A recombinant virus of African swine fever virus gene and a vaccine prepared therefrom

Abstract

The present invention discloses a recombinant virus of African swine fever virus gene and a vaccine prepared therefrom. The recombinant virus expresses p150 protein or the p150 protein truncation, which is achieved by introducing a DNA molecule containing the coding gene of the p150 protein or the coding gene of the p150 protein truncation into the genome of the starting virus; the amino acid sequences of the p150 protein and the p150 protein truncation are shown in SEQ ID No: 2 and SEQ ID NO: 2 from the 111th to 1202nd position from the N-terminus, respectively. Experiments have shown that the recombinant virus or the vaccine prepared therefrom is inoculated into pigs by intramuscular injection, and then orally infected with a strong toxin, and the strain used is the African swine fever virus SY-18 strain; the pigs survive well after the toxin attack. It can be seen that the recombinant virus prepared by the present invention or the vaccine prepared therefrom has excellent immune protection effect against African swine fever virus. The present invention has important application value.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to a recombinant virus of African swine fever virus gene and a vaccine prepared therefrom. Background Art

[0002] African swine fever (ASF), a highly contagious disease of pigs caused by the African swine fever virus (ASFV), is a major threat to the pig industry. Neither inactivated nor live vaccines for ASF have been approved for marketing. Prevention and control of ASF has traditionally relied primarily on culling and carcass removal, coupled with strict biosecurity measures.

[0003] The African swine fever virus genome is 170-193 kb long and contains 150-180 ORFs, presumably encoding approximately 165 proteins. Numerous immune-related genes are present, but key protective genes remain largely unknown. Some studies suggest that p72, p30, and p54 together offer protective immunity, while others suggest that MGF505-7R, M448R, 9GL, UK, CD2v, EP153R, E199L, O61R, F317L, and CP312R contribute to immune protection.

[0004] In recent years, attenuated ASFV vaccine strains with deletions of the MGF360, MGF505, CD2v, UK, and A238L genes, as well as naturally attenuated strains isolated from domestic and wild boar populations, have demonstrated some protective efficacy in pigs. However, some strains have been shown in field trials to produce chronic adverse effects, such as skin ulcers, fever, joint swelling, stiff pigs, abortions in sows, and clinical abnormalities during the fattening period. Artificially deleted virus strains, such as those with deletions of the MGF / CD2v, I177L, I226R, A137R, and UK genes, have demonstrated promising immune responses. However, concerns about mutations in live vaccines have slowed the approval and marketing of these vaccines. Although recombinant and subunit vaccines constructed using ASFV genes such as p30, p54, and p72 have reportedly shown some efficacy, no more effective vaccines have been widely adopted. Therefore, the search for safer and more effective new vaccines remains a crucial and pressing challenge for African swine fever prevention and control in the pig industry. Summary of the Invention

[0005] The purpose of the present invention is to prevent or treat African swine fever.

[0006] The present invention first protects a recombinant virus. The recombinant virus expresses p150 protein or a truncated form of the p150 protein; the recombinant virus is produced by introducing a DNA molecule containing a gene encoding the p150 protein or a truncated form of the p150 protein into the genome of the original virus.

[0007] In the recombinant virus, the p150 protein may be the following a1) or a2) or a3):

[0008] a1) the amino acid sequence is the protein shown in SEQ ID No: 2;

[0009] a2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of a1);

[0010] a3) A protein obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No: 2.

[0011] In the recombinant virus, the truncated form of the p150 protein may be the following b1) or b2) or b3):

[0012] b1) the amino acid sequence of the protein shown in SEQ ID NO: 2 from positions 111 to 1202 from the N-terminus;

[0013] b2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of b1);

[0014] b3) A protein obtained by substituting and / or deleting and / or adding one or more amino acid residues in the amino acid sequence of SEQ ID NO: 2 from positions 111 to 1202 from the N-terminus.

[0015] The specific labels of the proteins in a2) or b2) are shown in Table 1.

[0016] Table 1. Sequences of tags

[0017] Label residue sequence Poly-Arg 5-6 (usually 5) RRRRR Poly-His 2-10 (usually 6) HHHHHH FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL HA 9 YPYDVPDYA

[0018] In the protein of a3) or b3) above, the substitution and / or deletion and / or addition of one or several amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.

[0019] The protein in a3) or b3) above can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0020] The gene encoding the protein in a3) above can be obtained by deleting one or more codons for amino acid residues from the DNA sequence shown in SEQ ID No: 1, and / or performing missense mutations of one or more base pairs, and / or attaching the coding sequence of the tag shown in Table 1 to its 5′ and / or 3′ end.

[0021] The gene encoding the protein in b3) above can be obtained by deleting one or more codons for amino acid residues from the DNA sequence shown in positions 331 to 3606 from the 5' end of SEQ ID NO: 1, and / or performing missense mutations of one or more base pairs, and / or linking the coding sequence of the tag shown in Table 1 to its 5' end and / or 3' end.

[0022] In the recombinant virus, the gene encoding the p150 protein may be the following DNA molecule c1) or c2) or c3) or c4):

[0023] c1) a DNA molecule whose coding region is shown in SEQ ID NO: 1;

[0024] c2) a DNA molecule with a nucleotide sequence as shown in SEQ ID NO: 1;

[0025] c3) a DNA molecule that hybridizes with the DNA molecule defined in c1) or c2) under stringent conditions and encodes any of the above-mentioned p150 proteins;

[0026] c4) A DNA molecule that has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the DNA molecule defined in c1) or c2) and encodes any of the above-mentioned p150 proteins.

[0027] In the recombinant virus, the gene encoding the truncated form of the p150 protein is the following DNA molecule d1) or d2) or d3) or d4):

[0028] d1) a DNA molecule having a coding region as shown in SEQ ID NO: 1, positions 331 to 3606 from the 5' end;

[0029] d2) a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 1, positions 331 to 3606 from the 5' end; d3) a DNA molecule that hybridizes with the DNA molecule defined in d1) or d2) under stringent conditions and encodes a truncated form of any of the above-mentioned p150 proteins;

[0030] d4) A DNA molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the DNA molecule defined in d1) or d2) and encoding a truncated form of any of the above-mentioned p150 proteins.

[0031] The stringent conditions are hybridization in a 2×SSC, 0.1% SDS solution at 68°C and washing the membrane twice for 5 minutes each time, and hybridization in a 0.5×SSC, 0.1% SDS solution at 68°C and washing the membrane twice for 15 minutes each time.

[0032] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0033] In the recombinant virus, the starting virus can be a virus that can produce transient infection, stable infection or continuous expression of exogenous genes in pigs but does not cause any abnormal clinical symptoms.

