherwise specified or in addition apparent from the context, the term "approximately" or "approximately" refers to a range of values ​​falling within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the reference value in either direction (greater than or less than) (unless such numerals will exceed 100% of possible values).

[0054] In this article, the term "TGFβ superfamily" refers to a large family of multifunctional proteins that regulate various cellular functions, including cell proliferation, migration, differentiation and apoptosis, extracellular matrix production, tissue remodeling, angiogenesis, immune response, and cell adhesion. The TGFβ superfamily currently includes more than 30 members, including transforming growth factor β (TGFβ), activin, inhibin, bone morphogenetic protein (BMP), growth differentiation factor (GDF), Mullerian inhibitory substance (MIS), and glial-derived neurotrophic factor (GDNF). Among them, TGFβ is the founding member of the TGFβ family and plays a variety of roles in adult tissues, including embryonic pattern formation and cell growth regulation. Mammalian cells can produce the following three different TGFβ isoforms: TGFβ1, TGFβ2, and TGFβ3. TGFβ mainly binds to three high-affinity cell surface proteins, namely type I, type II, and type III TGFβ receptors. The activin family includes, but is not limited to, activin A, activin AB, activin AC, activin B, activin C, C17ORF99, INHBA, INHBB, inhibin, inhibin A, and inhibin B. The BMP (bone morphogenetic protein) family includes, but is not limited to, BMP-1 / PCP, BMP-2, BMP-2 / BMP-6 Heterodimer, BMP-2 / BMP-7 heterodimer, BMP-2a, BMP-3, BMP-3b / GDF-10, BMP-4, BMP-4 / BMP-7 heterodimer, BMP-5, BMP-6, BMP-7, BMP-8, BMP-8a, BMP-8b, BMP-9, BMP-10, BMP-15 / GDF-9B, and Decapentaplegic / DPP. The GDNF family includes, but is not limited to, Artemin, GDNF, Neurturin, and Persephin. Other TGFβ superfamily members include Lefty A, LeftyB, MIS / AMH, Nodal and SCUBE3. Mullerian inhibiting substance (MIS), also known as anti-mullerian hormone (AMH), is a peptide growth factor belonging to the TGF-β growth and differentiation factor family. Herein, TGFβ superfamily proteins encompass wild-type proteins and variants thereof. In some preferred embodiments, the variant has at least the function of the corresponding wild-type protein.

[0055] Three types of TGFβ receptors have been identified: TGFβRI (TGFβ type I receptor); TGFβRII (TGFβ type II receptor) and TGFβRIII (TGFβ type III receptor). TGFβ signaling is mediated by its binding to TGFβRI and RII. TGFβ superfamily ligands (e.g., TGFβ1, TGFβ2 and / or TGFβ3) bind to type II receptors (TGFβRII), which recruit and phosphorylate type I receptors (TGFβRI). Type I receptors then phosphorylate receptor-regulated Smads (R-Smads; e.g., Smad1, Smad2, Smad3, Smad5, or Smad9), which can then bind to coSmads (e.g., Smad4). Compared to type I and type II receptors, type III receptors do not participate in TGF-β signaling, but instead act as a reservoir for TGF-β.

[0056] In this article, the term "Smad" refers to a family of receptor-activated signal transduction transcription factors that transmit signals from TGFβ family receptors. At least 8 Smad proteins are involved in signal responses induced by TGFβ family members. These Smads can be divided into three subgroups. One group (Smad1, 2, 3, 5 and 9) includes Smads that are direct substrates of TGFβ family receptor kinases. Another group (Smad4) includes Smads that are not direct receptor substrates but participate in signal transduction by binding to receptor-activated Smads. The third group of Smads (Smad6 and Smad7) consists of proteins that inhibit Smad activation in the first two groups.

[0057] In this article, the term "fusion protein" refers to a polypeptide comprising protein domains from at least two different proteins. Herein, TGFβ superfamily protein fusion protein refers to a polypeptide comprising protein domains from at least two different proteins, one of which is a TGFβ superfamily protein. Anti-TGFβ superfamily protein antibodies can be used to detect TGFβ superfamily proteins in TGFβ superfamily protein fusion proteins.

[0058] As used herein, the term "analog" refers to an equivalent having one or more modified amino acids and one or more amino acids replaced by another amino acid. Such modifications may include, but are not limited to, conjugation to a molecule (e.g., a small molecule, a cytotoxic molecule, a linker, a pH-sensitive linker, and / or a thiol linker), sialylation, polysialylation, O-glycosylation, N-glycosylation, myristoylation, palmitoylation, isoprenylation or prenylation, lipidation, phosphopantetheinylation, ethanolamine phosphoglycerol linkage, diphthamide formation, hypusine formation, acylation, acetylation, formylation, alkylation, methylation, amidation, citrullination, deamination, eliminylation, ISG ylation, SUMOylation, ubiquitination, neddylation, pupylation, biotinylation, carbamylation, oxidation, pegylation, glycosylation, carbamylation, carbonylation, spontaneous isopeptide bond formation, butyrylation, γ-carboxylation, malonylation, hydroxylation, iodination, nucleotide addition, phosphate (O-linked) or phosphoramidate (N-linked) formation, phosphorylation, adenylylation, uridylylation, propionylation, pyroglutamate formation, S-glutathionylation, S-nitrosylation, S-sulfonylation, S-sulfenylation, S-sulfonylation, succinylation and / or sulfation.

[0059] In this article, the term "contact" is used according to its ordinary common meaning, and refers to a process of allowing at least two different substances (e.g., chemical compounds, including biomolecules, or cells) to be close enough to react, interact or physically contact. For example, in this article, a cell lysate is added to a 96-well plate in which a mouse pituitary cell line MPC-23 is cultured, and the cell lysate is in contact with the cultured cells.

[0060] The term "contacting" can include allowing two substances to react, interact, or be in physical contact, where the two substances can be a compound as described herein and a protein or enzyme, such as TGFβ and a TGFβ receptor.

[0061] Protein immunoblotting, also known as Western blot (WB), is an immunochemical technique that uses the principle of antigen-antibody specific reaction to detect protein antigens fixed on a solid phase carrier. The Western Blot (WB) method is commonly used to qualitatively detect protein phosphorylation levels. The main process is to first separate the protein (for example, using SDS-PAGE or IEF gel), then transfer the protein to a nitrocellulose membrane or PVDF membrane, and then use antibodies that specifically recognize phosphorylated proteins to identify the phosphorylation level of the target protein. Only proteins that are phosphorylated will show specific protein bands at the corresponding molecular mass.

[0062] The homogeneous time-resolved fluorescence (HTRF) method is detected by sandwich analysis, using two different specific antibodies, one labeled with Eu (donor) and the other labeled with d2 (acceptor). When the labeled antibodies bind to the same antigen, the donor is excited with a light source (laser or flash), triggering fluorescence resonance energy transfer (FRET) to the acceptor, which then emits fluorescence at a specific wavelength (665nm). The above two antibodies bind to proteins such as cytokines present in the sample, thereby generating FRET. The signal intensity is proportional to the cytokine concentration. The HTRF method is commonly used to quantitatively detect protein phosphorylation levels.

