Acetohydroxy acid synthase mutants and uses thereof

Abstract

The present application belongs to the field of protein engineering and biotechnology, and particularly relates to an acetyl-hydroxy acid synthase mutant and application thereof. The present application obtains an acetyl-hydroxy acid synthase mutant capable of improving the yield of branched-chain amino acids of a strain through in-depth research and mutant library screening, and the mutant can be applied to the production of L-leucine, L-isoleucine and L-valine, and has a potential application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to a novel acetyl-hydroxy acid synthase mutant and its use, in particular, to an acetyl-hydroxy acid synthase mutant, a microorganism containing the mutant or a method for producing L-branched chain amino acid. BACKGROUND

[0002] The branched chain amino acids, including L-valine, L-leucine and L-isoleucine, are important nutrients for human and animals, and play an important role in physiological function and metabolism. As essential amino acids for human and animals, branched chain amino acids are widely used in food, medicine and cosmetics, are precursors of antibiotics and herbicides, and also have a wide application in feed additives.

[0003] Like other amino acids, branched chain amino acids are mainly synthesized by biological fermentation. In the process of microbial synthesis of branched chain amino acids, acetyl-hydroxy acid synthase (encoded by ilvBN gene) is the first enzyme in the biosynthesis of branched chain amino acids, which can catalyze two molecules of pyruvic acid to generate acetyl lactate (a precursor of valine and leucine), and can also catalyze butanone acid and pyruvic acid to generate 2-acetyl-2-hydroxy-butyric acid (a precursor of isoleucine). Therefore, acetyl-hydroxy acid synthase is a very important enzyme involved in the initial biosynthesis process of L-branched chain amino acid.

[0004] Corynebacterium glutamicum is the main production strain of branched chain amino acids, and its acetyl-hydroxy acid synthase is a tetramer composed of two identical large subunits and two identical small subunits. The large subunit has complete catalytic activity and is encoded by the ilvB gene, and the small subunit has a regulatory effect and is encoded by the ilvN gene. The prior art shows that the three branched chain amino acids can all feedback inhibit the small subunit of acetyl-hydroxy acid synthase (Elisakova, V; Patek, M; Holatko, J; Nesvera, JN; Leyval, D; Goergen, JL; Delaunay, S. Feedback-resistant acetohydroxy acid synthase increases valine production in Corynebacterium glutamicum. Appl Environ Microbiol, 2005, 71: 207-213). Therefore, obtaining acetyl-hydroxy acid synthase that is free of feedback inhibition is the key to the synthesis of branched chain amino acids. In recent years, a number of acetyl-hydroxy acid synthase mutants that are free of feedback inhibition have been reported, such as CN107075496A, WO2023027284A1, WO2022255160A1. However, the prior art still needs to explore new mutants in order to improve the production of branched chain amino acids by strains. SUMMARY

[0005] Through structural prediction and functional analysis of the small subunit ilvN of acetohydroxyacid synthase, it was speculated that its G20, F29, L36, and L39 sites are the core catalytic sites. Further saturation mutagenesis of these sites resulted in the acquisition of L36R, L36Y, L39S, L39R, L39D, L39N, and L39Q mutants. All of these mutants can increase the yield of branched-chain amino acids in the strain and can be applied to the production of leucine, isoleucine, and valine, showing potential application prospects. The present invention was completed on this basis.

[0006] In a first aspect, the present invention provides an acetohydroxyacid synthase mutant, wherein the amino acid sequence of the mutant is based on the wild-type amino acid sequence shown in SEQ ID NO: 2, and the amino acid residues at positions 36 and / or 39 are mutated, and the mutant can increase the production of branched-chain amino acids in the strain.

[0007] The term "wild-type" refers to an object that can be found in nature. For example, a polypeptide or polynucleotide sequence that exists in an organism, can be isolated from a source in nature, and has not been intentionally modified by humans in the laboratory is naturally occurring. As used in this disclosure, "naturally occurring" and "wild-type" are synonymous.

