Human type 3 adenovirus vector vaccine as well as preparation and application thereof

Abstract

The present invention relates to a cell comprising a nucleotide sequence encoding the E1B-55kDa protein or a portion thereof of a human group B type 3 adenovirus. The invention also provides a replication-deficient human group B type 3 adenovirus, wherein the full length or part of the E1 region gene is deleted or knocked out of the replication-deficient human group B type 3 adenovirus. The invention also provides an adenovirus vector comprising the adenovirus, a preparation method and application thereof.

Description

Technical Field

[0001] The present invention belongs to the field of vaccines, and in particular relates to adenovirus vector vaccines. Background Art

[0002] Human adenovirus (Ad) is a linear double-stranded DNA virus with a capsid that is a regular icosahedral structure with a diameter of about 70 to 100 nm and no envelope. Adenovirus capsid proteins include hexons, pentons, polypeptide IX, polypeptide IIIa, polypeptide VI, and polypeptide VIII, of which hexons and pentons are the main structural proteins that induce immune responses and produce neutralizing antibodies. Human adenovirus includes 7 groups (A to G) and more than 100 serotypes, among which human group B adenovirus is an important pathogen causing acute respiratory tract infection and severe pneumonia. It is highly contagious and often causes outbreaks. The main types of epidemic strains in China are human group B adenovirus type 3 (Ad3), type 7 (Ad7), and type 55 (Ad55), which are also one of the main pathogens causing severe pneumonia and even death in young children. At present, there is still no specific clinical drug for adenovirus infection, and there is no adenovirus vaccine that has been applied to the general population. Therefore, it is very necessary to develop a safe and effective human adenovirus vaccine.

[0003] Adenovirus vectors without replication ability have been widely used in the development and production of infectious disease vaccines due to their high transduction efficiency, relatively large foreign gene capacity and high titer. Adenovirus vectors can induce moderate levels of innate immunity and have relatively high thermal stability. Currently, hAd2 and hAd5 commonly used in gene therapy and vaccine development belong to subgroup C in serological classification, mainly infecting the respiratory tract to cause upper respiratory tract infection and pneumonia, while more than 80% of adults have pre-existing neutralizing antibodies against Ad5, which significantly reduces the effectiveness of the vaccine.

[0004] The whole genome of adenovirus is about 35-36KD long, encoding 9 different transcription units, including early (E1, E2, E3, E4), middle (IX, IVa2) and late (MLT). The genes in the E1 region include E1A and E1B, which are essential genes for adenovirus replication and proliferation. At present, the human adenovirus C group E1B gene expressed by the 293 cell line that can be used for the production of replication-deficient adenovirus vaccines cannot interact with the human adenovirus B group E4orf6, thereby affecting the synergistic effect of E1B-55K and E4orf6 proteins, resulting in the inhibition of cellular mRNA output and the promotion of viral mRNA output and translation. However, human group B adenovirus is an important pathogen causing acute respiratory tract infection and severe pneumonia. Therefore, the production of human group B adenovirus vaccines and vector vaccines for the general population is imminent. The construction of a cell line that can be used for the production of human group B adenovirus replication-deficient vector vaccines will be the key to overcoming difficulties. Summary of the invention

[0005] The present invention constructs a replication-deficient human adenovirus type 3 vector vaccine candidate strain and corresponding complementary cells for vaccine production, thereby solving the problems of low production of replication-deficient human group B type 3 adenovirus, poor safety and efficacy in the general population, and difficulty in large-scale production of human group B adenovirus vector vaccines.

[0006] In a first aspect, the present invention provides a cell comprising a nucleotide sequence encoding the E1B-55kDa protein of human group B type 3 adenovirus or a portion thereof.

[0007] In some embodiments, the cell does not contain a nucleotide sequence encoding the E1A protein of a human group B adenovirus type 3.

[0008] In some embodiments, the cell does not contain a nucleotide sequence encoding the E1B-19K protein of a human group B adenovirus type 3.

[0009] In some embodiments, nucleotides encoding the E1B-55kDa protein of the E1 region of human group B type 3 adenovirus or a portion thereof are transduced into cells to obtain complemented cells.

[0010] In some embodiments, the cells do not carry the entire E1 region of human group B type 3 adenovirus, and do not even carry the E1A protein and / or the E1B-19K protein.

[0011] In some embodiments, the cell is a 293T cell, a HeLa cell, a W162 cell, an A549 cell, or a U87 cell.

[0012] Preferably, the cells are 293T cells.

[0013] In some embodiments, the cell comprises a nucleotide sequence encoding the E1B-55kDa protein of human group B type 3 adenovirus or a portion thereof, as long as the cell is capable of replicating and amplifying the adenovirus via trans-complementation.

[0014] In some embodiments, the replication-deficient human group B type 3 adenovirus can be prepared by culturing cells transfected with a replication-deficient human group B type 3 adenovirus vector under conditions that allow the adenovirus genome to replicate in the cells.

[0015] In a second aspect, the present invention provides a replication-deficient human group B type 3 adenovirus, wherein the adenovirus lacks or knocks out the E1 region gene or part thereof.

[0016] In some embodiments, the replication-deficient human group B type 3 adenovirus is deleted or knocked out of the full-length gene of the E1 region.

[0017] In some embodiments, the replication-deficient human group B type 3 adenovirus also has the E3 region gene or a portion thereof deleted or knocked out.

[0018] In some embodiments, the replication-deficient human group B type 3 adenovirus has a deletion or knockout of the E3 region gene or a portion thereof, and replaces it with an exogenous gene or a portion thereof.