[0063] An object of the present invention is to provide a mouse pituitary cell line MPC-23 (Mus musculus.), whose preservation number is CCTCC NO: C2023376, the preservation unit is China Center for Type Culture Collection, the address is Wuhan University, Wuhan, China, and the preservation date is November 23, 2023.

[0064] Another object of the present invention is to provide a method for preparing the aforementioned mouse pituitary cell line, which comprises the following steps:

[0065] (1) taking pituitary tissue from a mouse, digesting it with trypsin, and obtaining digested cells; preferably, washing and mincing the brain cells before digesting them with trypsin; more preferably, centrifuging the digested cells, discarding the supernatant, and resuspending them to obtain resuspended digested cells;

[0066] (2) culturing the digested cells described in step (1) in a culture medium to obtain primary mouse pituitary cells; preferably, the culture medium is a DMEM culture medium containing about 10-20% fetal bovine serum;

[0067] (3) The primary mouse pituitary cells were subcultured to the 30th generation to obtain the aforementioned mouse pituitary cell line.

[0068] Another object of the present invention is to provide a method for detecting the activity of an anti-TGFβ superfamily protein antibody or an anti-TGFβ superfamily protein analog antibody, comprising:

[0069] (1) mixing a TGFβ superfamily protein or a TGFβ superfamily protein analog with a corresponding anti-TGFβ superfamily protein antibody or an anti-TGFβ superfamily protein analog antibody to obtain a mixture 1 comprising the TGFβ superfamily protein or a TGFβ superfamily protein analog and the corresponding anti-TGFβ superfamily protein antibody or an anti-TGFβ superfamily protein analog antibody; preferably mixing at 4° C.-40° C.; preferably incubating for 5-30 min after mixing;

[0070] (2) taking the aforementioned mouse pituitary cell line and culturing it;

[0071] (3) contacting the mixture 1 obtained in step (1) with the mouse pituitary cell line in step (2), and incubating to obtain a mixture 2 comprising the TGFβ superfamily protein or TGFβ superfamily protein analog, the corresponding anti-TGFβ superfamily protein antibody or anti-TGFβ superfamily protein analog antibody and the mouse pituitary cell line cells; preferably incubating at 4-40°C, more preferably incubating at 37°C; preferably incubating for 5-60 min; preferably, contacting the mixture 2 with a BMP family protein or an activin family protein to obtain a mixture 3 comprising the mixture 2 and the BMP family protein or the activin family protein; preferably, the BMP family protein is BMP7 protein; preferably, incubating at 37°C for 30 min;

[0072] (4) contacting the mixture 2 or the mixture 3 in step (3) with a lysate to obtain a cell lysate of the mouse pituitary cell line;

[0073] (5) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (4);

[0074] (6) Determining the activity of the anti-TGFβ superfamily protein antibody or anti-TGFβ superfamily protein analog antibody according to the phosphorylation level of the Smad protein in step (5).

[0075] In some embodiments, the order of step (1) and step (2) can be arbitrarily reversed, or step (1) and step (2) can be performed simultaneously.

[0076] In some embodiments, the TGFβ superfamily protein is selected from one or more of the TGFβ family, activin family, BMP family, growth differentiation factor (GDF), Mullerian inhibitory substance (MIS), GDNF family and other TGFβ superfamily members; preferably, the TGFβ superfamily protein is selected from the wild-type protein or its variant.

[0077] In some embodiments, the TGFβ family member is selected from TGFβ1, TGFβ2, and TGFβ3.

[0078] In some embodiments, the activin family member is selected from activin A, activin AB, activin AC, activin B, activin C, C17ORF99, INHBA, INHBB, inhibin, inhibin A, and inhibin B.

[0079] In some embodiments, the BMP family member is selected from BMP-1 / PCP, BMP-2, BMP-2 / BMP-6 Heterodimer, BMP-2 / BMP-7 Heterodimer, BMP-2a, BMP-3, BMP-3b / GDF-10, BMP-4, BMP-4 / BMP-7 Heterodimer, BMP-5, BMP-6, BMP-7, BMP-8, BMP-8a, BMP-8b, BMP-9, BMP-10, BMP-15 / GDF-9B and Decapentaplegic / DPP.

[0080] In some embodiments, the GDNF family member is selected from Artemin, GDNF, Neurturin, and Persephin.

[0081] In some embodiments, the additional TGFβ superfamily member is selected from Lefty A, Lefty B, MIS / AMH, Nodal, and SCUBE3.

[0082] In some embodiments, the antibody is a monoclonal antibody.

[0083] In some embodiments, the Smad protein is Smad1 or Smad3.

[0084] In some embodiments, the method for detecting the phosphorylation level of Smad protein is homogeneous time-resolved fluorescence (HTRF) or western blotting (WB); preferably, homogeneous time-resolved fluorescence (HTRF).

[0085] In some embodiments, the TGFβ superfamily protein is selected from inhibin, BMP and activin; and the corresponding anti-TGFβ superfamily protein antibodies are selected from anti-inhibin antibodies, anti-BMP antibodies and anti-activin antibodies, respectively.

[0086] In some embodiments, the TGFβ superfamily protein is inhibin, and the corresponding anti-TGFβ superfamily protein antibody is an anti-inhibin antibody.

[0087] In some embodiments, the amino acid sequence of the heavy chain variable region of the anti-inhibin antibody is as shown in SEQ ID NO:1, and the amino acid sequence of the light chain variable region is as shown in SEQ ID NO:2.

[0088] In some embodiments, the TGFβ superfamily protein is BMP, preferably BMP7; the corresponding anti-TGFβ superfamily protein antibody is an anti-BMP antibody, preferably a BMP7 antibody.

[0089] In some embodiments, the TGFβ superfamily protein is activin, preferably activin A; the corresponding anti-TGFβ superfamily protein antibody is an anti-activin antibody, preferably activin A antibody.

[0090] In some embodiments, the TGFβ superfamily protein analog is selected from the group consisting of a PEGylated TGFβ superfamily protein, a biotinylated TGFβ superfamily protein, and a glycosylated TGFβ superfamily protein.

[0091] In some embodiments, in step (1), the concentration of the TGFβ superfamily protein or TGFβ superfamily protein analog is at least 1 nM, preferably 5-100 nM.

[0092] In some embodiments, in step (1), the concentration of the corresponding anti-TGFβ superfamily protein antibody or anti-TGFβ superfamily protein analog antibody is at least 1 nM, preferably 5-100 nM.

[0093] In some embodiments, in step (2), the mouse pituitary cell line is cultured at 0.5-2*10 6 The cells were inoculated and cultured at a density of cells / ml.