[0008] In some embodiments, the amino acid sequence of the "mutant" is based on the amino acid sequence shown in SEQ ID NO: 2, and the 36th position is mutated to any one of arginine and tyrosine, and / or the 39th position is mutated to any one of serine, arginine, aspartic acid, asparagine, and glutamine.

[0009] In a second aspect, the present invention provides a gene encoding an acetohydroxyacid synthase mutant, a recombinant expression vector containing the encoding gene, and a recombinant microorganism.

[0010] "Recombinant expression vector" refers to a DNA structure used to express a coding gene. A recombinant expression vector may include, for example, a collection of genetic elements that regulate gene expression, such as promoters and enhancers; ii) a structural or coding sequence that is transcribed into mRNA and translated into protein; and iii) appropriate transcription and translation start and stop sequences. Recombinant expression vectors are constructed in any suitable manner. The nature of the vector is not important, and any vector may be used, including plasmids, viruses, phages, and transposons. Possible vectors for use in the present disclosure include, but are not limited to, chromosomal, non-chromosomal, and synthetic DNA sequences, such as bacterial plasmids, phage DNA, yeast plasmids, and vectors derived from combinations of plasmids and phage DNA, DNA from viruses such as vaccinia, adenovirus, fowlpox, baculovirus, SV40, and pseudorabies.

[0011] " recombinant microorganism " of the present invention is the implication with those of ordinary skill in the art generally understood, that is, the microorganism that can import the acetohydroxy acid synthase mutant of the present invention, is called recombinant microorganism after importing. In other words, the present invention can utilize any bacterial strain, as long as it can import the acetohydroxy acid synthase mutant of the present invention. The recombinant microorganism of the present invention can be a bacterium, preferably a bacterium of the genus Corynebacterium. In a specific embodiment, the recombinant microorganism is Corynebacterium glutamicum, including but not limited to Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, and the mutant or bacterial strain of the generation of branched-chain amino acids prepared by the above-mentioned bacterial strain.

[0012] In the present invention, the host cells can be cultured according to conventional methods in the art, including but not limited to well plate culture, shake flask culture, batch culture, continuous culture and fed-batch culture, and various culture conditions such as temperature, time and pH value of the culture medium can be appropriately adjusted according to actual conditions.

[0013] In a third aspect, the present invention provides use of the acetohydroxyacid synthase mutant of the first aspect or the recombinant microorganism of the second aspect in the production of branched-chain amino acids.

[0014] In a fourth aspect, the present invention provides a method for producing branched-chain amino acids, comprising culturing the recombinant microorganism of the second aspect to produce branched-chain amino acids, and further comprising the step of separating or extracting the branched-chain amino acids from the culture medium.

[0015] In a specific embodiment, the branched-chain amino acid is selected from one or more of leucine, isoleucine and valine.

[0016] The present invention has the beneficial effects of demonstrating that the acetohydroxyacid synthase mutants obtained herein produce higher yields of the three branched-chain amino acids, leucine, isoleucine, and valine, than the wild-type WT control. Some mutants also produce higher yields of these three branched-chain amino acids than the known S41V+A91V positive control. Therefore, the mutants of the present invention can be applied to the production of leucine, isoleucine, and valine, demonstrating potential application prospects. DETAILED DESCRIPTION

[0017] The present invention is further described below with reference to specific examples in order to provide a better understanding of the present invention, but the present invention is not limited thereto.