[0019] In some embodiments, the replication-deficient human group B type 3 adenovirus is deleted or knocked out of the E3 region gene or a portion thereof, and replaced with an exogenous reporter gene or a portion thereof. In some embodiments, the exogenous reporter gene can be selected from, but is not limited to, green fluorescent protein (GFP), enhanced GFP (EGFP), red fluorescent protein (RFP), blue fluorescent protein (BFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), etc.

[0020] The replication-deficient human group B type 3 adenovirus deletes or knocks out the E1 region gene or part thereof, and / or deletes or knocks out the E3 region gene or part thereof, and the exogenous nucleotide sequence is inserted into the site of the partially or completely deleted gene, for example, inserted into the site in the adenovirus genome where the E1 region gene or part thereof is deleted, and / or the E3 region gene or part thereof is deleted.

[0021] In some embodiments, the replication-deficient human group B type 3 adenovirus has a deletion or knockout of the E3 region gene or a portion thereof, and replaces it with a gene encoding an antigen protein or a portion thereof.

[0022] In some embodiments, the replication-defective human group B type 3 adenovirus comprises a nucleotide sequence encoding one or more capsid proteins selected from the group consisting of: hexon protein; penton protein; fiber protein.

[0023] In a third aspect, the present invention provides a replication-deficient human group B type 3 adenovirus vector, the adenovirus vector comprising:

[0024] An expression vector for expressing adenovirus with deleted or knocked-out E1 region gene or part thereof.

[0025] In some embodiments, the expression vector also deletes or knocks out the E3 region gene or a portion thereof.

[0026] In some embodiments, the expression vector also deletes or knocks out the E3 region gene or a portion thereof and replaces it with an exogenous gene or a portion thereof.

[0027] In some embodiments, the adenovirus is a replication-defective adenovirus.

[0028] In some embodiments, the adenovirus has a deletion or knockout of the E1 region gene or a portion thereof.

[0029] In some embodiments, the adenovirus is the adenovirus of the second aspect.

[0030] In some embodiments, the adenoviral vector further comprises an exogenous nucleotide sequence of interest encoding a protein or polypeptide.

[0031] Preferably, the exogenous nucleotide sequence is operably linked to an expression control sequence (which directs the translation, transcription and / or expression of the exogenous nucleotide sequence in animal cells) and an adenovirus packaging signal sequence.

[0032] Preferably, the exogenous nucleotide sequence encodes a target molecule. The target molecule may be a target protein or polypeptide. The exogenous nucleotide sequence may encode one or more, two or more, or three or more target molecules.

[0033] In a fourth aspect, the present invention provides a packaging system, comprising: the cell of the first aspect and the adenovirus vector of the third aspect.

[0034] In a fifth aspect, the present invention provides a method for preparing a replication-defective human group B type 3 adenovirus, the method comprising:

[0035] The replication-deficient human group B type 3 adenovirus vector of the third aspect is introduced into the cells of the first aspect, and the cells are cultured and the replication-deficient human group B type 3 adenovirus is harvested.

[0036] In some embodiments, the replication-deficient human group B type 3 adenovirus is prepared by culturing cells transfected with a replication-deficient human group B type 3 adenovirus vector under conditions that allow the adenovirus genome to replicate in the cells.

[0037] In a sixth aspect, the present invention provides an immunogenic composition, comprising the replication-deficient human group B type 3 adenovirus of the second aspect or the replication-deficient human group B type 3 adenovirus vector of the third aspect and optionally one or more other active ingredients, pharmaceutically acceptable carriers, diluents, excipients or adjuvants.

[0038] In some embodiments, the immunogenic composition is in a dosage form suitable for nasal drops or intramuscular injections, or oral enteric-coated administration.

[0039] In the seventh aspect, the present invention provides the cell of the first aspect, the replication-deficient human group B type 3 adenovirus of the second aspect, the replication-deficient human group B type 3 adenovirus vector of the third aspect, the packaging system of the fourth aspect, the replication-deficient human group B type 3 adenovirus prepared by the method for preparing the replication-deficient human group B type 3 adenovirus of the fifth aspect, or the immunogenic composition of the sixth aspect, used in the preparation of a human type 3 adenovirus vaccine.

[0040] In an eighth aspect, the present invention provides an immunogen, which is the E1B-55kDa protein of human group B type 3 adenovirus.

[0041] In a ninth aspect, the present invention provides antibodies produced by the immunogen of the eighth aspect.

[0042] In a tenth aspect, the present invention provides use of the immunogen of the eighth aspect or the antibody of the ninth aspect to detect the cells of the first aspect. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 The results of colony PCR identification of the recombinant expression vector pGEX-4T-3 / E1B2n are shown. M is DNA marker DL5000; lanes 1 to 8 are the PCR products of templates 1 to 8 of colonies of pGEX-4T-3 / E1B2n.

[0044] Figure 2 The results of the identification of the complementing cell line A3-293T are shown. Figure 2 A shows the results of western immunoblotting, M is the protein marker PM5100, and the primary antibody is anti-E1B2n serum; Figure 2 B shows the results of RT-PCR identification, M is DNA marker DL5000, lane 1 is RNA extracted from A3-293T cells, and lane 2 is RNA extracted from 293T cells.