[0094] In some embodiments, the method comprises:

[0095] (i) mixing inhibin with an anti-inhibin antibody, and incubating to obtain a mixture 1 comprising the inhibin and the anti-inhibin antibody; preferably incubating for 5 minutes;

[0096] (ii) taking the aforementioned mouse pituitary cell line and culturing it;

[0097] (iii) contacting the mixture 1 obtained in step (1) with the mouse pituitary cell line in step (2), and incubating; obtaining a mixture 2 comprising the inhibin, the anti-inhibin antibody and the mouse pituitary cell line cells; preferably, contacting the mixture 2 with a BMP family protein or an activin family protein to obtain a mixture 3 comprising the mixture 2 and the BMP family protein or the activin family protein; preferably, the BMP family protein is BMP7 protein; preferably, incubating at 37° C. for 30 min;

[0098] (iv) contacting the mixture 2 or the mixture 3 described in step (iii) with a lysate to obtain a cell lysate of the mouse pituitary cell line;

[0099] (v) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (iv);

[0100] (vi) determining the activity of the anti-inhibin antibody based on the phosphorylation level of the Smad protein in step (v).

[0101] Another object of the present invention is to provide a method for detecting the activity of a TGFβ superfamily protein, a TGFβ superfamily protein fusion protein or a TGFβ superfamily protein analog, comprising:

[0102] (1) contacting a TGFβ superfamily protein, a TGFβ superfamily protein fusion protein or a TGFβ superfamily protein analog and optionally a BMP family protein or an activin family protein with the aforementioned mouse pituitary cell line, and incubating to obtain a mixture; preferably incubating at 4°C-40°C, more preferably at 37°C; preferably incubating for 5-60 min;

[0103] (2) contacting the mixture described in step (1) with a lysate to obtain a cell lysate of a mouse pituitary cell line;

[0104] (3) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (2);

[0105] (4) judging the activity of the TGFβ superfamily protein, the TGFβ superfamily protein fusion protein or the TGFβ superfamily protein analog according to the phosphorylation level of the Smad protein in step (3).

[0106] In some embodiments, the TGFβ superfamily protein, the Smad protein, and the method for detecting the phosphorylation level of the Smad protein are as defined above.

[0107] In some embodiments, the TGFβ superfamily protein fusion protein is selected from a fusion protein of a TGFβ superfamily protein fused to an Fc fragment, a fusion protein of a TGFβ superfamily protein fused to BSA, and a fusion protein of a TGFβ superfamily protein fused to HSA.

[0108] In some embodiments, the TGFβ superfamily protein analog is selected from the group consisting of a PEGylated TGFβ superfamily protein, a biotinylated TGFβ superfamily protein, and a glycosylated TGFβ superfamily protein.

[0109] In some embodiments, the method comprises:

[0110] (i) contacting inhibin and BMP7 protein with the aforementioned mouse pituitary cell line, and incubating to obtain a mixture; preferably incubating at 37° C. for 30 min;

[0111] (ii) contacting the mixture described in step (1) with a lysate to obtain a cell lysate of a mouse pituitary cell line;

[0112] (iii) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (2);

[0113] (iii) determining the inhibitory activity according to the phosphorylation level of the Smad protein in step (iii).

[0114] Another object of the present invention is to provide a method for screening anti-TGFβ superfamily protein antibodies or anti-TGFβ superfamily protein analogs antibodies using the aforementioned mouse pituitary cell line, which comprises:

[0115] (1) mixing a TGFβ superfamily protein or a TGFβ superfamily protein analog with a corresponding candidate antibody of an anti-TGFβ superfamily protein antibody or a candidate antibody of an anti-TGFβ superfamily protein analog to obtain a mixture 1 comprising the TGFβ superfamily protein or the TGFβ superfamily protein analog and the candidate antibody; preferably mixing at 4° C.-40° C.; preferably incubating for 5-30 min after mixing;

[0116] (2) taking the aforementioned mouse pituitary cell line and culturing it;

[0117] (3) contacting the mixture 1 obtained in step (1) with the mouse pituitary cell line in step (2), and incubating to obtain a mixture 2 comprising the TGFβ superfamily protein or TGFβ superfamily protein analog, the corresponding anti-TGFβ superfamily protein antibody or anti-TGFβ superfamily protein analog antibody and the mouse pituitary cell line cells; preferably incubating at 4-40°C, more preferably incubating at 37°C; preferably incubating for 5-60 min; preferably, contacting the mixture 2 with a BMP family protein or an activin family protein to obtain a mixture 3 comprising the mixture 2 and the BMP family protein or the activin family protein; preferably, the BMP family protein is BMP7 protein; preferably, incubating at 37°C for 30 min;

[0118] (4) contacting the mixture 2 or the mixture 3 in step (3) with a lysate to obtain a cell lysate of the mouse pituitary cell line;

[0119] (5) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (4);

[0120] (6) judging the activity of the anti-inhibin antibody according to the phosphorylation level of the Smad protein in step (5); if the candidate antibody of the anti-TGFβ superfamily protein antibody or the candidate antibody of the anti-TGFβ superfamily protein analog affects the activity of the TGFβ superfamily protein and changes the phosphorylation level of the Smad protein, then the candidate antibody is the anti-TGFβ superfamily protein antibody or the anti-TGFβ superfamily protein analog antibody.

[0121] In some embodiments, the order of step (1) and step (2) can be arbitrarily reversed, or step (1) and step (2) can be performed simultaneously.

[0122] In some embodiments, the TGFβ superfamily protein, the anti-TGFβ superfamily protein antibody, the Smad protein, and the method for detecting the phosphorylation level of the Smad protein are as defined above.

[0123] In some embodiments, in step (1), the concentration of the TGFβ superfamily protein or TGFβ superfamily protein analog is at least 1 nM, preferably 5-100 nM.

[0124] In some embodiments, in step (1), the concentration of the corresponding anti-TGFβ superfamily protein antibody or anti-TGFβ superfamily protein analog antibody is at least 1 nM, preferably 5-100 nM.

[0125] In some embodiments, in step (2), the mouse pituitary cell line is cultured at 0.5-2*10 6The cells were inoculated and cultured at a density of cells / ml.

[0126] In some embodiments, the method comprises:

[0127] (i) mixing inhibin with a candidate antibody of an anti-inhibin antibody, and incubating to obtain a mixture 1 comprising the inhibin and the candidate antibody of the anti-inhibin antibody; preferably incubating for 5 minutes;

[0128] (ii) taking the aforementioned mouse pituitary cell line and culturing it;

[0129] (iii) contacting the mixture 1 obtained in step (1) with the mouse pituitary cell line in step (2), and incubating; obtaining a mixture 2 comprising the inhibin, the anti-inhibin antibody and the mouse pituitary cell line cells; preferably, contacting the mixture 2 with a BMP family protein or an activin family protein to obtain a mixture 3 comprising the mixture 2 and the BMP family protein or the activin family protein; preferably, the BMP family protein is BMP7 protein; preferably, incubating at 37° C. for 30 min;

[0130] (iv) contacting the mixture 2 or the mixture 3 described in step (iii) with a lysate to obtain a cell lysate of the mouse pituitary cell line;

[0131] (v) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (iv);

[0132] (vi) judging the activity of the anti-inhibin antibody according to the phosphorylation level of the Smad protein in step (v); if the candidate antibody of the anti-inhibin antibody inhibits the activity of the inhibin, causing the phosphorylation level of the Smad protein to change, and the anti-inhibin antibody relieves the inhibition of the phosphorylation level of the Smad protein by inhibin, then the candidate antibody is the anti-inhibin antibody.