[0018] Example 1: Design of feedback inhibition-reducing mutation sites for Corynebacterium glutamicum acetohydroxyacid synthase

[0019] Corynebacterium glutamicum acetyl-hydroxy acid synthase IlvBN is a key enzyme for branched-chain amino acid synthesis, which is composed of two subunits, the large subunit encoded by ilvB gene and the small subunit encoded by ilvN gene. The large subunit has complete catalytic activity, and the small subunit has a regulatory effect, which can activate the catalytic activity of the large subunit and confer 3 branched-chain amino acids on the feedback inhibition of the holoenzyme. The amino acid sequence of IlvB in Corynebacterium glutamicum 13032 is shown as SEQ ID NO. 1, the nucleotide sequence of the encoding gene is shown as SEQ ID NO. 3, the amino acid sequence of IlvN is shown as SEQ ID NO. 2, and the corresponding encoding gene sequence is shown as SEQ ID NO. 4.

[0020] Since the acetyl-hydroxy acid synthase IlvBN of Corynebacterium glutamicum has no protein structure, the present application is based on the crystal structure of the acetyl-hydroxy acid synthase from Escherichia coli (PDB code: 5YPP) to perform homology modeling and L-valine effector and protein interaction analysis, and it is predicted that L-valine is combined on the IlvN subunit, and the amino acids in the interaction range are also predicted. The conservation of each amino acid is analyzed by multiple sequence alignment based on 1000 homologous sequences. Existing researches also confirm that the mutants that remove the valine feedback inhibition also remove the feedback inhibition of leucine and isoleucine. The present application speculates that the similar structures of the three effectors of valine, leucine and isoleucine are combined in the same region, and the three branched-chain amino acids are mainly combined with IlvN through hydrophobic interaction, in which the conserved hydrophobic amino acids play an important role in the combination. Therefore, the four sites in the range of L-valine effector which are highly conserved and the conserved residues are hydrophobic amino acids are selected as mutation sites, i.e. the G20, F29, L36 and L39 sites of Corynebacterium glutamicum IlvN.

[0021] Example 2, screening of Corynebacterium glutamicum acetyl-hydroxy acid synthase feedback inhibition mutants

[0022] Firstly, the screening method of the feedback inhibition removal acetyl-hydroxy acid synthase mutant is designed. Since the main limitation of valine synthesis in Corynebacterium glutamicum is the feedback inhibition of acetyl-hydroxy acid synthase IlvBN, removing the feedback inhibition of the enzyme can enhance the synthesis of valine. The screening method designed by the present application is as follows: the genes encoding acetyl-hydroxy acid synthase ilvBN and the downstream ilvC and ilvE genes of the metabolic pathway are expressed on the plasmid, the ilvN gene is amplified by carrying the amino acid saturation primer and the plasmid library of introducing specific site saturation mutation is constructed, and then the plasmid mutation library is transformed into the chassis bacteria with a valine biosensor, and the mutants with high efficiency of removing feedback inhibition are screened based on fluorescence enhancement.

[0023] Construction of a Valine-Responsive Biosensor: A valine biosensor expression plasmid was constructed based on the lysine biosensor expression plasmid pLysGWT (Biosens Bioelectron. 2023 Feb 15;222:115004), which uses the eYFP reporter gene. The plasmid backbone was amplified using the pLysGWT plasmid as a template and primers pG-1 and pG-2. The endogenous lrp-brnF gene fragment was amplified using the ATCC13032 genome sequence (GenBank: BA000036.3) as a template and primers LB-1 and LB-2. The plasmid backbone and target gene fragment were recovered and ligated using a Novozymes One-Step Recombination Kit. The resulting plasmid was then transformed into E. coli Trans-T1 (Beijing Quanshijin Biotechnology Co., Ltd.). The plasmid was plated onto LB solid medium containing 25 μg / mL kanamycin and cultured overnight at 37°C. Transformants were verified by PCR using universal plasmid primers pTRC99C-F and PBV220-R and sent to a sequencing company for sequencing verification. The correct recombinant plasmid was designated pEC-LB. LB medium consisted of 5 g / L yeast extract, 10 g / L peptone, and 10 g / L NaCl. For solid medium preparation, 15 g / L agar powder was added. The correct pEC-LB plasmid was introduced into Corynebacterium glutamicum ATCC13032 using conventional electroporation to obtain the ATCC13032 (pEC-LB) strain.