[0034] In the recombinant virus, the starting virus is specifically adenovirus, porcine reproductive and respiratory syndrome virus, pseudorabies virus, rabies virus, poxvirus of mammalian or avian origin, porcine encephalitis virus, classical swine fever virus, retrovirus or paramyxovirus. Specifically, the adenovirus can be human adenovirus type 5 or porcine adenovirus. The pseudorabies virus can be porcine pseudorabies virus. In an embodiment of the present invention, the rabies virus is specifically rabies virus SRV9 strain. The strain of porcine reproductive and respiratory syndrome virus can be PRRSV-A strain. The pseudorabies virus strain can be the candidate strain JL14-△gI / gE strain.

[0035] When the starting virus is adenovirus, the recombinant virus may be rAdv-p150 or rAdv-fp150 mentioned in the Examples.

[0036] When the starting virus is porcine reproductive and respiratory syndrome virus, the recombinant virus may be rPRRSV-p150 mentioned in the examples.

[0037] When the starting virus is pseudorabies virus, the recombinant virus may be PRV-p150 mentioned in the examples.

[0038] When the starting virus is rabies virus, the recombinant virus may be SRV9-p150 mentioned in the examples.

[0039] Any of the above-mentioned recombinant viruses can also express the structural protein of African swine fever virus.

[0040] The structural proteins of the African swine fever virus may be B646L protein and / or E183L protein. The B646L protein may be encoded by the B646L gene (GenBank accession number: MH766894.3). The E183L protein may be encoded by the E183L gene (GenBank accession number: MH766894.3).

[0041] When the starting virus is an adenovirus, the recombinant virus can be rAdv-p150 / B646L / E183L as described in the Examples. rAdv-p150 / B646L / E183L contains the p150 gene, the B646L gene, and the E183L gene. rAdv-p150 / B646L / E183L undergoes transcription and translation in cells to express the fusion protein p150 / B646L / E183L, which is composed of the p150 protein, the B646L protein, and the E183L protein.

[0042] The present invention also protects a vaccine for preventing African swine fever, which contains any of the above-mentioned recombinant viruses or a combination consisting of any of the above-mentioned recombinant viruses.

[0043] The vaccine may also contain any form of adjuvant (such as salt adjuvants such as aluminum gel, different polysaccharide adjuvants, biological protein adjuvants, nucleic acid adjuvants and / or nanomaterial adjuvants), immunopotentiators and / or regulators.

[0044] The present invention also protects a product for treating African swine fever, which contains any of the above-mentioned recombinant viruses or a combination consisting of any of the above-mentioned recombinant viruses.

[0045] The present invention also protects the use of any of the above-mentioned recombinant viruses or a combination consisting of any of the above-mentioned recombinant viruses in the preparation of a vaccine for preventing African swine fever.

[0046] The present invention also protects the use of any of the above-mentioned recombinant viruses or a combination consisting of any of the above-mentioned recombinant viruses in the preparation of products for treating African swine fever.

[0047] The combination of any of the above-mentioned recombinant viruses can be composed of at least two of any of the above-mentioned recombinant viruses.

[0048] The combination of any of the above-mentioned recombinant viruses can specifically consist of rAdv-p150 and SRV9-p150.

[0049] Any of the above-mentioned vaccines for preventing African swine fever is specifically prepared using any of the above-mentioned recombinant viruses as an antigen.

[0050] Any of the above-mentioned products for treating African swine fever uses any of the above-mentioned recombinant viruses as the main active ingredient.

[0051] Any of the above products may be a medicine.

[0052] The present invention also protects the use of any of the above-mentioned p150 proteins, any of the above-mentioned truncated p150 proteins, any of the above-mentioned p150 protein encoding genes, or any of the above-mentioned p150 protein encoding genes in the preparation of vaccines for preventing African swine fever.

[0053] The present invention also protects the use of any of the above-mentioned p150 proteins, any of the above-mentioned truncated p150 proteins, any of the above-mentioned p150 protein encoding genes, or any of the above-mentioned p150 protein encoding genes in the preparation of products for treating African swine fever.

[0054] Any of the above-mentioned African swine fevers may be caused by African swine fever virus. Any of the above-mentioned African swine fever viruses may specifically be African swine fever virus SY-18 strain.

[0055] The present application believes that the core sheath protein (such as p150 protein) of the African swine fever virus can also be remembered by the body's immune system. After expression in the body, it is expected to stimulate the body to produce specific immune protection reactions and recall reactions, so that the body can resist the infection of ASFV. The core sheath protein (such as p150 protein) is combined with other structural proteins (such as B646L protein and E183L protein) to further improve its immunity. Further experiments have shown that the recombinant virus constructed by the present invention or the vaccine prepared therefrom is inoculated into pigs by intramuscular injection, and then orally infected with a strong toxin. The strain used is the African swine fever virus SY-18 strain; the pigs survive well after the toxin attack; that is, the recombinant virus expressing the core sheath protein p150 protein immunizes pigs, which can completely resist the attack of the strong toxin without becoming ill, and can protect pigs, especially susceptible pigs, from natural infection or artificial attack of the African swine fever virus, and is used for the prevention of African swine fever. It can be seen that the recombinant virus prepared by the present invention or the vaccine prepared therefrom has excellent immune protection effect on African swine fever virus. The present invention has important application value. DETAILED DESCRIPTION

[0056] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0057] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0058] HEK293 AD cells were purchased from Invitrogen, Inc. Hereinafter, HEK293 AD cells were cultured in DMEM (Gibco, catalog number C119955bbBT) or complete suspension medium (Youkang Hengye, catalog number NC0303) supplemented with 1%-10% (v / v) calf serum.

[0059] BHK-21 cells were purchased from the China Veterinary Drug Administration. Hereinafter, BHK-21 cells were cultured in DMEM medium or full suspension medium containing 1%-10% (v / v) calf serum.

[0060] Marc-145 cells were purchased from the China Veterinary Drug Administration. Marc-145 cells were cultured in DMEM medium containing 1%-10% (v / v) calf serum.

[0061] The vector pacAd5 CMVK-NpA is an expression plasmid of foreign genes and was purchased from Invitrogen, USA.

[0062] The backbone plasmid pacAd59.2-100 was purchased from Invitrogen, USA.

[0063] The rabies virus vaccine strain in the following examples is specifically the rabies virus SRV9 strain (recorded in the following literature: Yue Junming, Hou Shikuan, Yin Zhen. Research status of oral immunization of rabies vaccine [J]. Chinese Journal of Zoonoses, 1994, 10(3): 32-35.), which is a attenuated vaccine strain.