[0045] Figure 3 The results of identifying adenovirus plasmids with E1 region deletion are shown. In the figure, M is DNA marker DL15000; Figure 3 A shows the results of PCR colony identification, upstream primer A3-468U and downstream primer A3-5134R, lanes 1-25 are pAd3eDE1 colony 1-25# template PCR products; Figure 3 In B, lanes 1-12 are single restriction enzyme digestion maps of plasmids pAd3eDE1-6#, 7#, 8#, 9#, 10#, 15#, 16#, 17#, 22#, 23#, 24#, and 25#BamHI, and lanes 13-24 are single restriction enzyme digestion maps of pAd3eDE1-6#, 7#, 8#, 9#, 10#, 15#, 16#, 17#, 22#, 23#, 24#, and 25#HindIII; Figure 3 C. Identification by SacI restriction enzyme digestion, lanes 1 and 2 are pAd3eDE1-7# and 17# respectively.

[0046] Figure 4 Electron microscopy results of a replication-defective adenovirus are shown.

[0047] Figure 5Shown is the genome replication of replication-defective adenovirus in different cell lines.

[0048] Figure 6 The expression of the late protein hexon in different cell lines of replication-defective adenovirus is shown.

[0049] Figure 7 A process roadmap for the preparation of replication-defective human group B type 3 adenovirus and its complementing cell line is shown. DETAILED DESCRIPTION

[0050] Human adenovirus (Ad) is a non-enveloped linear double-stranded DNA virus with a genome length of 25 to 45 kb. There are 100 to 150 bp inverted terminal repeats (ITR) at both ends. The packaging signal of about 300 bp at the 3' end of the left ITR is a cis-acting element necessary for Ad replication and packaging. According to the order of viral DNA replication, its genes can be divided into early and late transcription units. The early transcription unit expresses the E1A, E1B, E2A, E2B, E3 and E4 region genes related to viral replication. The deletion of the E1 region can prevent the virus from continuing to replicate. The product of the E2 region is a trans factor and replication essential factor expressed by the late transcription unit. E3 is a non-essential region for replication, and its deletion can expand the insertion capacity. The late transcription unit expresses the L1-L5 region genes related to Ad particle assembly.

[0051] The E1 region includes the entire E1B transcription unit, which encodes two major proteins: E1B-19K and E1B-55K. In adenovirus replication, the E1B-19K and E1B-55K proteins function to limit E1A-induced apoptosis in the early lytic cycle.

[0052] The virus particle diameter of Ad is 80 to 100 nm, and the relative molecular mass is about 175,000. The virus capsid is a 20-sided three-dimensional symmetrical structure, mainly composed of 252 capsids, including 240 hexons and 12 pentons. The hexon base is conserved, and there are 7 highly variable regions in the loop (Loop) 1 and Loop 2 variable regions, which are the main targets of neutralizing antibodies. The penton is located at the top corner of the capsid, composed of a penton base and a fiber. A ciliary protrusion extends from each top corner, and there is a nodule region at the end. Polypeptide IV mainly constitutes the virus trimer fiber, which is related to the virus hemagglutination activity and has type specificity. Exogenous antigen epitopes can be inserted into hexons, penton base proteins, fiber proteins and polypeptide IX, but do not affect the stability and function of the virus structure, and can induce specific immune responses.

[0053] Preferably, the adenovirus vector has a deletion or knockout of the adenovirus E3 gene. The deletion of the adenovirus E3 region increases the insertion capacity of exogenous nucleotides by about 5 kb. The present invention has found that for human group B type 3 adenovirus, the deletion of E3 has no effect on the yield of the viral vector. The E3 gene can be deleted or knocked out using conventional methods known in the art.

[0054] In the present invention, the target exogenous nucleotide sequence encodes target proteins and polypeptides, and the target proteins and polypeptides include antigens, molecular adjuvants, immunostimulatory proteins and recombinases.

[0055] Preferably, the antigen is an antigen derived from a pathogen. Preferably, the antigen is selected from: Mycobacterium tuberculosis, Plasmodium sp, influenza virus, human immunodeficiency virus (HIV), hepatitis C virus, cytomegalovirus, human papillomavirus, rabies virus, measles virus, mumps virus, rubella virus, coronavirus, respiratory syncytial virus (RSV), Zika virus, leishmania parasites or any mycobacterium species.

[0056] In some embodiments, the antigen is an antigen derived from a pathogen. Preferably, the pathogen is selected from bacteria, viruses, prions, fungi, protozoa and helminths.

[0057] In some embodiments, the target exogenous nucleotide sequence is a miRNA or an immunostimulatory RNA sequence.

[0058] Figure 7 The flowchart of the present invention for preparing replication-deficient human group B type 3 adenovirus and its complementing cell line is exemplified.

[0059] The complementation cell line of the replication-deficient human group B type 3 adenovirus of the present invention significantly increases the production of the replication-deficient virus. Figure 5 As shown, the viral copy number of replication-deficient adenovirus in human A549 cells continued to decrease, and it could proliferate in both 293T cells and complementing cell lines. The proliferation in the complementing cell line was better than that in 293T cells. At 96 hours, the viral load of replication-deficient adenovirus in the complementing cells was about 62.29 times that in the 293T cells, p<0.05; Figure 6 As shown, the replication-deficient adenovirus late protein Hexon was not expressed in human A549 cells, and its expression level in 293T cells was significantly lower than that in complementing cells, and its expression level in 293T cells was about 16% of that in complementing cells.

[0060] The human replication-deficient type B group 3 adenovirus of the present invention has high vaccine virulence. In the BALB / c mouse immunization experiment, the mouse serum immunized with the replication-deficient type B group 3 adenovirus can completely inhibit the infection of 100TCID50 virus amount of wild-type Ad3 at a dilution of 1:256 times; in the tree shrew challenge experiment, on the 3rd and 7th days after the challenge, the tree shrew produced an immune response to the exogenous protein EGFP, and at the same time, the titer of neutralizing antibodies against 100TCID50 Ad3 in the serum of the sacrifice group on the 7th day of the challenge reached 1:32.