[0133] Another object of the present invention is to provide a method for screening TGFβ superfamily protein analogs or TGFβ superfamily protein fusion proteins using the aforementioned mouse pituitary cell line, which comprises:

[0134] (1) contacting a candidate drug of a TGFβ superfamily protein analog or a TGFβ superfamily protein fusion protein and optionally a BMP family protein or an activin family protein with the aforementioned mouse pituitary cell line, incubating to obtain a mixture, preferably mixing and incubating at 4°C-40°C, more preferably at 37°C; preferably incubating for 5-60 min;

[0135] (2) contacting the mixture described in step (1) with a lysate to obtain a cell lysate of a mouse pituitary cell line;

[0136] (3) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (2);

[0137] (4) judging the activity of the TGFβ superfamily protein fusion protein or the TGFβ superfamily protein analog according to the phosphorylation level of the Smad protein in step (3); if the candidate drug affects the phosphorylation level of the Smad protein and changes the phosphorylation level of the Smad protein, then the candidate drug is the TGFβ superfamily protein fusion protein or the TGFβ superfamily protein analog.

[0138] In some embodiments, the TGFβ superfamily protein and the Smad protein are as defined above.

[0139] In some embodiments, the TGFβ superfamily protein fusion protein or TGFβ superfamily protein analog is as defined above.

[0140] In some embodiments, the method comprises:

[0141] (i) contacting the candidate drug of inhibin fusion protein or inhibin analog with the aforementioned mouse pituitary cell line and incubating to obtain a mixture; preferably incubating at 4°C-40°C, more preferably at 37°C; preferably incubating for 5-60 minutes; more preferably incubating for 30 minutes;

[0142] (ii) contacting the mixture described in step (i) with a lysate to obtain a cell lysate of a mouse pituitary cell line;

[0143] (iii) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (ii);

[0144] (iv) judging the activity of the inhibitor fusion protein or inhibitor analog according to the phosphorylation level of the Smad protein in step (iii); if the candidate drug affects the phosphorylation level of the Smad protein and changes the phosphorylation level of the Smad protein, then the candidate drug is an inhibitor fusion protein or an inhibitor analog.

[0145] Another object of the present invention is to provide the use of the aforementioned mouse pituitary cell line in the preparation of a drug for detecting the activity of an anti-TGFβ superfamily protein antibody or an anti-TGFβ superfamily protein analog antibody.

[0146] Another object of the present invention is to provide the use of the aforementioned mouse pituitary cell line in the preparation of a drug for detecting the activity of a TGFβ superfamily protein or a TGFβ superfamily protein analog.

[0147] Another object of the present invention is to provide the use of the aforementioned mouse pituitary cell line in preparing a drug for screening antibodies against TGFβ superfamily proteins or antibodies against the TGFβ superfamily protein analogs.

[0148] Another object of the present invention is to provide the use of the aforementioned mouse pituitary cell line in preparing drugs for screening analogs of TGFβ superfamily proteins.

[0149] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the examples are carried out according to conventional experimental conditions or the conditions recommended by the manufacturer's instructions.

[0150] Example 1 Preparation of mouse pituitary cell line

[0151] The preparation of mouse pituitary cell line includes the following steps:

[0152] 1) Euthanasia and disinfection of mice

[0153] 10-12g ICR mice (the mother and father were purchased from Zhejiang Weitong Lihua Experimental Animal Technology Co., Ltd., and the 10-12g mice were self-bred) were killed by cervical dislocation and then immersed in 75% alcohol for 30s-2min to disinfect the body surface of the mice, and then transferred to a biosafety cabinet;

[0154] 2) Extraction of pituitary tissue

[0155] Peel off the epidermis on the back of the mouse under sterile operation, then fix the rat skull at the eye socket with hook forceps, and cut it at the connection between the skull and cervical vertebrae with tissue scissors;

[0156] Insert the scissors head into the foramen magnum and cut as close to the bone as possible, so as to facilitate the next step of craniotomy;

[0157] Insert the scissors from the foramen magnum toward the ipsilateral eye socket, cut along the bone until the eye socket is reached; do the same on the right side;

[0158] Cut it between the rat's eye sockets, insert the hook forceps with your left hand into the rat's eye sockets to fix the skull, and use curved forceps to directly clamp the bone at the foramen magnum, and lift it up to reveal the intact brain tissue;

[0159] The brain tissue was pushed upward from the cerebellum, and the cranial nerves were cut with small scissors. The pituitary tissue was taken out and washed 3-5 times with PBS solution containing double antibodies (penicillin-streptomycin solution, 100X, purchased from Sangon Biotechnology (Shanghai) Co., Ltd., catalog number E607011). The first time it was washed, it was soaked for 10 minutes, and then each time it was soaked for 5 minutes. During the soaking process, blood vessels and mesangium and other tissues were removed;

[0160] 3) Primary cell culture

[0161] Use sterile ophthalmic scissors to cut the pituitary tissue into 1 mm pieces. 3 For tissue blocks of about 1.5-2.5 times the volume of the tissue, add 5-7 times the volume of trypsin solution (0.25%, containing EDTA, Sangon Biotechnology, catalog number E607001), digest at 37°C for at least 30 min, pipetting once every 10 min; add an equal volume of DMEM medium containing 20% ​​FBS (fetal bovine serum) to terminate digestion, and centrifuge at 1500 rpm for 5 min to collect cells;

[0162] The cells obtained in the previous step were made into a cell suspension using DMEM medium containing 20% ​​FBS (fetal bovine serum) (10 ml of culture medium was used to resuspend the pituitary cells of each mouse), and transferred to two T25 breathable cap culture bottles, cultured at 37°C and 8% CO2, and not moved within 7-10 days. After the pituitary cells have grown stably attached to the wall, the culture medium was replaced by half every 2-3 days to remove detached tissues and dead cells; after 10 days of culture, a small number of cells were observed to grow attached to the wall, such as Figure 1 As shown; after 24 days of culture, cells can be seen growing in clusters. Figure 2 shown.

[0163] 4) Subculture

[0164] When the cells cover 90% of the bottom of the bottle, the old culture medium is aspirated and filtered with a 0.22um sterile filter (recorded as conditioned medium). The culture bottle is washed twice with 2ml PBS. The cells are digested with trypsin (0.25%, containing EDTA, Sangon Biotechnology) until the cells become round. The trypsin is aspirated and discarded. 3ml of fresh DMEM medium containing 20% ​​FBS (fetal bovine serum) and 2ml of conditioned medium are added to terminate the digestion. The cells are gently tapped and mixed by blowing and then transferred to a new T25 in a 1:1 manner and cultured at 37°C and 8% CO2. Observe the next day. If a large number of dead cells that are not attached to the wall are found, the culture supernatant is aspirated and centrifuged to remove the dead cells, then added back to the culture bottle and culture is continued.