[0024] The plasmids for overexpressing ilvBN, ilvC and ilvE genes were constructed as follows: ilvBN, ilvC and ilvE genes were expressed on the basis of pXMJ19 plasmid (GenBank: AJ133195.1), and the P trcThe promoter controls gene expression. Using the pXMJ19 plasmid as a template, pXMJ19-1 and pXMJ19-2 were used as primers to amplify the plasmid backbone. Using the ATCC13032 genome (GenBank: BA000036.3) as a template, ilvBN-1 and ilvBN-2 were used as primers to amplify the ilvBN gene fragment, corresponding to the Cgl1271-Cgl1272 fragment in the ATCC13032 genome (GenBank: BA000036.3); ilvC-1 and ilvC-2 were used as primers to amplify the ilvC gene fragment, corresponding to the Cgl1273 gene fragment in the ATCC13032 genome (GenBank: BA000036.3); ilvE-1 and ilvE-2 were used as primers to amplify the ilvE gene fragment, corresponding to the Cgl2204 gene fragment in the ATCC13032 genome (GenBank: BA000036.3). The above-mentioned plasmid backbone and three gene fragments were recovered and connected using the Novozymes one-step recombination kit and then transformed into E. coli Trans-T1. They were spread on LB solid culture medium containing 20 μg / mL chloramphenicol and cultured overnight at 37°C. The obtained transformants were verified by PCR using the plasmid universal primers pXMJ19-F and pXMJ19-R, and sent to a sequencing company for sequencing verification. The correct recombinant plasmid was named pQ-ilvBNCE.

[0025] 4 sites unit point saturation mutation library plasmid and control plasmid construction as follows: with pQ-ilvBNCE as template, with XXX-F (such as G20-F) and ilvBNCE-R as primers and XXX-R (such as G20-R) and ilvBNCE-F as primers to amplify two fragments of each site, after fragment recovery, connect by Novagen one-step recombination kit, then transform into E. coli Trans-T1, spread on LB solid medium containing 20 μg / mL chloramphenicol, the transformants should be more than 300 clones. Add 2 mL sterile water to each library plate, collect the colonies with a spreader, centrifuge the collected bacterial solution and extract the plasmid library, and obtain the saturation mutation library plasmid of 4 sites. At the same time, using the similar method above, introduce the S41V and A91V combined dominant mutant identified in branched chain amino acid producing bacteria (Protein Expr Purif. 2015 May; 109: 106-12.) into the pQ-ilvBNCE plasmid, amplify the plasmid backbone with S41V-1 and A91V-2 primers, and amplify the ilvN fragment with S41V-2 and A91V-1 primers, then recover the fragments, connect by Novagen one-step recombination kit, then transform into E. coli Trans-T1, spread on LB solid medium containing 20 μg / mL chloramphenicol, and sequence to obtain the correct pQ-ilvBN S41V+A91V CE plasmid. The primers used in this example are shown in Table 1.

[0026] Table 1 Primers used in the experiment

[0027]

[0028]