[0061] The human replication-deficient adenovirus type 3 of the present invention has high safety and cannot replicate in normal human cells; in the tree shrew challenge experiment, the tree shrews in the experimental group showed no obvious clinical symptoms, the virus loads of various organs were negative on the 3rd and 7th days, and the morphology of the pathological tissue sections of the lung tissue was basically consistent with that of the control group.

[0062] The replication-deficient human group B type 3 adenovirus of the present invention can induce an immune response against wild-type Ad3, causing the body to produce a higher neutralizing antibody titer; the complementary cell line of the replication-deficient human group B type 3 adenovirus can effectively increase the yield of the adenovirus. The results of the challenge experiment showed that the replication-deficient human group B type 3 adenovirus of the present invention has high protection against wild-type Ad3 and vaccine safety, and can effectively induce the body to produce an immune response to the exogenous protein EGFP, further verifying the great potential of adenovirus as a vector vaccine. The replication-deficient vector vaccine has high vaccine protection and higher safety, and can be used to prevent infection and protection against human adenovirus.

[0063] The following are preferred embodiments of the present invention, and the present invention is not limited to the following preferred embodiments. It should be noted that for those skilled in the art, several modifications and improvements made on the basis of this invention and creation concept all belong to the protection scope of the present invention. The reagents used without indicating the manufacturer are all conventional products that can be obtained through commercial purchase.

[0064] The Ad3 used in this article is the HAdv-3 GZ01 virus strain, with a complete genome Genbank number of DQ099432.

[0065] Example

[0066] Example 1: Preparation of complementing cell line A3-293T cells

[0067] Through PCR, enzyme digestion, ligation, etc., the gene encoding the E1B 55kDa protein in the Ad3 E1 region (Genbank No.: DQ099432.4) was connected to the lentiviral vector pLVX-IRES-Puro, transfected into 293T cells, and the stable expression cell line A3-293T was selected by puromycin.

[0068] The specific steps are as follows:

[0069] (1) Construction of lentiviral expression vector: Ad3 was used as a template and primer pair A3-1960UN (gtgaattcaagccaccatggatccgccaaactcac, SEQ ID NO: 1) and A3-3384R (gctctagacactttagtcagtttcttcaccac, SEQ ID NO: 2) were used for PCR amplification. The amplified product was about 1500 bp. The PCR product was recovered using a kit after agarose gel electrophoresis and purified. The PCR product was double-digested with endonucleases Xba I + EcoR I. The PCR product after digestion was recovered using a kit after agarose gel electrophoresis. At the same time, pLVX-IRES-Puro was double-digested with Xba I + EcoR I to recover the large fragment, which was ligated with T4 DNA ligase to obtain pLVX-IRES-Puro / E1B, which was transformed into Stbl3 competent cells. After PCR identification using the A3-1960UN / A3-3384R primer pair, colony sequencing identification was performed using the PlvxA3-F (agatcgcctggagagacgccat, SEQ ID NO: 3) and PlvxA3-R (ttcggccagtaacgttaggg, SEQ ID NO: 4) primer pairs.

[0070] PCR reaction program: 98°C pre-denaturation for 1 min; 98°C denaturation for 10 s, 65°C annealing for 15 s, 72°C extension for 30 s, 30 cycles; 72°C extension for 2 min. The PCR reaction system is shown in Table 1 below.

[0071] Table 1

[0072]

[0073] (2) Preparation of specific antiserum for identification: Select the specific peptide segment in Ad3 E1B-55kDa polypeptide (Ad3E1B-2n,

[0074] tctgggagtagcagggatactgagacacccaccgaccatgccagcggttctgcaggaggagcagcaggaggacaatcc (SEQ ID NO: 19)), using primer pair A3E1B-2u

[0075] (gatccctgggagtagcagggatactgagacacccaccgaccatgccagcggttctgcaggaggagccagcaggaggacaatccggc, SEQ ID NO:5) and A3E1B-2r

[0076] (ggccgccggattgtcctcctgctgctcctcctgcagaaccgctggcatggtcggtgggtgtctcagtatccctgctactcccagg, SEQ ID NO: 6) was annealed to synthesize the Ad3E1B-2n coding gene fragment, and the product was about 85 bp. At the same time, pGEX-4T-3 was double-digested with BamH I+Not I to recover the large fragment. pGEX-4T-3 / E1B2n was obtained by ligation with T4 DNA ligase and transformed into Top10 competent cells.

[0077] Colony PCR was performed using primer pairs pGEX-4T-512U (tccaaaagagcgtgcagaga, SEQ ID NO: 7) and A3E1B-2013R (ggattgtcctcctgctgctcc, SEQ ID NO: 8). The product was about 503 bp. Figure 1 As shown. Four of the eight selected colonies (corresponding to lanes 1, 2, 6, and 7) were preliminarily judged as positive colonies, and the positive colonies were further sent for sequencing identification. The plasmid was extracted with a plasmid extraction kit, transformed into BL21 competent cells, induced to express with 1mM IPTG, and purified by affinity chromatography to obtain the fusion protein E1B2n-GST. BALB / C mice were subcutaneously immunized with the E1B2n-GST protein to obtain anti-E1B2n serum.