[0165] 5) Establishment of cell lines

[0166] As the number of passages increases, the cell adhesion ability becomes weaker and weaker, and the cells gradually show the characteristics of aggregate growth, such as Figure 3 (P20), the FBS content was reduced to 10%; when the cells were continued to be subcultured to P30, the culture medium turned yellow after 5-7 days of expansion culture at a ratio of 1:2, and the aggregated cells became larger. Figure 4As shown; observation of the cell growth performance after three subsequent passages found that it tended to be stable, so the P30 cells were named mouse pituitary cell line MPC-23 and sent for sample preservation, with the preservation number CCTCC NO: C2023376, preserved in the China Center for Type Culture Collection, located at Wuhan University, Wuhan, China, and the preservation date is November 23, 2023.

[0167] Example 2 Detection of TGFβRIII expression

[0168] 1) Target gene RNA extraction

[0169] (i) The cells frozen at generation P30 (mouse pituitary cell line MPC-23) were revived and expanded, and the cell pellets were collected by centrifugation;

[0170] (ii) Add 1000 μl of Trizol to the 1.5 ml EP tube containing the cell line, mix thoroughly, then add 200 μl of chloroform, shake and mix, let stand for 5 min, and then centrifuge at 12,000 rpm at 4°C for 10 min;

[0171] (iii) Take out the 1.5ml EP tube from the centrifuge and transfer the upper colorless and transparent aqueous phase into another clean 1.5ml EP tube. (The sample will be divided into three layers: the lower organic phase, the middle layer and the upper aqueous phase, and the RNA is in the upper aqueous phase.) Add an equal volume of isopropanol, gently invert up and down to mix, let stand for 10 minutes, and then centrifuge at 12000 rpm and 4℃ for 10 minutes;

[0172] (iv) After centrifugation, a gelatinous precipitate may be seen on the wall or bottom of the tube. The precipitate is RNA. Carefully discard the supernatant and keep the precipitate.

[0173] (v) Wash the RNA precipitate with 1 mL of 75% ethanol (prepared with DEPC H2O). Then centrifuge at 7000 rpm for 5 min at 4°C and remove the supernatant as much as possible.

[0174] (vi) Leave to dry on the workbench for 5 to 10 minutes. Add 25 μl of DEPC H2O to all EP tubes and pipette several times to fully dissolve the RNA. Store at -80°C.

[0175] (vii) The RNA concentration was measured using a micro-nucleic acid detector and was 687.0 ng / μl with a purity of 2.04.

[0176] 2) Primer design

[0177] Target genes:

[0178] Table 1

[0179] m-TGFβRIII-152-F CCCTGCATCTGAACCCCATT(SEQ ID NO:3) m-TGFβRIII-152-R CACAGAACCCTCCGAAACCA(SEQ ID NO:4)

[0180] Internal reference primer:

[0181] Table 2

[0182] GAPDH-128F(M) AGCCCAAGATGCCCTTCAGT(SEQ ID NO:5) GAPDH-128R(M) CCGTGTTCCTACCCCCAATG(SEQ ID NO:6)

[0183] 3) Reverse transcription PCR

[0184] A. Prepare the reverse transcription reaction solution according to the following components:

[0185] Table 3

[0186]

[0187] The following reaction was performed on a PCR instrument: 72°C for 5 min, and then rapidly cooled on ice.

[0188] B. Add the following reverse transcription reaction solution to the above PCR tube:

[0189] Table 4

[0190]

[0191] The reverse transcription reaction was carried out on a PCR instrument under the following conditions: 42°C for 60 min; 72°C for 10 min

[0192] 4) Real-time fluorescence quantitative PCR reaction

[0193] Preparation of reaction system:

[0194] Table 5

[0195]

[0196] Reaction conditions:

[0197] Amplification Procedure:

[0198] Table 6

[0199]

[0200] 5) Results

[0201] The target gene qPCR amplification results are as follows Figure 5 As shown in Table 7, the CT value can be used to determine that TGFβRIII is expressed in MPC-23 cells.

[0202] Table 7 Statistical results of gene expression detection

[0203]

[0204] Example 3 Differences in TGFβRIII expression in different cells

[0205] This example studies the expression of TGFβRIII in pituitary cells from different mice. It should be noted that during the isolation and culture of primary cells, since MPC-1, MPC-2, and MPC-3 cells (derived from different mice) cannot be passaged and expanded after P5, no cell lines were established. The experiments involving these three cells in the present invention were all P4 cells.

[0206] According to the method in Example 2, target gene RNA was extracted from different mouse pituitary cells (respectively MPC-1, MPC-2, and MPC-3) isolated at different times, and target gene RNA was extracted from MPC-23 cells (P10 and P30), and the expression difference of TGFβRIII in pituitary cells of different mice was compared. The results are shown in FIG. Figure 6 As shown in Table 8, it can be seen that there are obvious differences in the expression of receptors in cells obtained by the same method. For the same cell type MPC-23, the TGFβRIII expressed by P30 cells is less than that of P10 cells, that is, the receptor expression will gradually decrease with cell passage. However, even if MPC-23 cells are passaged to the 30th generation, the TGFβRIII expressed is still higher than that of MPC-1, MPC-2, and MPC-3 cells that are passaged to the 4th generation.

[0207] Table 8 Statistical results of gene expression detection in different cells

[0208]

[0209] Example 4 Effects of BMP7, inhibitor A and activin A on Smad protein phosphorylation

[0210] 1) MPC-23 (P30) cells were cultured in an incubator at 37°C and 8% CO2. Cells were subcultured regularly and cells in the logarithmic growth phase were used for plating.

[0211] 2) Use trypan blue to stain the cells and count the living cells, and adjust the cell concentration to 5*10 5 ~1*10 6 / mL, inoculated in 6-well plates, with a final volume of 2mL in each well.

[0212] 3) The 6-well plate was transferred to an incubator and cultured overnight at 37°C and 8% CO2.

[0213] 4) Add different protein factors to different wells, such as BMP7 (purchased from R&D, catalog number 354-BP-010), activinA (purchased from R&D, catalog number 11348-AC), inhibin A (purchased from R&D Systems, catalog number 8346-IN-010), etc., and use WB method to detect the change trend of phosphorylation level before and after treatment to evaluate the sensitivity of MPC-23 cells to TGFβ family proteins. The experimental design is as follows:

[0214] Table 9 Protein phosphorylation experimental conditions

[0215]

[0216] 5) Information about the secondary antibody used in the experiment

[0217] Table 10 Product information

[0218]

[0219] 6) WB experimental conditions

[0220] Table 11WB conditions

[0221]

[0222] 7) Results

[0223] A. Cell sensitivity to BMP7 protein

[0224] from Figure 7 It can be seen that after the addition of BMP7 protein, the Smad1 phosphorylation level of MPC-23 cells increased significantly, about 3 times the basal value; and after the addition of inhibin A protein, the Smad1 phosphorylation level decreased by half, indicating that BMP7 protein and inhibin A protein have an antagonistic effect.

[0225] B. Cell sensitivity to activin A protein

[0226] from Figure 8 It can be seen that activin A can increase the Smad3 level of MPC-23 cells, which is about 2.5 times that of the blank control. After adding inhibin A protein, the phosphorylation level of Smad3 protein decreased, indicating that there is a certain degree of antagonism between activin A protein and inhibin A protein.

[0227] It can be seen from the above experiments that BMP7, activin A and inhibin A can all change the phosphorylation level of MPC-23 cells and can be used for the research, development and screening of such proteins and their analogs.