[0029] High-throughput screening based on biosensor: according to the method reported in the conventional literature, prepare the competent cells of ATCC13032 (pEC-LB) strain, and transform the above constructed 4 site saturation mutation library plasmid and positive control pQ-ilvBN S41V +A91V CE plasmid into the competent cells of ATCC13032 (pEC-LB), add 1 mL of 46°C preheated TSB medium, incubate at 46°C for 6 min, and incubate at 30°C for 2 h. Transfer the above culture to 100 mL triangular flask containing 20 mL TSB liquid medium added with 5 μg / mL chloramphenicol and 25 μg / mL kanamycin, and culture at 30°C on a shaker until the OD 600 of the obtained bacterial solution is about 5. The initial OD 600Transfer to 30 mL fermentation medium (250 mL Erlenmeyer flask) supplemented with 5 μg / mL chloramphenicol, 25 μg / mL kanamycin and 1 mM IPTG, culture at 30°C for 5-6 h, and dilute the bacterial cell concentration to OD 600 The fluorescence intensity of single cells in the above bacterial solution was analyzed by flow cytometry, and the results showed that compared with the positive control pQ-ilvBN S41V+A91V Compared to the CE plasmid transformation libraries, only the L36 and L39 libraries showed significantly higher single-cell fluorescence intensities than the positive control. For each of these two libraries, regions with significantly higher fluorescence intensities than the positive control were selected as sorting regions. Cells from these regions were then sorted onto plates and cultured to obtain single clones. TSB medium composition: glucose, 5g / L; yeast extract, 5g / L; soy peptone, 9g / L; urea, 3g / L; succinic acid, 0.5g / L; K2HPO4·3H2O, 1g / L; MgSO4·7H2O, 0.1g / L; biotin, 0.01mg / L; thiamin, 0.1mg / L; MOPS, 20g / L; pH 7-7.2.

[0030] The fluorescence intensity of each of the approximately 80 clones sorted from the above two libraries was rescreened in 96-well plates. Single clones were picked and cultured overnight in 96-well plates containing TSB medium. Each well was filled with 200 μL of liquid containing 5 μg / mL chloramphenicol and 25 μg / mL kanamycin. Subsequently, the initial OD 600 The same volume of about 0.05 was transferred to a 96-well plate containing fermentation medium, with each well filled with 200 μL of liquid, containing 5 μg / mL chloramphenicol, 25 μg / mL kanamycin and 1 mM IPTG, and cultured for 6 hours at 30°C. After the culture, the fluorescence (excitation wavelength: 488 nm, emission wavelength: 520 nm) and OD of the strain were detected using a microplate reader. 600 , calculate the fluorescence intensity (fluorescence / OD 600 Fermentation medium formula: glucose, 80 g / L; yeast extract, 2 g / L; (NH4)2SO4, 20 g / L; urea, 5 g / L; KH2PO4, 1 g / L; K2HPO4·3H2O, 1.3 g / L; MOPS, 42 g / L; CaCl2, 0.01 g / L; FeSO4·7H2O, 0.01 g / L; MnSO4·H2O, 0.01 g / L; ZnSO4·7H2O, 0.001 g / L; CuSO4, 0.0002 g / L; NiCl·6H2O, 0.00002 g / L; MgSO4·7H2O, 0.25 g / L; protocatechuic acid, 0.03 g / L; vitamin B1, 0.0001 g / L; biotin, 0.0002 g / L; pH 7-7.2.

[0031] For clones in the above library whose fluorescence intensity increased by more than 30% compared with the positive control strain, PCR was performed using plasmid universal primers pXMJ19-F and pXMJ19-R and sent to a sequencing company for sequencing verification. Finally, a total of 8 mutants were obtained. The corresponding strains, fluorescence intensity increase, and mutation status are shown in Table 2.

[0032] Table 2 Fluorescence intensity increase and mutation status of mutant strains

[0033]

[0034] Example 3 Evaluation of L-valine production by Corynebacterium glutamicum acetohydroxyacid synthase mutants

[0035] The L-valine production of the eight strains obtained above was evaluated using a 24-well plate, with strains containing the wild-type plasmid and the positive control plasmid as controls (the strains were named CgL-WT and CgL-S41V+A91V, respectively). The strains were first inoculated into 24-well plates containing 800 μL of TSB liquid medium per well and cultured for 6-8 h. The culture was then seeded into 24-well plates containing 800 μL of fermentation medium supplemented with 5 μg / mL chloramphenicol, 25 μg / mL kanamycin, and 1 mM IPTG per well. The initial OD 600 The control was about 0.06, cultured at 30℃ for 24h, the plate shaker speed was 800rpm, and the relative humidity was 90%. After the fermentation was completed, the OD was measured. 600 The experiment was set up in triplicate, and L-valine concentration was determined using a conventional amino acid liquid phase assay. As shown in Table 3, all mutants showed higher L-valine production than the wild-type CgL-WT control, with several mutants even producing higher yields than the known positive control, CgL-S41V+A91V.