[0064] The porcine reproductive and respiratory syndrome virus strain used in the following examples is PRRSV-A, which was synthesized by the applicant of the present invention at Jilin Kumei Biotechnology Co., Ltd., and its nucleotide sequence is shown in SEQ ID NO: 3, positions 59 to 15453 from the 5' end. PRRSV-A is a rescued attenuated vaccine strain.

[0065] The pseudorabies virus strain in the following examples is the candidate strain JL14-△gI / gE strain (described in the following document: Zhou Xintao. Construction and Characterization Study of Pseudorabies Virus Gene Deletion Strain JL14-△gI / gE / TK [D]. Jilin Agricultural University, 2018.). The specific construction method of the candidate strain JL14-△gI / gE strain is to attenuate the isolated and identified virulent JL strain by deleting the gI and gE genes through homologous recombination.

[0066] African swine fever virus SY-18 strain (GenBank accession number: MH766894.3; submitted on July 12, 2023) was isolated by the Epidemiology Research Laboratory of the Military Veterinary Research Institute in 2018. In the following examples, the African swine fever virus SY-18 strain used was the fourth-generation propagation virus of PAM cells and stored in aliquots at -80°C.

[0067] Example 1. Construction of African swine fever virus gene-recombinant adenovirus

[0068] 1. Construction of recombinant adenovirus carrying the African swine fever virus p150 gene (rAdv-p150)

[0069] 1. Construction of recombinant plasmid pAdCMV-p150

[0070] (1) The genomic DNA of African swine fever virus strain SY-18 was extracted and used as a template, and primers 150-F: 5'-TAAGCTTGATATCGAATTGCCACCATGGCCGATGAGCTAGAGCC-3' and 150-R: 5'

[0071] PCR amplification was performed using the primer pair consisting of -TCCCCCGGGCTGCAGTCATAAAATCCGAATATCACTATCATACTGT-3', and a gene fragment of about 4794 bp was recovered.

[0072] (2) The vector pacAd5 CMVK-NpA was digested with restriction endonuclease EcoRI, and the linearized plasmid pacAd5 CMVK-NpA was recovered.

[0073] (3) The gene fragment recovered in step (1) and the linearized plasmid pacAd5 CMVK-NpA recovered in step (2) are ligated to obtain the recombinant plasmid pAdCMV-p150.

[0074] 2. Obtaining rAdv-p150

[0075] (1) The recombinant plasmid pAdCMV-p150 was digested with the restriction endonuclease pacI to obtain the linearized recombinant plasmid pAdCMV-p150. The backbone plasmid pacAd59.2-100 was digested with the restriction endonuclease pacI to obtain the linearized backbone plasmid pacAd59.2-100.

[0076] (2) 2 μg of linearized recombinant plasmid pAdCMV-p150, 4 μg of linearized backbone plasmid pacAd59.2-100 and 200 μL of transfection reagent ( 2000, Invitrogen) were mixed and then co-transfected into HEK293AD cells. After 2-3 days, the transfected cells were passaged and grown into a monolayer, and then transfected 2-3 times according to the above steps.

[0077] (3) After completing step (2), when the cells have a large number of lesions such as rounding, freeze-thaw the cells, collect and save the freeze-thaw solution, and record them as P0 generation recombinant viruses. Inoculate the P0 generation recombinant virus into fresh HEK293 AD cells according to a certain ratio, freeze-thaw after 1-2 days of lesions, and collect and save the freeze-thaw solution, which is the P1 generation recombinant virus. Repeat the above steps to obtain P2 generation recombinant virus and P3 generation recombinant virus in turn.

[0078] (4) The P3 recombinant virus was titered, and the nucleic acid was extracted and used as a template for PCR amplification using the upstream primer p150: 5'-CGCAAATGGGCGGTAGGCGTG-3' and the downstream primer p150: 5'-CACTGCATTCTAGTTGTGGTTT-3' to obtain a PCR amplification product. The following determination was made: If the PCR amplification product of a recombinant virus contained a DNA fragment of approximately 4897 bp, the recombinant virus was the target recombinant adenovirus and was designated rAdv-p150.

[0079] rAdv-p150 contains the p150 gene with a nucleotide sequence as shown in SEQ ID NO: 1. rAdv-p150 is transcribed and translated in cells to express the p150 protein with an amino acid sequence as shown in SEQ ID NO: 2.

[0080] 2. Construction of recombinant adenovirus carrying the African swine fever virus B646L gene (rAdv-B646L)

[0081] 1. According to the method of steps 1 and 2 (1)-(3), the primer 150-F in step 1 (1) was replaced with the primer B646L-F: 5'-GCTTGATATCGAATTATGGCATCAGGAGGAGCTTTT-3', and the primer 150-R was replaced with the primer B646L-R: 5'-TCCCCCGGGCTGCAGGTTAGGTACTGTAACGCAGCACAG-3'. The other steps remained unchanged to obtain the P3 generation recombinant virus.

[0082] 2. The P3 recombinant virus obtained in step 1 was titered, and then the nucleic acid was extracted and used as a template. The identification primers (upstream primer: 5'-CGCAAATGGGCGGTAGGCGTG-3' and downstream primer: 5'

[0083] -CACTGCATTCTAGTTGTGGTTT-3') to obtain a PCR amplification product. The following determination was made: If the PCR amplification product of a recombinant virus contained a DNA fragment of approximately 2177 bp, the recombinant virus was the target recombinant adenovirus and was named rAdv-B646L.

[0084] rAdv-B646L contains the B646L gene (GenBank accession number: MH766894.3); rAdv-B646L is transcribed and translated in cells to express p72 protein (ie, B646L protein).

[0085] 3. Construction of recombinant adenovirus carrying the African swine fever virus CP204L gene (rAdv-CP204L)

[0086] 1. According to the method of steps 1 and 2 (1)-(3), the primer 150-F in step 1 (1) was replaced with the primer CP204L-F: 5'-TAAGCTTGATATCGAATTGCCACCATGGATTTTATTTTAAATATATCCATGAAA-3', and the primer 150-R was replaced with the primer CP204L-R: 5'-TCCCCCGGGCTGCAGGTTATTTTTTTTTTAAA AGTTTAATAACCATG-3'. The other steps remained unchanged to obtain the P3 generation recombinant virus.