[0228] Example 5 Differences in sensitivity of different cells to BMP7 and inhibitory protein A

[0229] The four different mouse pituitary cells (MPC-23 (P10), MPC-23 (P30), MPC-1, MPC-2, MPC-3) mentioned in Example 3 were cultured in an incubator at 37°C and 8% CO2, and the WB method in Example 4 was used for the experiment. The results are as follows. Fig. 9 As shown, it can be seen that the antagonistic effects of BMP7 and inhibin A protein are different in different mouse pituitary cells. Combined with the results of Example 3, the higher the content of TGFβRIII, the more significant the inhibition of inhibin A protein on the phosphorylation level caused by BMP7.

[0230] Example 6 Effect of inhibitory A on Smad protein phosphorylation

[0231] This example provides a method for detecting the biological activity of inhibin A protein, which is based on MPC-23 cells and is achieved by detecting the phosphorylation level of SMAD1 protein using a commercial kit (HTRF Human and Mouse Phospho-SMAD1 (Ser463 / 465) Detection Kit, purchased from Cisbio, catalog number: 63ADK062PEG). The specific method is as follows:

[0232] 1) MPC-23 (P30) and MPC-1 cells in logarithmic growth phase were cultured at 1*10 6 Plate at a density of 100 μl / well, incubate at 37°C, 8% CO2, and aspirate the culture medium when the cells are completely attached to the wall;

[0233] 2) After the inhibin A protein was diluted with DMEM medium (purchased from Gibco, catalog number 11965092) to a certain gradient concentration (the first well concentration was 150nM, and two-fold dilutions were performed to obtain a total of 8 concentrations of 75nM, 37.5nM, 18.75nM, 9.375nM, 4.688nM, 2.344nM, and 1.172nM), it was added to a 96-well plate at 50μl / well, and blank culture medium was used as a blank control. Then, 50μl of 4nM BMP7 protein was added to each well and treated at 37°C for 30min;

[0234] 3) Take out the culture plate, discard 70 μl of solution from each well, add 10 μl of freshly prepared cell lysis buffer, and let stand at room temperature for 30 min;

[0235] 4) After mixing the lysed liquid by pipetting, take 16 μl and add it to the HTRF-384 well plate with 4 μl of premixed antibody. After shaking at room temperature for 10 minutes, incubate at 4°C overnight.

[0236] 5) On the second day, set the parameters of the microplate reader according to the instructions, optimize the first well, read the signal value of each well, and use Graphpad to draw a graph to calculate the IC value of the effect of inhibin A protein on the phosphorylation level. 50 value.

[0237] The results are as follows Fig.10 As shown in the figure, the inhibition of Smad1 phosphorylation level of MPC-23 (P30) cells by inhibin A protein has good linearity within the concentration range (0.586nM~75nM), and its IC 50 The value is 4.704nM; although there is a correlation between the Smad1 protein phosphorylation level of MPC-1 cells and the inhibin A protein concentration, the curve is flat and it is difficult to accurately reflect the difference between drug doses; combined with the above experimental results, TGFβR3 receptor is closely related to the function of inhibin A protein.

[0238] Example 7 Effect of anti-inhibin monoclonal antibodies on Smad protein phosphorylation

[0239] 1) MPC-23 (P30) cells in the logarithmic growth phase were cultured at 1*10 6 The cells were plated at a density of 100 μl / well and cultured at 37°C and 8% CO2 until they were completely attached to the wall.

[0240] 2) Dilute the inhibin A protein to 20 nM with DMEM medium; dilute the anti-inhibin monoclonal antibody (heavy chain variable region sequence such as SEQ ID NO: 1, light chain variable region sequence such as SEQ ID NO: 2) by a certain multiple gradient dilution (first well concentration 20 nM, 1.5-fold gradient dilution for a total of 8 points), mix the monoclonal antibody solutions of different concentrations with the 20 nM inhibin A protein solution in equal proportions, incubate at room temperature for 5 min, add to a 96-well plate, 50 μl / well, use DMEM blank medium as a blank control, then add 50 μl of 4 nM BMP7 protein to each well, and treat at 37°C for 30 min;

[0241] 3) Take out the culture plate, discard 70 μl of solution from each well, add 10 μl of freshly prepared cell lysis buffer, and let stand at room temperature for 30 min;

[0242] 4) After mixing the lysed liquid by pipetting, take 16 μl and add it to the HTRF-384 well plate with 4 μl of premixed antibody. After shaking at room temperature for 10 minutes, incubate at 4°C overnight.

[0243] 5) On the second day, set the parameters of the microplate reader according to the instructions, optimize the first well, read the signal value of each well, and use Graphpad to draw a graph to calculate the EC value of the anti-inhibin monoclonal antibody to relieve phosphorylation inhibition. 50 value.

[0244] The results are as follows Fig.11 As shown in the results, anti-inhibin monoclonal antibody can relieve the inhibition of inhibin A protein on the phosphorylation level of Smad1 in MPC-23 cells, and has good linearity within the above concentration range, and its EC 50 The value is 0.75nM.

[0245] In summary, the mouse pituitary cell line MPC-23 provided by the present invention has normal expression of TGFβR3 receptor and is sensitive to TGFβ family proteins, which is manifested by changes in the phosphorylation level of Smad1 or Smad3 protein after the addition of TGFβ family proteins. At the same time, using a Smad1 protein phosphorylation level detection kit, it is preliminarily verified that the anti-inhibin monoclonal antibody can relieve the inhibition of inhibin on phosphorylation, and its EC 50 The value was 0.75 nM. The above experiments demonstrated that the mouse pituitary cell line MPC-23 can be used as a stable cell line for evaluating and screening anti-inhibin antibodies.

[0246] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A mouse pituitary cell line, whose accession number is: CCTCC NO: C2023376.

2. The method for preparing the mouse pituitary cell line according to claim 1, comprising the following steps: (1) taking pituitary tissue from a mouse, digesting it with trypsin, and obtaining digested cells; preferably, washing and mincing the brain cells before digesting them with trypsin; more preferably, centrifuging the digested cells, discarding the supernatant, and resuspending them to obtain resuspended digested cells; (2) culturing the digested cells described in step (1) in a culture medium to obtain primary mouse pituitary cells; preferably, the culture medium is a DMEM culture medium containing about 10-20% fetal bovine serum; (3) The primary mouse pituitary cells are subcultured to the 30th generation to obtain the mouse pituitary cell line according to claim 1.