[0036] Table 3 Evaluation of L-valine production

[0037] strains L-Valine (g / L) CgL-WT 0.04±0.01 CgL-S41V+A91V 7.03±0.11 CgL-L36R 5.40±0.60 CgL-L36Y 7.28±0.13 CgL-L39S 2.37±0.03 CgL-L39R1 8.70±0.45 CgL-L39D 8.49±0.11 CgL-L39R2 9.85±0.16 CgL-L39N 7.53±0.03 CgL-L39Q 6.49±0.1

[0038] Example 4. Reconstruction of a Corynebacterium glutamicum acetohydroxyacid synthase mutant and evaluation of its application in branched-chain amino acid production

[0039] In order to further confirm the functions of the above-mentioned specific site mutations, the CgL-L39D and CgL-L39R2 strains containing dominant mutants were selected for reconstruction.

[0040] The mutants were reconstructed using a method similar to that of Example 2, and the corresponding mutants were introduced into the pQ-ilvBNCE plasmid (the newly added primers are shown in Table 4), and pQ-ilvBN L39D CE and pQ-ilvBNL39R The above plasmids were transformed into ATCC13032 (pEC-LB) competent cells to obtain CgL-L39D* and CgL-L39R* strains, respectively.

[0041] Table 4 Primer information

[0042] Primers Nucleotide sequence L39D-F GCGCATTCAACCTCGTGTCCGATGTGTCTGCAAAGACCGAAAC L39R-F GCGCATTCAACCTCGTGTCCCGGGTGTCTGCAAAGACCGAAAC L39-R GGACACGAGGTTGAATGCGC

[0043] The above strains and control strains were evaluated by well plate fermentation using the same method as in Example 3, and the production of the three branched-chain amino acids was determined using the amino acid liquid phase detection method in Example 3. The results are shown in Table 5. The production of the three branched-chain amino acids in all mutants was higher than that of the wild-type WT control and also higher than that of the known S41V+A91V positive control, indicating that the acetohydroxyacid synthase mutants obtained in the present invention are beneficial for the synthesis of the three branched-chain amino acids and can be applied to the production of branched-chain amino acids.

[0044] Table 5. Yields of three branched-chain amino acids

[0045]

[0046] Example 5. Evaluation of the Application of Corynebacterium glutamicum Acetohydroxyacid Synthase Mutants in L-Isoleucine Production

[0047] In order to further evaluate the application of the advantageous mutants obtained above in L-isoleucine production, a mutant containing the advantageous mutant L39R (base mutation CTC→CGG) and a WT control were selected for comparative analysis.

[0048] To enhance the synthesis of L-isoleucine, first, pQ-ilvBNCE and pQ-ilvBN L39R The CE plasmid was further used to overexpress the threonine dehydratase gene ilvA, which relieves feedback inhibition. F383V . pQ-ilvBNCE and pQ-ilvBN L39R The CE plasmid was used as a template, and pXM-1 and pXM-2 were used as primers to amplify the backbone portion, respectively. The 13032 genome was used as a template, and ilvA-1 and ilvA-2 were used as primers to amplify a partial fragment of the ilvA gene. ilvA-3 and ilvA-4 were used as primers to amplify another partial fragment of the ilvA gene. The F383V mutant was introduced through the primers. The above plasmid backbone was recombined with the two ilvA gene fragments to obtain pQ-ilvBNCEA and pQ-ilvBNCEA, respectively. F383V and pQ-ilvBN L39R CEA F383VTo enhance the supply of L-threonine precursors to the chassis cells, the T311I mutation (base mutation ACC→ATC) in the aspartate kinase lysC gene, which relieves feedback inhibition, and the G378E mutation (GGG→GAG) in the homoserine dehydrogenase hom gene were sequentially introduced into the genome of Corynebacterium glutamicum ATCC13032. The start codon of the lysC gene was mutated from GTG to ATG, and an artificial strong promoter P was inserted before the start codon. pyc -20 (CN113755492A), an artificial strong promoter P was inserted before the start codon of the hom gene gpmA -16 (CN115506035A), the resulting strain was named ZLJHT4 strain. F383V and pQ-ilvBN L39R CEA F383V Plasmids were electroporated into ZLJHT4 competent cells to obtain CgL-ilvBNCEA F383V and CgL-ilvBN L39R CEA F383V The primers used in this example are shown in Table 6.