[0087] 2. Titer the P3 recombinant virus obtained in step 1. Afterwards, nucleic acid was extracted and used as a template for PCR amplification using identification primers (upstream primer: 5'-CGCAAATGGGCGGTAGGCGTG-3' and downstream primer: 5'-CACTGCATTCTAGTTGTGGTTT-3') to obtain a PCR amplification product. The following determination was made: If the PCR amplification product of a recombinant virus contained a DNA fragment of approximately 821 bp, the recombinant virus was identified as the target recombinant adenovirus and designated rAdv-CP204L.

[0088] rAdv-CP204L contains the CP204L gene (GenBank accession number: MH766894.3); rAdv-CP204L is transcribed and translated in cells to express p30 protein (ie, P204L protein).

[0089] 4. Construction of recombinant adenovirus expressing African swine fever virus E183L gene (rAdv-E183L)

[0090] 1. According to the method of steps 1 and 2 (1)-(3), the primer 150-F in step 1 (1) was replaced with the primer E183L-F: 5'-TAAGCTTGATATCGAATTGCCACCATGGATTCTGAATTTTTTCAACCG-3', and the primer 150-R was replaced with the primer E183L-R: 5'-TCCCCCGGGCTGCAGGTTACAAGGAGTTTTCTAGGTCTTTATG-3'. The other steps remained unchanged to obtain the P3 generation recombinant virus.

[0091] 2. Titer the P3 recombinant virus obtained in step 1. Afterwards, nucleic acid was extracted and used as a template for PCR amplification using identification primers (upstream primer: 5'-CGCAAATGGGCGGTAGGCGTG-3' and downstream primer: 5'-CACTGCATTCTAGTTGTGGTTT-3') to obtain a PCR amplification product. The following determination was made: If the PCR amplification product of a recombinant virus contained a DNA fragment of approximately 791 bp, the recombinant virus was identified as the target recombinant adenovirus and designated rAdv-E183L.

[0092] rAdv-E183L contains the E183L gene (GenBank accession number: MH766894.3); rAdv-E183L is transcribed and translated in cells to express p54 protein (ie, E183L protein).

[0093] 5. Construction of recombinant adenovirus expressing p150 / B646L / E183L gene of African swine fever virus (rAdv-p150 / B646L / E183L)

[0094] 1. According to the method of steps 1 and 2 (1)-(3), the "gene fragment of about 4794 bp" in step 1 (1) is replaced with the three-gene fusion fragment, and the other steps remain unchanged to obtain the P3 generation recombinant virus.

[0095] The preparation method of the triple gene fusion fragment is as follows:

[0096] (1) Artificially synthesized fusion genes

[0097] The fusion gene consists of the nucleotide sequence of the p150 gene, the linker sequence, the nucleotide sequence of the B646L gene, the linker sequence and the nucleotide sequence of the E183L gene from 5' to 3'; the nucleotide sequence of the linker sequence is: gcaacaaacttctctctgctgaaacaagccggagatgtcgaagagaatc ctggaccg (SEQ ID NO: 5).

[0098] (2) Using the fusion gene synthesized in step (1) as a template, primers p150 / B646L / E183L-F: 5'

[0099] PCR amplification was performed using a primer pair consisting of primers p150 / B646L / E183L-R: 5'-TCCCCCGGGCTGCAGGTTACAAGGAGTTTTCTAGGTCTTTATG-3' to recover a gene fragment of about 7406 bp, i.e., the triple gene fusion fragment.

[0100] 2. The P3 recombinant virus obtained in step 1 was titered, and nucleic acid was extracted and used as a template for PCR amplification using identification primers (upstream primer: 5'-CGCAAATGGGCGGTAGGCGTG-3' and downstream primer: 5'-CACTGCATTCTAGTTGTGGTTT-3') to obtain a PCR amplification product. The following determination was made: If the PCR amplification product of a recombinant virus contained a DNA fragment of approximately 7602 bp, the recombinant virus was identified as the target recombinant adenovirus and designated rAdv-p150 / B646L / E183L.

[0101] rAdv-p150 / B646L / E183L contains the p150 gene, B646L gene and E183L gene. rAdv-p150 / B646L / E183L is transcribed and translated in cells to express the fusion protein p150 / B646L / E183L (i.e., fusion protein p150 / p72 / p54) composed of p150 protein, B646L protein and E183L protein.

[0102] VI. Construction of a recombinant adenovirus encoding a partial fragment of the African swine fever virus p150 gene (rAdv-fp150)

[0103] 1. Construction of recombinant plasmid pAdCMV-fp150

[0104] According to the method of step 1, replace the primer 150-F in step 1 (1) with primer 150-pF: 5'

[0105] -TAAGCTTGATATCGAATTGCCACCATGAACCGCAGATTCGGTGTCATT-3', primer 150-R was replaced with primer 150-pR: 5'-TCCCCCGGGCTGCAGTCAGTATCCGGCGTTGCCTTT-3', and other steps remained unchanged to obtain the recombinant plasmid pAdCMV-fp150.

[0106] 2. Obtaining rAdv-fp150

[0107] (1) According to the method of 2(1)-(3) in step 1, the recombinant plasmid pAdCMV-p150 was replaced with the recombinant plasmid pAdCMV-fp150, and the other steps remained unchanged to obtain the P3 generation recombinant virus.

[0108] (2) The P3 recombinant virus obtained in step (1) was titered, and then the nucleic acid was extracted and used as a template to identify the virus using the primers (upstream primer: 5'-CGCAAATGGGCGGTAGGCGTG-3' and downstream primer: 5'

[0109] -CACTGCATTCTAGTTGTGGTTT-3') to obtain a PCR amplification product. The following determination was made: If the PCR amplification product of a recombinant virus contained a DNA fragment of approximately 3531 bp, the recombinant virus was the target recombinant adenovirus and was named rAdv-fp150.

[0110] rAdv-fp150 contains the fp150 gene; rAdv-fp150 is transcribed and translated in cells to express the fp150 protein.

[0111] The fp150 gene differs from the p150 gene only in that nucleotides 1 to 330 and 3607 to 4755 from the 5' end of the p150 gene shown in SEQ ID NO: 1 are missing. The nucleotide sequence of the fp150 gene is shown in SEQ ID NO: 1, 331 to 3606 from the 5' end.

[0112] The fp150 protein differs from the p150 protein only in that amino acids 1 to 110 and 1203 to 1584 from the N-terminus of the p150 protein shown in SEQ ID NO: 2 are missing. The amino acid sequence of the fp150 protein is shown in SEQ ID NO: 2, from positions 111 to 1202 from the N-terminus.