3. A method for detecting the activity of an anti-TGFβ superfamily protein antibody or an anti-TGFβ superfamily protein analog antibody, comprising: (1) mixing a TGFβ superfamily protein or a TGFβ superfamily protein analog with a corresponding anti-TGFβ superfamily protein antibody or an anti-TGFβ superfamily protein analog antibody to obtain a mixture 1 comprising the TGFβ superfamily protein or a TGFβ superfamily protein analog and the corresponding anti-TGFβ superfamily protein antibody or an anti-TGFβ superfamily protein analog antibody; preferably mixing at 4° C.-40° C.; preferably incubating for 5-30 min after mixing; (2) taking the mouse pituitary cell line according to claim 1 and culturing it; (3) contacting the mixture 1 obtained in step (1) with the mouse pituitary cell line in step (2), and incubating to obtain a mixture 2 comprising the TGFβ superfamily protein or TGFβ superfamily protein analog, the corresponding anti-TGFβ superfamily protein antibody or anti-TGFβ superfamily protein analog antibody and the mouse pituitary cell line cells; preferably incubating at 4-40°C, more preferably incubating at 37°C; preferably incubating for 5-60 min; preferably, contacting the mixture 2 with a BMP family protein or an activin family protein to obtain a mixture 3 comprising the mixture 2 and the BMP family protein or the activin family protein; preferably, the BMP family protein is BMP7 protein; preferably, incubating at 37°C for 30 min; (4) contacting the mixture 2 or the mixture 3 in step (3) with a lysate to obtain a cell lysate of the mouse pituitary cell line; (5) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (4); (6) judging the activity of the anti-TGFβ superfamily protein antibody or anti-TGFβ superfamily protein analog antibody according to the phosphorylation level of the Smad protein in step (5); Preferably, the order of step (1) and step (2) can be arbitrarily swapped, or step (1) and step (2) can be performed simultaneously; Preferably, the TGFβ superfamily protein is selected from one or more of the TGFβ family, activin family, BMP family, growth differentiation factor (GDF), Mullerian inhibitory substance (MIS), GDNF family and other TGFβ superfamily members; preferably, the TGFβ superfamily protein is selected from the wild-type protein or its variant; Preferably, the TGFβ family member is selected from TGFβ1, TGFβ2 and TGFβ3; Preferably, the activin family member is selected from activin A, activin AB, activin AC, activin B, activin C, C17ORF99, INHBA, INHBB, inhibin, inhibin A and inhibin B; Preferably, the BMP family member is selected from BMP-1 / PCP, BMP-2, BMP-2 / BMP-6 Heterodimer, BMP-2 / BMP-7 Heterodimer, BMP-2a, BMP-3, BMP-3b / GDF-10, BMP-4, BMP-4 / BMP-7 Heterodimer, BMP-5, BMP-6, BMP-7, BMP-8, BMP-8a, BMP-8b, BMP-9, BMP-10, BMP-15 / GDF-9B and Decapentaplegic / DPP; Preferably, the GDNF family member is selected from Artemin, GDNF, Neurturin and Persephin. Preferably, the other TGFβ superfamily members are selected from Lefty A, Lefty B, MIS / AMH, Nodal and SCUBE3; Preferably, the antibody is a monoclonal antibody; Preferably, the Smad protein is Smad1 or Smad3; Preferably, the method for detecting the phosphorylation level of Smad protein adopts homogeneous time-resolved fluorescence (HTRF) or protein immunoblotting (WB); preferably homogeneous time-resolved fluorescence (HTRF); Preferably, the TGFβ superfamily protein is selected from inhibin, BMP and activin; the corresponding anti-TGFβ superfamily protein antibodies are selected from anti-inhibin antibodies, anti-BMP antibodies and anti-activin antibodies, respectively; Preferably, the TGFβ superfamily protein is inhibin, and the corresponding anti-TGFβ superfamily protein antibody is an anti-inhibin antibody; Preferably, the amino acid sequence of the heavy chain variable region of the anti-inhibin antibody is as shown in SEQ ID NO: 1, and the amino acid sequence of the light chain variable region is as shown in SEQ ID NO: 2; Preferably, the TGFβ superfamily protein is BMP, preferably BMP7; the corresponding anti-TGFβ superfamily protein antibody is an anti-BMP antibody, preferably a BMP7 antibody; Preferably, the TGFβ superfamily protein is activin, preferably activin A; the corresponding anti-TGFβ superfamily protein antibody is an anti-activin antibody, preferably activin A antibody; Preferably, the TGFβ superfamily protein analog is selected from PEGylated TGFβ superfamily protein, biotinylated TGFβ superfamily protein and glycosylated TGFβ superfamily protein; Preferably, in step (1), the concentration of the TGFβ superfamily protein or TGFβ superfamily protein analog is at least 1 nM, preferably 5-100 nM; Preferably, in step (1), the concentration of the corresponding anti-TGFβ superfamily protein antibody or anti-TGFβ superfamily protein analog antibody is at least 1 nM, preferably 5-100 nM; Preferably, in step (2), the mouse pituitary cell line is cultured at 0.5-2*10 6 The density of inoculation and culture was 100 / ml; Preferably, the method comprises: (i) mixing inhibin with an anti-inhibin antibody, and incubating to obtain a mixture 1 comprising the inhibin and the anti-inhibin antibody; preferably incubating for 5 minutes; (ii) taking the mouse pituitary cell line according to claim 1 and culturing it; (iii) contacting the mixture 1 obtained in step (1) with the mouse pituitary cell line in step (2), and incubating; obtaining a mixture 2 comprising the inhibin, the anti-inhibin antibody and the mouse pituitary cell line cells; preferably, contacting the mixture 2 with a BMP family protein or an activin family protein to obtain a mixture 3 comprising the mixture 2 and the BMP family protein or the activin family protein; preferably, the BMP family protein is BMP7 protein; preferably, incubating at 37° C. for 30 min; (iv) contacting the mixture 2 or the mixture 3 described in step (iii) with a lysate to obtain a cell lysate of the mouse pituitary cell line; (v) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (iv); (vi) determining the activity of the anti-inhibin antibody based on the phosphorylation level of the Smad protein in step (v).

4. A method for detecting the activity of a TGFβ superfamily protein, a TGFβ superfamily protein fusion protein or a TGFβ superfamily protein analog, comprising: (1) contacting a TGFβ superfamily protein, a TGFβ superfamily protein fusion protein or a TGFβ superfamily protein analog and optionally a BMP family protein or an activin family protein with the mouse pituitary cell line of claim 1, and incubating to obtain a mixture; preferably incubating at 4°C-40°C, more preferably at 37°C; preferably incubating for 5-60 min; (2) contacting the mixture described in step (1) with a lysate to obtain a cell lysate of a mouse pituitary cell line; (3) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (2); (4) judging the activity of the TGFβ superfamily protein, the TGFβ superfamily protein fusion protein or the TGFβ superfamily protein analog according to the phosphorylation level of the Smad protein in step (3); Preferably, the TGFβ superfamily protein, the Smad protein, and the method for detecting the phosphorylation level of the Smad protein are as defined in claim 3; Preferably, the TGFβ superfamily protein fusion protein is selected from a fusion protein of a TGFβ superfamily protein fused to an Fc fragment, a fusion protein of a TGFβ superfamily protein fused to BSA, and a fusion protein of a TGFβ superfamily protein fused to HSA; Preferably, the TGFβ superfamily protein analog is selected from PEGylated TGFβ superfamily protein, biotinylated TGFβ superfamily protein and glycosylated TGFβ superfamily protein; Preferably, the method comprises: (i) contacting inhibin and BMP7 protein with the mouse pituitary cell line according to claim 1, and incubating to obtain a mixture; preferably incubating at 37° C. for 30 min; (ii) contacting the mixture described in step (1) with a lysate to obtain a cell lysate of a mouse pituitary cell line; (iii) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (2); (iii) determining the inhibitory activity according to the phosphorylation level of the Smad protein in step (iii).