[0049] Table 6 Primer information

[0050]

[0051] The above strains were evaluated by well plate fermentation using the same method as in Example 3, and the L-isoleucine concentration was measured using the amino acid liquid phase detection method of Example 3. The results, as shown in Table 7, showed that the L-isoleucine production of the acetohydroxyacid synthase L39R mutant was 1.2 times higher than that of the wild-type WT control strain, indicating that the L39R mutant obtained in the present invention facilitates efficient L-isoleucine synthesis and can be applied to L-isoleucine production.

[0052] Table 7. Production of L-isoleucine

[0053] strains L-Isoleucine (g / L) <![CDATA[CgL-ilvBNCEA F383V ]]> 0.51±0.01 <![CDATA[CgL-ilvBN L39R THE F383 ]]> 1.12±0.08

[0054] Example 6 Characterization of Feedback Inhibition-Reducing Enzymatic Properties of Corynebacterium glutamicum Acetohydroxyacid Synthase Mutants

[0055] In order to further characterize the feedback inhibition relief level of the mutant, the WT and L39R (base mutation CTC→CGG) mutants were recombinantly expressed in Escherichia coli, respectively, and their feedback inhibition relief effects were characterized.

[0056] Recombinant enzyme expression and crude enzyme preparation: The recombinant protein was expressed using the pET-28a protein expression plasmid and Escherichia coli BL21(DE3) (Beijing Quanshijin Biotechnology Co., Ltd.). Recombinant expression plasmids were constructed by amplifying the plasmid backbone using the pET-28a plasmid as a template using primers 28a-F and 28a-R. The corresponding ilvBN gene fragments were amplified using primers ilvBN-F and ilvBN-R, respectively, using plasmids containing the corresponding wild-type or mutant as templates. These two fragments were recovered and ligated using a Novozymes One-Step Recombination Kit before transformation into E. coli Trans-T1 (Beijing Quanshijin Biotechnology Co., Ltd.). Transformants were plated onto LB solid medium supplemented with 50 μg / mL kanamycin. Transformants were confirmed by PCR and sequencing to obtain the expression plasmids pET-WT and pET-L39R, respectively. These expression plasmids were transformed into E. coli BL21(DE3) to generate recombinant expression strains. The recombinant expression strain was cultured overnight in LB medium, and the inoculum was transferred to 40 mL of LB liquid medium supplemented with 50 μg / mL kanamycin at a 1% inoculum volume. The culture was carried out in a 500 mL Erlenmeyer flask at 37°C and 220 rpm in a shaker until the OD 600 The expression of the recombinant protein was induced by adding IPTG to a final concentration of 0.5 mM and culturing at 16°C and 220 rpm for 16 hours. The recombinant expression cells were washed twice with 100 mM potassium phosphate buffer (pH 7.4), resuspended at the same concentration, ultrasonically disrupted, and centrifuged at 12,000 rpm for 15 minutes at 4°C. The supernatant was collected as the crude enzyme solution. The primers used in this example are shown in Table 8.