[0113] Example 2: Immune protection test of the recombinant adenovirus containing the African swine fever virus gene constructed in Example 1

[0114] 1. Immunoprotective assay of rAdv-p150

[0115] 1. To rAdv-p150(10 8.5 TCID 50 ) were added with 100 μg of tuckahoe polysaccharide and aluminum gel adjuvant to obtain rAdv-p150 vaccine; in the rAdv-p150 vaccine, the concentration of aluminum gel adjuvant was 10%.

[0116] 2. To rAdv-p150(10 8.5 TCID 50 ) and rAdv-B646L(10 8.5 TCID 50 ) were added with 100 μg of tuckahoe polysaccharide and aluminum gel adjuvant to obtain rAdv-p150+rAdv-B646L vaccine; in the rAdv-p150+rAdv-B646L vaccine, the concentration of aluminum gel adjuvant was 10%.

[0117] 3. Fifteen pigs of the same age were randomly divided into a rAdv-p150 vaccine group, a rAdv-p150+rAdv-B646L vaccine group, and a control group, with 5 pigs in each group. The following treatments were then performed:

[0118] rAdv-p150 vaccine group: Each pig was immunized by intramuscular injection of rAdv-p150 vaccine, and the single injection dose of rAdv-p150 was 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0119] rAdv-p150+rAdv-B646L vaccine group: Each pig was immunized by intramuscular injection of rAdv-p150+rAdv-B646L vaccine, and the single injection dose of rAdv-p150 and rAdv-B646L was 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0120] Control group: No treatment was performed and the mice were fed in the usual manner for 14 days.

[0121] 4. On the 14th day after completing step 3 (i.e., the 14th day after the second immunization), oral infection with strong toxic virus (the strain used is African swine fever virus SY-18 strain, the toxic dose is 10 3.0 TCID 50 The survival of the pigs was observed within 28 days after the challenge.

[0122] The results are shown in Table 2. The results showed that the p150 protein had a significant protective effect against the African swine fever virus SY-18 strain.

[0123] Table 2. Survival after immune challenge

[0124]

[0125] Note: “ / ” means it does not exist.

[0126] II. Immune Effects of rAdv-p150 / B646L / E183L

[0127] 1. Fifteen pigs of the same age were randomly divided into a rAdv-p150 / B646L / E183L group, a rAdv-B646L+rAdv-E183L+rAdv-CP204L group, and a control group, with 5 pigs in each group. The following treatments were then performed:

[0128] rAdv-p150 / B646L / E183L group: Each pig was immunized by intramuscular injection of rAdv-p150 / B646L / E183L. The single injection dose of rAdv-p150 / B646L / E183L was 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0129] rAdv-B646L+rAdv-E183L+rAdv-CP204L group: Each pig was immunized by intramuscular injection of rAdv-B646L, rAdv-E183L and rAdv-CP204L. The single injection dose of rAdv-B646L, rAdv-E183L and rAdv-CP204L was 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0130] Control group: No treatment was performed and the mice were fed in the usual manner for 14 days.

[0131] 2. On the 14th day after completing step 1 (i.e., the 14th day after the second immunization), oral infection with strong toxin (the strain used is African swine fever virus SY-18 strain, the toxin dose is 10 3.0 TCID 50 The survival of the pigs was observed within 28 days after the challenge.

[0132] The results are shown in Table 3. All pigs in the control group and the rAdv-B646L+rAdv-E183L+rAdv-CP204L group became ill and died, while all five pigs in the rAdv-p150 / B646L / E183L group survived. The results demonstrate that the fusion combination of p150, p72, and p54 proteins has significant protective effects against the SY-18 strain of African swine fever virus.

[0133] Table 3. Survival after immune challenge

[0134]

[0135] Note: “ / ” means it does not exist.

[0136] 3. Immune Effects of rAdv-fp150

[0137] 1. To rAdv-fp150(10 8.5 TCID 50 ) were added with 100 μg of Acanthopanax senticosus polysaccharide and aluminum gel adjuvant to obtain rAdv-fp150 vaccine; in the rAdv-fp150 vaccine, the concentration of the aluminum gel adjuvant was 10%.

[0138] 2. Fifteen pigs of the same age were randomly divided into the rAdv-fp150 group, the rAdv-B646L+rAdv-E183L+rAdv-CP204L group, and the control group, with 5 pigs in each group. The following treatments were then performed:

[0139] rAdv-fp150 group: Each pig was immunized by intramuscular injection of rAdv-fp150 vaccine, and the single injection dose of rAdv-fp150 was 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0140] rAdv-B646L+rAdv-E183L+rAdv-CP204L group: Each pig was injected intramuscularly with rAdv-B646L, rAdv-E183L and rAdv-CP204L. The single injection dose of rAdv-B646L, rAdv-E183L and rAdv-CP204L was 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0141] Control group: No treatment was performed and the mice were fed in the usual manner for 14 days.

[0142] 3. On the 14th day after step 2 (i.e., the 14th day after the second immunization), oral infection with strong toxic virus (the strain used is African swine fever virus SY-18 strain, the toxic dose is 103.0 TCID 50 The clinical manifestations and final outcomes of the pigs were observed within 28 days after challenge.

[0143] The results are shown in Table 4: All pigs in the control group and the rAdv-B646LrAdv-E183L+rAdv-CP204L group became ill and died, while the four pigs in the rAdv-fp150 group survived. The results show that the fp150 protein has a significant protective effect against the SY-18 strain of African swine fever virus.

[0144] Table 4. Survival after immune challenge

[0145]

[0146]

[0147] Example 3. Construction of African swine fever virus p150 gene-recombinant porcine reproductive and respiratory syndrome virus (rPRRSV-p150)

[0148] 1. Construction of plasmid pcDNA-HH-PRRSV-p150

[0149] (1) Plasmid pcDNA3.1 (product of Invitrogen, USA, catalog number V790-20) and DNA molecules were seamlessly cloned using In-Fusion enzyme to obtain plasmid pcDNA-HH.

[0150] The DNA molecule consists of the coding gene of hammerhead ribozyme (HamRz), the recognition sequence of restriction endonuclease EcoRV and the coding gene of hepatitis delta ribozyme (HdvRz) from 5' end to 3' end.

[0151] (2) Reverse transcription was performed using the total RNA of the PRRSV-A strain as a template to obtain the genomic DNA of the PRRSV-A strain (i.e., the complete PRRSV genome sequence). The genomic DNA of the PRRSV-A strain and the plasmid pcDNA-HH were then seamlessly cloned using In-Fusion enzyme to obtain the plasmid pcDNA-HH-PRRSV.

[0152] (3) The recognition sequence of restriction endonuclease PacⅠ and the transcriptional regulatory sequence TRS were inserted between ORF1 and ORF2 on the genomic DNA of PRRSV-A strain in the plasmid pcDNA-HH-PRRSV to obtain the plasmid pcDNA-HH-PRRSV-TRS.