[0078] (3) Preparation of complementary cell line A3-293T cells:

[0079] ① Digest and dilute 293T cells to a concentration of 1-2×10 5Cells / mL were plated on a 6-well plate, 2 mL of cell suspension was added to each well, and the plate was cultured overnight in a 37°C, 5% CO2 incubator. When the cell density reached 80% to 90% the next day, DMEM medium with puromycin concentrations of 1 μg / mL, 3 μg / mL, 5 μg / mL, 7 μg / mL, and 9 μg / mL was added, and culture and observation were performed, and 5 μg / mL was selected as the optimal screening concentration.

[0080] ② Digest and dilute 293T cells to a concentration of 1-2×10 5 Cells / mL were plated on a 6-well plate, 2 mL of cell suspension was added to each well, and the plate was cultured overnight in a 37°C, 5% CO2 incubator. When the cell density reached 80% to 90% the next day, 293T cells were transfected with pLVX-IRES-Puro / E1B. After 48 hours of transfection, the maintenance medium containing 5 μg / mL of puromycin was replaced. The medium was changed every other day until all cells in the control wells died. The medium was then replaced with a maintenance medium containing 0.25 μg / mL of puromycin for subculture to obtain A3-293T cells.

[0081] ③ Identification of complementary cell line A3-293T cells: A3-293T cells were passaged to the 10th generation, A3-293T cells and 293T cells were lysed by SDS, and western blotting was performed using anti-E1B2n serum as the primary antibody. The target protein was 55 kDa. The results were as follows Figure 2 As shown in A. The results showed that the complementing cell line A3-293T cells can stably express the E1B-55KDa protein of human group B type 3 adenovirus, and the expression of this protein was not found in 293T cells that were not transfected with pLVX-IRES-Puro / E1B. Using RNA extracted from A3-293T cells and 293T cells with TranZOL reagent as templates, specific primers A3-1960UN / A3-3384R, PrimerScriptTM One Step RT-PCR Kit Ver.2 (TaKaRa) were used for RT-PCR identification. The product was about 1500bp, and the results were as shown in Figure 2 As shown in B. Figure 2 The results of B further verified that the complementation cell line A3-293T cells can stably express the E1B-55KDa protein of human group B adenovirus type 3.

[0082] Example 2: Preparation of replication-defective adenovirus Ad3eDE1 with E1 region deletion

[0083] Based on the backbone plasmid pBRAd△E3GFP (Zhang Q et al. Construction and characterization of a replication-competent human adenovirus type 3-based vector as a live-vaccine candidate and a viral delivery vector. Vaccine 2009; 27(8): 1145-53), the E1 region gene was deleted. The basic construction procedure is as follows: by PCR, restriction digestion, ligation, etc., the shuttle plasmid pAd3DE1LR with E1 region deletion was constructed, pBRAd△E3GFP was used as the backbone plasmid, and the adenovirus plasmid pAd3eDE1 with E1 region deletion was constructed by in vitro homologous recombination. After pAd3eDE1 was linearized, it was transfected into the complementation cell line A3-293T cells to package and rescue the replication-deficient adenovirus Ad3eDE1.

[0084] The specific steps are as follows:

[0085] (1) Amplification and construction of shuttle plasmid:

[0086] Using pBRAd△E3GFP as template, primer pair E1-LF (ccatcgatagtagttcgccagttaatagtttgc, SEQ ID NO: 9) and E1-LR (cgggatccccctagcgatcagctgacac, SEQ ID NO: 10) were used for PCR amplification. The amplified product was about 1287 bp. The PCR product was recovered with a kit after agarose gel electrophoresis. After purification, it was double-digested with endonucleases Cla I + BamHI. The PCR product after digestion was recovered with a kit after agarose gel electrophoresis. At the same time, the vector pBR322 was double-digested with Cla I + BamHI to recover the large fragment, which was ligated with T4 DNA ligase to obtain pAd3E1L, transformed into Top10 competent cells, and PCR identification was performed with E1-LF / E1-LR primer pair.

[0087] Similarly, using pBRAd△E3GFP as a template, primer pair E1-RF (cgggatccgcacgcgtagcttaacaggaatctttgatatgaat, SEQ ID NO: 11) and E1-RR (aaggtcgacatagagcacatcgccgagc, SEQ ID NO: 12) were used for PCR amplification, and the amplified product was about 1882 bp. The PCR product and pAd3E1L were recovered by double restriction digestion with BamH I + Sal I, and ligated with T4 DNA ligase to obtain pAd3E1LR, which was transformed into Top10 competent cells and identified by PCR with E1-RF / E1-RR primer pair.

[0088] PCR reaction program: 98℃ pre-denaturation for 1min; 98℃ denaturation for 10s, 54℃ annealing for 15s, 72℃ extension for 1min15s, 30 cycles; 72℃ extension for 2min. The PCR reaction system is shown in Table 2 below:

[0089] Table 2

[0090]