[0057] Table 8. Primers for constructing the recombinant expression plasmid for acetohydroxyacid synthase

[0058] Primers Nucleotide sequence 28a-F CTCGAGCACCACCACCACCAC 28a-R GCTGCTGTGATGATGATGATG ilvBN-F CATCATCATCATCACAGCAGCGTGAATGTGGCAGCTTCTCAAC ilvBN-R TGGTGGTGGTGGTGCTCGAGTTAGATCTTGGCCGGAGCCATG

[0059] The enzyme activity assay system for acetohydroxyacid synthase is: 100 mM potassium phosphate buffer (pH 7.4), 50 mM sodium pyruvate, 10 mM MgCl2, 100 μM thiamine pyrophosphate (TPP) and 100 μM flavin adenine dinucleotide (FAD), appropriate amount of crude enzyme solution and corresponding concentration of inhibitor. OD was measured using a microplate reader. 525nm Absorbance changes were measured at a reaction temperature of 37°C. The enzyme activity of each mutant or wild-type in the absence of inhibitors was set at 100%, and the relative enzyme activity remaining after the addition of inhibitors was calculated. One unit of enzyme activity is defined as the amount of enzyme required to produce 1 nanomole of product in 1 minute (1 U). Specific enzyme activity refers to the catalytic activity per milligram of crude enzyme. Each experiment was performed in triplicate.

[0060] The residual relative enzyme activity of the wild type and mutant enzymes in the presence of 10 mM each of L-valine, L-leucine and L-isoleucine inhibitors is shown in Table 9. The wild type WT enzyme retains 42 ± 13% relative enzyme activity in the presence of 10 mM inhibitors, while the mutant retains 103 ± 16% activity in the presence of 10 mM inhibitors, indicating that the mutant of the present application can simultaneously relieve the feedback inhibition of L-valine, L-leucine and L-isoleucine, and is beneficial for the efficient production of L-valine, L-leucine and L-isoleucine and their derivatives.

[0061] Table 9. Residual relative enzyme activity of wild type and mutant enzymes in the presence and absence of inhibitors

[0062]

[0063]

[0064] The above describes embodiments of the present application. However, the present application is not limited to the above-described embodiments. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present application should be included in the scope of protection of the present application.

Claims

1. An acetohydroxyacid synthase mutant, characterized in that The amino acid sequence of the mutant is based on the amino acid sequence shown in SEQ ID NO: 2, and the amino acid residues at positions 36 and / or 39 are mutated, and the mutant can increase the production of branched-chain amino acids in the strain; The amino acid sequence of the mutant is based on the amino acid sequence shown in SEQ ID NO: 2, with position 36 mutated to any one of arginine and tyrosine, or position 39 mutated to any one of serine, arginine, aspartic acid, asparagine, and glutamine.

2. The gene encoding the acetohydroxyacid synthase mutant according to claim 1.

3. A recombinant expression vector containing the coding gene as claimed in claim 2.

4. A recombinant microorganism containing the coding gene according to claim 2 or the recombinant expression vector according to claim 3.

5. The recombinant microorganism according to claim 4, wherein The recombinant microorganism is a microorganism of the genus Corynebacterium that produces branched-chain amino acids, and the branched-chain amino acids are valine, leucine or isoleucine.

6. The recombinant microorganism according to claim 5, wherein The recombinant microorganism is Corynebacterium glutamicum.

7. Use of the acetohydroxyacid synthase mutant according to claim 1 or the recombinant microorganism according to any one of claims 4 to 6 in the production of branched-chain amino acids, wherein the branched-chain amino acid is valine, leucine or isoleucine.

8. A method for producing branched-chain amino acids, characterized in that: The method comprises culturing the recombinant microorganism of claim 4 or 5 to produce branched-chain amino acids, and further comprises the step of separating or extracting the branched-chain amino acids from the culture medium, wherein the branched-chain amino acids are valine, leucine or isoleucine.

Images