[0153] The plasmid pcDNA-HH-PRRSV-TRS contains the nucleotide sequence of HamRz-PRRSV (5'

[0154] (UTR-ORF1-PacⅠ-TRS-ORF2-ORF3-ORF4-ORF5-ORF6-ORF7-3'UTR)-HdvRz fragment. In SEQ ID NO:3, from the 5' end, positions 1-58 are the gene encoding the hammerhead ribozyme (HamRz), positions 12048-12056 are the recognition site for the restriction endonuclease PacⅠ, positions 12057-12087 are the transcriptional regulatory sequence TRS, and positions 15454-15537 are the gene encoding the hepatitis delta ribozyme (HdvRz).

[0155] (4) Using the genomic DNA of African swine fever virus strain SY-18 as a template, primers 3:5'

[0156] -TAGGCCTGAATTGATATGGCCGATGAGCTAGAGCC-3' and primer 4:5'

[0157] -TCCCCCGGGCTGCAGTCATAAGGGTTGCCGCGGAAC-3' was used for PCR amplification (primers were designed according to the instructions of Takara's seamless cloning enzyme In-Fusion) to obtain the target fragment carrying the p150 gene fragment.

[0158] (5) Insert the target fragment carrying the p150 gene fragment obtained in step (4) into the restriction endonuclease PacI recognition site of the plasmid pcDNA-HH-PRRSV-TRS to obtain the plasmid pcDNA-HH-PRRSV-p150.

[0159] 2. Obtaining rPRRSV-p150

[0160] (1) The plasmid pcDNA-HH-PRRSV-p150 was transfected into BHK-21 cells. After 3 days, the cells were frozen and thawed twice. The supernatant was collected and transferred to Marc-145 cells. The cells were observed for 4 days. If cytopathic effects were observed, the recombinant virus was successfully rescued and the recombinant virus was obtained.

[0161] (2) The recombinant virus obtained in step (1) was titered, and then the nucleic acid was extracted and used as a template for RT-PCR amplification using 5'-TGCTGGAAAGTGATGTTGGAC-3' and 5'-TGCTCAGGGTGAACGGTAGA-3' to obtain a PCR amplification product. The following determination was then made: If the PCR amplification product of a recombinant virus contained a DNA fragment of approximately 5520 bp, the recombinant virus was the target recombinant porcine reproductive and respiratory syndrome virus and was designated rPRRSV-p150.

[0162] Example 4, rPRRSV-p150 immune protection test constructed in Example 3

[0163] 1. To rPRRSV-p150(10 5.7 TCID 50 ) were added with 100 μg of Acanthopanax senticosus polysaccharide and aluminum gel adjuvant to obtain rPRRSV-p150 vaccine; in the rPRRSV-p150 vaccine, the concentration of the aluminum gel adjuvant was 10%.

[0164] 2. Fifteen pigs of the same age were randomly divided into an rPRRSV-p150 group, a rAdv-B646L+rAdv-E183L+rAdv-CP204L group, and a control group, with 5 pigs in each group. The following treatments were then performed:

[0165] rPRRSV-p150 group: Each pig was immunized by intramuscular injection of rPRRSV-p150 vaccine, and the single injection dose of rPRRSV-p150 was 10 6.5 TCID 50 / ml; immunization was performed twice, with an interval of 14 days between the two times.

[0166] rAdv-B646L+rAdv-E183L+rAdv-CP204L group: Each pig was injected intramuscularly with rAdv-B646L, rAdv-E183L and rAdv-CP204L, with a single injection dose of 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0167] Control group: No treatment was performed and the mice were fed in the usual manner for 14 days.

[0168] 3. On the 14th day after step 2 (i.e., the 14th day after the second immunization), oral infection with strong toxic virus (the strain used is African swine fever virus SY-18 strain, the toxic dose is 10 3.0 TCID 50 The clinical manifestations, body temperature and final outcome of the pigs were observed for 28 days after the challenge.

[0169] The results are shown in Table 5: All pigs in the control group and rAdv-B646L+rAdv-E183L+rAdv-CP204L group became ill and died; in the rPRRSV-p150 group, 4 of the 5 pigs survived and 1 died.

[0170] Table 5. Survival after immune challenge

[0171]

[0172] Example 5. Construction of African swine fever virus p150 gene-recombinant pseudorabies virus (PRV-p150)

[0173] 1. Construction of recombinant plasmid pUC-ΔTK-EGFP-p150

[0174] (1) The EGFP gene (purchased from Bio-Tech, catalog number: D2626-100 μg) was inserted into the EcoRI position of the plasmid pUC19 (Takara, catalog number: 3219) by in-fusion seamless cloning to obtain the plasmid pUC-EGFP.

[0175] (2) The left homologous arm (located approximately 1100 bp to the left of the TK gene, named TK-Left Arm) and the right homologous arm (located approximately 1200 bp to the right of the TK gene, named TK-Right Arm) of the TK gene in the genome of the candidate strain JL14-ΔgI / gE were cloned into the restriction endonucleases XbaI and SphI of the plasmid pUC-EGFP, respectively, to obtain the plasmid pUC-ΔTK-EGFP.

[0176] (3) Using the genomic DNA of African swine fever virus strain SY-18 as a template, PCR amplification was performed using primer 5: 5'-CTACCGGTCGCCACCATGGCCGATGAGCTAGAGCC-3' and primer 6: 5'-AGAGAAGTTTGTTGCTCATAAAATCCGAATATCACTATCATACTGT-3' (primers were designed according to the instructions of Takara's seamless cloning enzyme In-Fusion) to obtain the target fragment carrying the p150 gene fragment.

[0177] (4) Insert the target fragment carrying the p150 gene fragment obtained in step (3) between the Kozak sequence (nucleotide sequence is GCCACC) and the EGFP gene of the plasmid pUC-ΔTK-EGFP to obtain the recombinant plasmid pUC-ΔTK-EGFP-p150.

[0178] 2. Acquisition of PRV-p150

[0179] (1) The recombinant plasmid pUC-ΔTK-EGFP-p150 was transfected into BHK-21 cells. After 5 h of transfection, four rounds of purification were performed to collect fluorescent cells. The steps of each round of purification were as follows: the transfected BHK-21 cells were infected with the candidate strain JL14-ΔgI / gE at an MOI of 0.1, cultured for 24 h, and then the cells emitting green fluorescence were picked and transferred to fresh normal BHK-21 cells.