[0091] (2) Construction of E1-deleted human adenovirus type 3 plasmid: pAd3E1LR was digested with EcoRI-HF and the large fragment was recovered and self-ligated to obtain pAd3DE1L. Using pBRAd△E3GFP as a template, primer pair A3-32731U (aaagagctcttagccagccagaagccccccggga, SEQ ID NO: 13) and A3-33818R (ctctcaagggcatcggtcgac, SEQ ID NO: 14) were used for PCR amplification. The amplified product was about 1088 bp. The PCR product was recovered using a kit after agarose gel electrophoresis. After purification, it was double-digested with endonucleases SacI-HF+SalI-HF. The PCR product after digestion was recovered using a kit after agarose gel electrophoresis. At the same time, pAd3DE1L was double-digested with SacI-HF+SalI-HF to recover the large fragment, ligated with T4 DNA ligase, transformed into Top10 competent cells, and PCR identified with primer pair A3-32731U / A3-33818R. The plasmid was extracted for SacI-HF+SalI-HF digestion identification, and pAd3DE1LR was obtained after sequencing and verification with primer pair E1RU (aagctcctggagcgaggagaa, SEQ ID NO: 15) / E1RR2 (aagaagacagtcataagtgcgg, SEQID NO: 16). pAd3DE1LR was digested with XmaI, pBRAd△E3GFP was double-digested with AsisI+Pme, the large fragment was recovered, and homologous recombination was performed in the BJ5183 strain. Select the colonies and use the primer pair A3-468U (gtaggtgtcagctgatcgcta, SEQ ID NO: 17) / A3-5134R (atcgtctgattccctactcca, SEQ ID NO: 18) to perform PCR colony identification. The product is about 1989 bp. The results are as follows: Figure 3 A. Among them, 12 colonies successfully amplified PCR products with a size of 1989 bp, which were initially judged to be positive colonies. Plasmids were extracted and identified by single restriction enzyme digestion with endonucleases BamHI, HindIII, and SacI. The results are shown in Figure 3 B and Figure 3 C. The band and size of the enzyme digestion product were consistent with the theoretical value, and the plasmid pAd3eDE1 was obtained.

[0092] (3) Rescue of replication-defective virus: The plasmid pAd3eDE1 obtained above was linearized by endonuclease AsisI and then transfected into complementing cell line A3-293T cells to rescue and package the replication-defective adenovirus Ad3eDE1. After the virus was continuously passaged in A3-293T cells for 10 generations, the viral genome was extracted for restriction digestion and sequencing, indicating that the replication-defective viral genome remained stable.

[0093] (4) Electron microscopy: Ad3eDE1 was inoculated into a 100 mm dish of A3-293T cells and cultured for 3 to 4 days. The cells were collected and washed once with PBS, centrifuged at 1000 rpm for 5 min, and electron microscopy fixative (provided by Guangzhou Keyida Biotechnology Co., Ltd.) was slowly added. The cells were sent to Guangzhou Keyida Biotechnology Co., Ltd. for preparation of sections. Virus particles were observed under a transmission electron microscope. The results are as follows: Figure 4 It can be observed that the Ad3eDE1 virus particle is hexagonal in plan view, with a diameter of about 75 to 100 nm, which is the same as the normal Ad3 adenovirus particle.

[0094] (5) Virus preparation: One day before virus infection, use about 1×10 7 A3-293T cells were spread on 100mm dishes. The next day, the cell density was about 90%. The original culture medium was discarded and 9ml of fresh DMEM culture medium (containing 2% fetal bovine serum + 1% penicillin and streptomycin) was added. 0.1-1ml replication-deficient adenovirus solution was added and placed in a 37℃, 5% CO2 incubator for 2-4 days. When more than 90% of the cells were cytopathic, the cells and supernatant were collected. -80℃ / 37℃ were repeatedly frozen and thawed three times to break the cells. The cell freeze-thaw solution was centrifuged at 10000rpm for 30 minutes, the supernatant was collected, labeled after aliquoting, and frozen in a -80℃ refrigerator for later use. The virus infection titer (TCID50) was determined using A3-293T cells. The virus was cultured in large quantities (about 20-40 100mm dishes), the cells were collected, and after repeated freezing and thawing 3-4 times, the virus supernatant was collected by centrifugation. The virus was purified by CsCl discontinuous density gradient ultracentrifugation, and the virus concentration (VPs) was determined. The purified virus particles were diluted to 1×10 12 VPs / ml, the OD260 / OD280 ratio was determined to be approximately 1.2-1.4, and the endotoxin test was <10EU / ml.

[0095] Example 3: Infection, replication and proliferation characteristics of replication-deficient viruses in different cell lines

[0096] (1) Adenovirus preparation: One day before virus infection, subculture A3-293T cells in T25 culture flasks. When the cell density reaches 80% to 90%, discard the original culture medium, add fresh DMEM culture medium (containing 2% fetal bovine serum + 1% penicillin and streptomycin), inoculate 0.1 to 1 ml of virus solution, culture for 3 to 5 days, and observe the cytopathic effect. When more than 90% of the cells are cytopathic, collect the cells and supernatant by blowing. Repeat the freezing and thawing of the collected cells and supernatant at -80℃ / 37℃ for three times to break the cells, centrifuge at 10000rpm for 10min, collect the supernatant and dispense it into 1.5mL EP tubes, mark them and freeze them at -80℃ for future use. Use A3-293T cells to measure the virus infection titer (TCID50).

[0097] (2) Fluorescence analysis of Ad3eDE1 infection in different cell lines and passage in different cell lines: A3-293T cells, 293T cells, and A549 cells were digested and diluted to 1–2 × 10 5 Cells / mL, spread on 6-well cell culture plates, culture overnight at 37°C, 5% CO2. When the cell density reaches 80% to 90%, remove the culture medium, dilute the prepared replication-deficient adenovirus Ad3eDE1 with DMEM culture medium (containing 2% fetal bovine serum + 1% penicillin and streptomycin) to 100TCID50 / 0.1mL and inoculate the cells, 2mL / well, incubate at 37°C for 2hr, discard the virus solution and replace the maintenance culture medium for 3-5 days, observe the pathological changes, collect the supernatant and cells. -80°C / 37°C freeze-thaw three times, centrifuge at 10000rpm for 10min, collect the supernatant, re-inoculate to the cells after gradient dilution, incubate at 37°C for 2hr, discard the virus solution and replace the maintenance culture medium for 3-5 days, observe the pathological changes, collect the supernatant and cells. Freeze-thaw three times, centrifuge to collect the supernatant, re-inoculate to the cells after gradient dilution. The results of continuous culture for 2 to 4 generations showed that Ad3eDE1 virus could be continuously passaged in A3-293T and 293T cells, but not in A549 cells.