5. A method for screening anti-TGFβ superfamily protein antibodies or anti-TGFβ superfamily protein analog antibodies using the mouse pituitary cell line according to claim 1, comprising: (1) mixing a TGFβ superfamily protein or a TGFβ superfamily protein analog with a corresponding candidate antibody of an anti-TGFβ superfamily protein antibody or a candidate antibody of an anti-TGFβ superfamily protein analog to obtain a mixture 1 comprising the TGFβ superfamily protein or the TGFβ superfamily protein analog and the candidate antibody; preferably mixing at 4° C.-40° C.; preferably incubating for 5-30 min; (2) taking the mouse pituitary cell line according to claim 1 and culturing it; (3) contacting the mixture 1 obtained in step (1) with the mouse pituitary cell line in step (2), and incubating to obtain a mixture 2 comprising the TGFβ superfamily protein or TGFβ superfamily protein analog, the corresponding anti-TGFβ superfamily protein antibody or anti-TGFβ superfamily protein analog antibody and the mouse pituitary cell line cells; preferably incubating at 4-40°C, more preferably incubating at 37°C; preferably incubating for 5-60 min; preferably, contacting the mixture 2 with a BMP family protein or an activin family protein to obtain a mixture 3 comprising the mixture 2 and the BMP family protein or the activin family protein; preferably, the BMP family protein is BMP7 protein; preferably, incubating at 37°C for 30 min; (4) contacting the mixture 2 or the mixture 3 in step (3) with a lysate to obtain a cell lysate of the mouse pituitary cell line; (5) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (4); (6) judging the activity of the anti-inhibin antibody according to the phosphorylation level of the Smad protein in step (5); if the candidate antibody of the anti-TGFβ superfamily protein antibody or the candidate antibody of the anti-TGFβ superfamily protein analog affects the activity of the TGFβ superfamily protein and changes the phosphorylation level of the Smad protein, then the candidate antibody is the anti-TGFβ superfamily protein antibody or the anti-TGFβ superfamily protein analog antibody; Preferably, the order of step (1) and step (2) can be arbitrarily swapped, or step (1) and step (2) can be performed simultaneously; Preferably, the TGFβ superfamily protein, the anti-TGFβ superfamily protein antibody, the Smad protein, and the method for detecting the phosphorylation level of the Smad protein are as defined in claim 3; Preferably, in step (1), the concentration of the TGFβ superfamily protein or TGFβ superfamily protein analog is at least 1 nM, preferably 5-100 nM; Preferably, in step (1), the concentration of the corresponding anti-TGFβ superfamily protein antibody or anti-TGFβ superfamily protein analog antibody is at least 1 nM, preferably 5-100 nM; Preferably, in step (2), the mouse pituitary cell line is cultured at 0.5-2*10 6 The density of inoculation and culture was 100 / ml; Preferably, the method comprises: (i) mixing inhibin with a candidate antibody of an anti-inhibin antibody, and incubating to obtain a mixture 1 comprising the inhibin and the candidate antibody of the anti-inhibin antibody; preferably incubating for 5 minutes; (ii) taking the mouse pituitary cell line according to claim 1 and culturing it; (iii) contacting the mixture 1 obtained in step (1) with the mouse pituitary cell line in step (2), and incubating; obtaining a mixture 2 comprising the inhibin, the anti-inhibin antibody and the mouse pituitary cell line cells; preferably, contacting the mixture 2 with a BMP family protein or an activin family protein to obtain a mixture 3 comprising the mixture 2 and the BMP family protein or the activin family protein; preferably, the BMP family protein is BMP7 protein; preferably, incubating at 37° C. for 30 min; (iv) contacting the mixture 2 or the mixture 3 described in step (iii) with a lysate to obtain a cell lysate of the mouse pituitary cell line; (v) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (iv); (vi) judging the activity of the anti-inhibin antibody according to the phosphorylation level of the Smad protein in step (v); if the candidate antibody of the anti-inhibin antibody inhibits the activity of the inhibin, causing the phosphorylation level of the Smad protein to change, and the anti-inhibin antibody relieves the inhibition of the phosphorylation level of the Smad protein by inhibin, then the candidate antibody is the anti-inhibin antibody.

6. A method for screening TGFβ superfamily protein analogs or TGFβ superfamily protein fusion proteins using the mouse pituitary cell line according to claim 1, comprising: (1) contacting a candidate drug of a TGFβ superfamily protein analog or a TGFβ superfamily protein fusion protein and optionally a BMP family protein or an activin family protein with the mouse pituitary cell line of claim 1, incubating to obtain a mixture, preferably mixing and incubating at 4°C-40°C, more preferably at 37°C; preferably incubating for 5-60 min; (2) contacting the mixture described in step (1) with a lysate to obtain a cell lysate of a mouse pituitary cell line; (3) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (2); (4) judging the activity of the TGFβ superfamily protein fusion protein or the TGFβ superfamily protein analog according to the phosphorylation level of the Smad protein in step (3); if the candidate drug affects the phosphorylation level of the Smad protein and changes the phosphorylation level of the Smad protein, then the candidate drug is the TGFβ superfamily protein fusion protein or the TGFβ superfamily protein analog; Preferably, the TGFβ superfamily protein and the Smad protein are as defined in claim 3; Preferably, the TGFβ superfamily protein fusion protein and TGFβ superfamily protein analog are as defined in claim 4; Preferably, the method comprises: (i) contacting a candidate drug of an inhibin fusion protein or an inhibin analog with the mouse pituitary cell line of claim 1, and incubating to obtain a mixture; preferably incubating at 4°C-40°C, more preferably at 37°C; preferably incubating for 5-60 minutes; more preferably incubating for 30 minutes; (ii) contacting the mixture described in step (i) with a lysate to obtain a cell lysate of a mouse pituitary cell line; (iii) detecting the phosphorylation level of Smad protein in the cell lysate of the mouse pituitary cell line described in step (ii); (iv) judging the activity of the inhibitor fusion protein or inhibitor analog according to the phosphorylation level of the Smad protein in step (iii); if the candidate drug affects the phosphorylation level of the Smad protein and changes the phosphorylation level of the Smad protein, then the candidate drug is an inhibitor fusion protein or an inhibitor analog.

7. Use of the mouse pituitary cell line according to claim 1 in the preparation of a drug for detecting the activity of an anti-TGFβ superfamily protein antibody or an anti-TGFβ superfamily protein analog antibody.

8. Use of the mouse pituitary cell line according to claim 1 in the preparation of a drug for detecting the activity of a TGFβ superfamily protein or a TGFβ superfamily protein analog.

9. Use of the mouse pituitary cell line according to claim 1 in preparing a drug for screening antibodies against TGFβ superfamily proteins or antibodies against TGFβ superfamily protein analogs.

10. Use of the mouse pituitary cell line according to claim 1 in preparing a drug for screening analogs of TGFβ superfamily proteins.

Images