[0180] (2) After completing step (1), the fluorescent cells were frozen and thawed three times, inoculated onto BHK-21 cells and subjected to three rounds of limiting dilution to obtain a fluorescent cell dilution solution, i.e., the recombinant virus.

[0181] (3) The recombinant virus obtained in step (2) was titered, and then the nucleic acid was extracted and used as a template for RT-PCR amplification using 5'-GGCTGACCGCCCAACGA-3' and 5'-CCTTGCTCACCATCGGTCC-3' to obtain a PCR amplification product. The following determination was then made: If the PCR amplification product of a recombinant virus contained a DNA fragment of approximately 5316 bp, the recombinant virus was the target recombinant pseudorabies virus and was designated PRV-p150.

[0182] Example 6: PRV-p150 immune protection test constructed in Example 5

[0183] 1. To PRV-p150(10 6.5 TCID 50 ) were added with 100 μg of Acanthopanax senticosus polysaccharide and nano-aluminum gel adjuvant to obtain PRV-p150 vaccine; in the PRV-p150 vaccine, the concentration of the nano-aluminum gel adjuvant was 4%.

[0184] 2. Fifteen pigs of the same age were randomly divided into a PRV-p150 group, a rAdv-B646L+rAdv-E183L+rAdv-CP204L group, and a control group, with 5 pigs in each group. The following treatments were then performed:

[0185] PRV-p150 group: Each pig was immunized by intramuscular injection of PRV-p150 vaccine, and the single injection dose of PRV-p150 was 10 7.0 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0186] rAdv-B646L+rAdv-E183L+rAdv-CP204L group: Each pig was injected intramuscularly with rAdv-B646L, rAdv-E183L and rAdv-CP204L. The single injection dose of rAdv-B646L, rAdv-E183L and rAdv-CP204L was 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0187] Control group: No treatment was performed and the mice were fed in the usual manner for 14 days.

[0188] 3. On the 14th day after step 2 (i.e., the 14th day after the second immunization), oral infection with strong toxic virus (the strain used is African swine fever virus SY-18 strain, the toxic dose is 10 3.0 TCID 50 The clinical manifestations, body temperature and final outcome of the pigs were observed for 28 days after the challenge.

[0189] The results are shown in Table 6: All pigs in the control group and rAdv-B646L+rAdv-E183L+rAdv-CP204L group became ill and died; three of the five pigs in the PRV-p150 group had a mild fever and eventually recovered; two pigs developed anorexia, depression, lay on the ground, had a high fever, and died.

[0190] Table 6. Survival after immune challenge

[0191]

[0192]

[0193] Example 7. Construction of African swine fever virus p150 gene-recombinant rabies virus (abbreviated as SRV9-p150)

[0194] 1. Construction of recombinant plasmid pcDNA3.1-SRV9-p150 (i.e., RABV full-length genome transcription vector)

[0195] (1) The nucleotide sequence HamRZ-SRV9-pacI-HdvRZ shown in SEQ ID NO: 4 was inserted into the recognition site of the restriction endonuclease EcoR V of the plasmid pcDNA3.1 to obtain the pcDNA3.1-SRV9-PacI plasmid.

[0196] The HamRZ-SRV9-pacI-HdvRZ sequence includes ribozyme and cDNA sequence of the full-length genome of rabies virus SRV9 strain, and a recognition site for restriction endonuclease PacI is introduced between the P gene and M gene of the cDNA sequence of the full-length genome of rabies virus SRV9 strain.

[0197] (2) The pcDNA3.1-SRV9-PacI plasmid was digested with the restriction endonuclease PacI to obtain a linearized vector.

[0198] (3) Using the genomic DNA of African swine fever virus strain SY-18 as a template, primers 7:5'

[0199] -AACACCACTGCCACCATGGCCGATGAGCTAGAGCC-3' and primer 8:5'

[0200] -GTTGCCTGTTTTTTTCATCATAAAATCCGAATATCACTATCATACTGT-3' was used for PCR amplification to obtain a target fragment carrying the p150 gene fragment, which has homology arms of rabies virus (RABV) on both sides.

[0201] (4) The linearized vector obtained in step (2) and the target fragment carrying the p150 gene fragment obtained in step (3) are connected by in-fusion to obtain the recombinant plasmid pcDNA3.1-SRV9-p150.

[0202] 2. Construction of expression helper plasmid

[0203] The SRV9-N gene was inserted into the recognition site of restriction endonuclease EcoR V of plasmid pcDNA3.1 to obtain plasmid pcDNA3.1-N. The GenBank number of the SRV9-N gene is AF499686.2, specifically bp 71-1423 of the rabies virus SRV9 strain.

[0204] The SRV9-P gene was inserted into the recognition site of the restriction endonuclease EcoR V of the plasmid pcDNA3.1 to obtain the plasmid pcDNA3.1-P. The GenBank number of the SRV9-P gene is AF499686.2, specifically bp 1514-2407 of the rabies virus SRV9 strain.

[0205] The SRV9-G gene was inserted into the recognition site of the restriction endonuclease EcoR V of the plasmid pcDNA3.1 to obtain the plasmid pcDNA3.1-G. The GenBank number of the SRV9-G gene is AF499686.2, specifically bp 3317-4891 of the rabies virus SRV9 strain.

[0206] The SRV9-L gene was inserted into the recognition site of the restriction endonuclease EcoR V of the plasmid pcDNA3.1 to obtain the plasmid pcDNA3.1-L. The GenBank number of the SRV9-L gene is AF499686.2, specifically bp 5414-11797 of the rabies virus SRV9 strain.

[0207] 3. Acquisition of SRV9-p150

[0208] (1) BSR-T7 cells (Golden Hamster Kidney cells, Shanghai Cell Bank, Catalog No. BFN60810674) were plated in 6-well plates. After BSR-T7 cells grew to a monolayer, 5 μg of recombinant plasmid pcDNA3.1-SRV9-p150, 1 μg of plasmid pcDNA3.1-N, 0.5 μg of plasmid pcDNA3.1-P, 0.7 μg of plasmid pcDNA3.1-G, 1 μg of plasmid pcDNA3.1-L, and 17 μL of Transfection were added. Reagent (Mirus) and Opti-MEM (Gibco) were added to obtain 100 μL of transfection system. Transfection was then performed. The transfected cells were monitored daily. After 5-7 days, the reconstituted cells were scraped and evenly distributed. A portion was inoculated onto a new monolayer of BSR-T7 cells at a 5% (v / v) inoculum to continue the culture. The remaining reconstituted cells were collected.