[0098] (3) Proliferation of Ad3eDE1 in different cell lines: A3-293T cells, 293T cells, and A549 cells were digested, plated on 96-well cell culture plates, and cultured overnight. When the cell density reached 80%, the same amount of Ad3eDE1 was infected, and the infected cells were collected at 12hr, 24hr, 36hr, 48hr, 60hr, 72hr, 84hr, and 96hr, with 3 parallel wells at each time point. The human adenovirus Q-PCR kit (Guangzhou Hexin Instrument Co., Ltd.) was used to determine the viral genome copy number at each time point by real-time quantitative PCR (Q-PCR) on the Applied Biosystems 7500PCR system. The gene copy number of Ad3eDE1 was quantified using the HAdV-3 type-specific primer pair in the kit. The results showed that Ad3eDE1 could replicate in A3-293T cells and 293T cells, but not in A549 cells. In addition, the replication efficiency in the complementary cell line A3-293T cells was higher than that in 293T cells. At 96 hours, the viral load in A3-293T cells was 62.29 times that in 293T cells, p<0.05.

[0099] (4) Expression of late genes of Ad3eDE1 in different cell lines: A3-293T cells, 293T cells, and A549 cells were digested and diluted to 2×10 5cells / mL, take 5 ml and pass it in a T25 cell culture flask. When the cell density is about 80%, inoculate 500 μl of virus solution containing 2×10 5 FFU. Incubate at 37℃ for 2 hours, discard the virus solution, wash 3 times with PBS, add incomplete culture medium, and continue to culture for 72 hours. Observe and record the cytopathic condition. Collect cells after 72 hours, centrifuge at 1000rpm for 5 minutes, gently discard the supernatant to 1ml, resuspend the cells as protein samples, take 100μl of cell suspension, add 5X SDS-PAGE protein loading buffer and mix well, heat at 100℃ or in a boiling water bath for 3-5 minutes to fully denature the protein. Take 10μl of protein sample solution and load it for western immunoblotting analysis and protein quantification analysis of hexon expression. The results show ( Figure 6 ), Ad3eDE1 can express the late protein Hexon in A3-293T cells and 293T cells, but not in A549; and the expression level in A3-293T cells is higher than that in 293T cells, and the expression level in 293T cells is 16% of that in A3-293T cells.

[0100] Example 4: Experiment on Immunization of Mice with Replication-Deficient Virus Ad3eDE1

[0101] (1) Immunization and serum collection: 4- to 6-week-old SPF female Balb / c mice were randomly divided into groups, with 5 mice in each group. Mice injected with PBS served as negative controls, and mice injected with Ad3e served as positive controls. Intramuscular injection, a total of 4 immunizations: Purified adenovirus Ad3e and Ad3eDE1 were injected intramuscularly to immunize mice, with a single immunization dose of 10 9 VPS / mouse. Two weeks after the last immunization, the mice were anesthetized with 3% sodium pentobarbital (1 mL / kg body weight) and blood was collected from the eye sockets. The blood samples were placed at room temperature for 4 hours and centrifuged at 10,000 rpm for 5 minutes. The serum was transferred to EP tubes and stored in a -80°C refrigerator for later use.

[0102] (2) Cell microneutralization experiment: Determine the virus titer of Ad3 and calculate TCID50. A549 cells were passaged one day before the experiment and plated on 96-well cell culture plates. The cell density was about 80-90% the next day. Inactivate mouse serum at 56°C for 30 min. Dilute the mouse immune serum by 2-fold gradient (1:8 to 1:16, with the highest dilution being 1:4096), mix with an equal volume of 100 TCID50 virus solution, and incubate at 37°C for 1 hr. Inoculate the mixed solution into a 96-well plate, set up 3 parallel wells for each serum dilution, and set up cell control wells and virus control wells. Cultivate for 3-5 days and observe under a microscope. The highest serum dilution that completely inhibits the appearance of cytopathic effect (CPE) is the serum neutralizing antibody titer. The results showed that the serum of mice immunized with Ad3eDE1 can completely inhibit the infection of 100 TCID50 virus of wild-type Ad3 (GZ01) at 1:256 times. The control group (PBS immunization group) had no inhibitory effect on the infection of 100TCID50 viral load of wild-type Ad3 (GZ01).

[0103] Example 5: Tree shrew challenge infection experiment

[0104] Healthy tree shrews were quarantined and weighed before entry. The pre-existing serum of animals to Ad3 was tested. Those with pre-existing serum below 1:8 were included in the experiment. Six animals were randomly divided into groups, with 2 animals in each group. They were humanely killed and sampled on the 3rd and 7th days after infection. The human replication-deficient virus type 3 (Ad3eDE1) was suspended in serum-free DMEM medium and 10 3.5 TCID50(2×10 5 IFU) / 100μl, 100μl virus suspension was instilled into each tree shrew through a single nostril. After the challenge, the animals were continuously observed and clinical symptoms (fecal characteristics, eating conditions, activity, nasal discharge, coughing, temperature measurement, and throat swab specimens) were recorded every day. Animals in each group were killed on the 3rd and 7th days after the challenge, and blood was collected. Serum was collected for immunological testing and neutralization experiments, and lung, trachea, nasal turbinates, liver, kidney, heart, brain, and spleen specimens were collected for qPCR detection of viral load. The experimental results showed that none of the six tree shrews showed obvious clinical symptoms. The throat swabs were positive for Ad3 qPCR on the 1st to 3rd day after challenge, with a CT value ≥30.02, and were negative from the 4th day onwards. The viral load of each organ was not detected on the 3rd and 7th days. On the 3rd and 7th days after challenge, the tree shrews produced an immune response to the exogenous protein EGFP. In the serum of the group sacrificed on the 7th day after challenge, the neutralizing antibody titer against Ad3 (GZ01) reached 1:32.

[0105] The above examples show that the replication-deficient human adenovirus type 3 Ad3eDE1 can induce an immune response against wild-type Ad3, causing the body to produce a higher neutralizing antibody titer; the complementary cell line A3-293T can effectively increase the production of Ad3eDE1. The results of the challenge experiment showed that Ad3eDE1 has high protection and vaccine safety against wild-type Ad3, and can effectively induce the body to produce an immune response to the exogenous protein EGFP, further verifying the great potential of adenovirus as a vector vaccine. Replication-deficient vector vaccines have higher vaccine protection and higher safety, and can be used to prevent infection and protection against human adenovirus.

Claims

A cell comprising a nucleotide sequence encoding the E1B-55kDa protein of human group B adenovirus type 3 or a portion thereof.

2. The cell according to claim 1, characterized in that The cell does not contain a nucleotide sequence encoding the E1A protein of a human group B adenovirus type 3 and / or a nucleotide sequence encoding the E1B-19K protein of a human group B adenovirus type 3.

3. The cell according to claim 1, characterized in that The cells are obtained by transducing nucleotides encoding the E1B-55 kDa protein or a portion thereof in the E1 region of human group B type 3 adenovirus into the cells.

4. The cell according to claim 1, characterized in that The cells do not carry the entire E1 region of human group B type 3 adenovirus, Preferably, the cells do not carry human group B adenovirus E1A protein and / or E1B-19K protein.

5. The cell according to claim 1, characterized in that The cells are 293T cells, HeLa cells, W162 cells, A549 cells or U87 cells. Preferably, the cells are 293T cells.

6. A replication-deficient human group B type 3 adenovirus, wherein the adenovirus lacks or knocks out the full length or part of the E1 region gene.

7. The adenovirus according to claim 6, characterized in that The adenovirus also lacks or knocks out the E3 region gene or part thereof, Preferably, the adenovirus lacks or knocks out the E3 region gene or part thereof, and replaces it with an exogenous reporter gene or part thereof. More preferably, the adenovirus deletes or knocks out the E3 region gene or part thereof, and replaces it with a gene encoding an antigen protein or part thereof.

8. The adenovirus according to claim 6, characterized in that The adenovirus comprises a nucleotide sequence encoding a capsid protein, Preferably, the capsid protein comprises one or more of hexon protein, penton protein or fiber protein.

9. A replication-deficient human group B type 3 adenovirus vector, comprising: An expression vector for expressing adenovirus with deleted or knocked-out E1 region gene or part thereof.

10. The adenoviral vector according to claim 9, characterized in that The expression vector also deletes or knocks out the E3 region gene or part thereof, Preferably, the expression vector also deletes or knocks out the E3 region gene or part thereof, and replaces it with an exogenous reporter gene or part thereof.

11. The adenoviral vector according to claim 9, characterized in that The adenovirus is a replication-defective adenovirus, Preferably, the adenovirus lacks or knocks out the E1 region gene or part thereof. More preferably, the adenovirus is the adenovirus according to any one of claims 6 to 8.

12. The adenoviral vector according to claim 9, characterized in that The adenoviral vector further comprises an exogenous nucleotide sequence encoding a target protein or polypeptide. Preferably, the exogenous nucleotide sequence is operably linked to an expression control sequence and an adenovirus packaging signal sequence. More preferably, the exogenous nucleotide sequence encodes a target molecule.

13. A packaging system, comprising: The cell according to any one of claims 1 to 5 and the adenoviral vector according to any one of claims 9 to 12.

14. A method for preparing a replication-deficient human group B type 3 adenovirus, the method comprising: The adenovirus vector according to any one of claims 9 to 12 is introduced into the cells according to any one of claims 1 to 5, and the cells are cultured and the replication-deficient human group B type 3 adenovirus is harvested.

15. An immunogenic composition, comprising the adenovirus according to any one of claims 6 to 8 or the adenovirus vector according to any one of claims 9 to 12, and optionally one or more other active ingredients, pharmaceutically acceptable carriers, diluents, excipients or adjuvants, Preferably, the immunogenic composition is in the form of an enteric-coated dosage form suitable for nasal drops, intramuscular injection, or oral administration.

16. Use of the cell according to any one of claims 1 to 5, the adenovirus according to any one of claims 6 to 8, the adenovirus vector according to any one of claims 9 to 12, the packaging system according to claim 13, the adenovirus prepared by the method according to claim 14, or the immunogenic composition according to claim 15 in the preparation of a human adenovirus type 3 vaccine.

17. An immunogen, which is the E1B-55kDa protein of human group B adenovirus type 3.

18. Antibodies produced by the immunogen of claim 17.

19. Use of the immunogen according to claim 17 or the antibody according to claim 18 in detecting the cell according to any one of claims 1 to 5.

Images