[0209] Blank control: BSR-T7 cells were plated in a 6-well plate; after the BSR-T7 cells grew to a monolayer, they were cultured for 5-7 days and then the recombinant cells were directly scraped and evenly distributed. A portion was inoculated into a new monolayer of BSR-T7 cells and continued to expand the culture at an inoculum size of 5% (V / V); the remaining recombinant cells were collected.

[0210] (2) The cells collected in step (1) were subjected to direct immunofluorescence identification (for RABV-N and -p150, and then the following judgment was made: if a recombinant cell had a fluorescent signal and the blank control had no fluorescent signal, the recombinant cell was the target recombinant rabies virus and was named SRV9-p150.

[0211] The FITC-labeled RABV antibody required for immunofluorescence identification was purchased from Jilin Zijing Shenzhou Biotechnology Co., Ltd., catalog number ZJ-023-016.

[0212] Example 8, SRV9-p150 immune protection test constructed in Example 7

[0213] 1. Fifteen pigs of the same age were randomly divided into an SRV9-p150 group, a rAdv-B646L+rAdv-E183L+rAdv-CP204L group, and a control group, with 5 pigs in each group. The following treatments were then performed:

[0214] SRV9-p150 group: Each pig was immunized by intramuscular injection of SRV9-p150, and the single injection dose of SRV9-p150 was 10 8.0 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0215] rAdv-B646L+rAdv-E183L+rAdv-CP204L group: Each pig was injected intramuscularly with rAdv-B646L, rAdv-E183L and rAdv-CP204L, with a single injection dose of 10 8.5 TCID 50 ; A total of 2 immunizations were given, with an interval of 14 days between the two.

[0216] Control group: No treatment was performed and the mice were fed in the usual manner for 14 days.

[0217] 2. On the 14th day after completing step 1 (i.e., the 14th day after the second immunization), oral infection with strong toxin (the strain used is African swine fever virus SY-18 strain, the toxin dose is 10 3.0 TCID 50 The clinical manifestations, body temperature and final outcome of the pigs were observed for 28 days after the challenge.

[0218] The results are shown in Table 7: All pigs in the control group and rAdv-B646L+rAdv-E183L+rAdv-CP204L group became ill and died, while all 5 pigs in the SRV9-p150 group were alive and well.

[0219] Table 7. Survival after immune challenge

[0220]

[0221] Example 9: Cross-immune protection test of rAdv-p150 constructed in Example 1 and SRV9-p150 constructed in Example 7

[0222] 1. Ten pigs of the same age were randomly divided into a cross-immunization group and a control group, with 5 pigs in each group. The following treatments were then performed:

[0223] Cross-immunization group: Each pig was first immunized by intramuscular injection of rAdv-p150, with a single injection dose of 10 8.5 TCID 50 ; After 14 days, each pig was boosted with SRV9-p150 injected intramuscularly. The single injection dose of SRV9-p150 was 10 8.0 TCID 50 .

[0224] Control group: No treatment was performed and the mice were fed in the usual manner for 14 days.

[0225] 2. On the 14th day after completing step 1 (i.e., the 14th day after the second immunization), oral infection with strong toxin (the strain used is African swine fever virus SY-18 strain, the toxin dose is 10 3.0 TCID 50The clinical manifestations, body temperature and final outcome of the pigs were observed for 28 days after the challenge.

[0226] The results are shown in Table 8: All pigs in the control group became ill and died, while 4 of the 5 pigs in the cross-immunization group survived and 1 died.

[0227] Table 8. Survival after immune challenge

[0228]

[0229] It can be seen that the p150 gene or part of its gene (such as the fp150 gene) can be used as the target gene to construct recombinant viruses of different viral vectors; these recombinant virus culture fluids can be used directly or mixed with adjuvants and immunopotentiators, and can show good immune protection effects, which can protect susceptible pigs from natural infection or artificial infection of African swine fever virus, and can be used for the prevention of African swine fever.

[0230] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. A recombinant virus, characterized in that: The recombinant virus expresses p150 protein or a truncated form of the p150 protein; the recombinant virus is achieved by introducing a DNA molecule containing a gene encoding the p150 protein or a gene encoding the truncated form of the p150 protein into the genome of the starting virus; The p150 protein is as follows a1) or a2): a1) the amino acid sequence is the protein shown in SEQ ID No: 2; a2) a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of a1); The truncated form of the p150 protein is as follows: b1) or b2): b1) the amino acid sequence of the protein shown in SEQ ID NO: 2, from positions 111 to 1202 from the N-terminus; b2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of b1).

2. The recombinant virus according to claim 1, characterized in that: The gene encoding the p150 protein is the following DNA molecule c1) or c2): c1) a DNA molecule whose coding region is represented by SEQ ID NO: 1; c2) A DNA molecule having a nucleotide sequence as shown in SEQ ID NO:

1.

3. The recombinant virus according to claim 1, characterized in that: The gene encoding the truncated form of the p150 protein is the following DNA molecule d1) or d2): d1) a DNA molecule having the coding region as shown in SEQ ID NO: 1, positions 331 to 3606 from the 5' end; d2) A DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 1 at positions 331 to 3606 from the 5' end.

4. The recombinant virus according to claim 1, characterized in that: The starting virus is a virus that can produce transient infection, stable infection or continuous expression of foreign genes in pigs but does not cause any abnormal clinical symptoms.

5. The recombinant virus according to claim 4, characterized in that: The starting virus is adenovirus, porcine reproductive and respiratory syndrome virus, pseudorabies virus, rabies virus, poxvirus of mammalian or avian origin, porcine encephalitis virus, classical swine fever virus, retrovirus or paramyxovirus.

6. The recombinant virus according to claim 1, characterized in that: The recombinant virus also expresses the structural protein of African swine fever virus; The structural proteins of the African swine fever virus are B646L protein and E183L protein; B646L protein is encoded by the B646L gene with GenBank accession number MH766894.3; E183L protein is encoded by the E183L gene with GenBank accession number MH766894.3; The recombinant virus expresses the fusion protein p150 / B646L / E183L composed of p150 protein, B646L protein and E183L protein.

7. A vaccine for preventing African swine fever, comprising the recombinant virus according to any one of claims 1 to 6 or a combination consisting of the recombinant viruses according to any one of claims 1 to 6. 8.e1) or e2): e1) Use of the recombinant virus according to any one of claims 1 to 6 or a combination consisting of the recombinant viruses according to any one of claims 1 to 6 in the preparation of a vaccine for preventing African swine fever; e2) Use of the p150 protein of claim 1, the truncated p150 protein of claim 1, the gene encoding the p150 protein of claim 2, or the gene encoding the truncated p150 protein of claim 3 in the preparation of a vaccine for preventing African swine fever.

Images