Acetohydroxy acid synthase mutant and application thereof in production of branched chain amino acid

Abstract

The invention belongs to the fields of protein engineering and biotechnology, and particularly relates to an acetohydroxy acid synthase mutant and application thereof. The acetohydroxy acid synthase mutant capable of improving the yield of branched-chain amino acid of a strain is obtained through deep research and mutant library screening, can be applied to production of branched-chain amino acid including L-leucine, L-isoleucine and L-valine, and has potential application prospects.

Description

Technical Field

[0001] The present invention relates to a novel acetohydroxyacid synthase mutant and use thereof, in particular, to an acetohydroxyacid synthase mutant, a microorganism containing the same or a method for producing L-branched-chain amino acids. Background Art

[0002] It is known that branched-chain amino acids (e.g., L-valine, L-leucine, and L-isoleucine) increase protein levels in individuals and play an important role as an energy source during exercise, and are therefore widely used in medicines, foods, etc. Like other amino acids, branched-chain amino acids are mainly synthesized by biofermentation. In the biosynthetic process of branched-chain amino acids, acetohydroxy acid synthase is the first enzyme in the biosynthesis of branched-chain amino acids, which can catalyze two molecules of pyruvic acid to generate acetolactate (which is a precursor of valine and leucine), and can also catalyze ketobutyric acid and pyruvic acid to generate 2-acetyl-2-hydroxy-butyric acid (which is a precursor of isoleucine). Therefore, acetohydroxy acid synthase is a very important enzyme that participates in the initial biosynthetic process of L-branched-chain amino acids.

[0003] The acetohydroxy acid synthase IlvBN in Corynebacterium glutamicum is composed of two subunits, namely the large subunit encoded by the ilvB gene and the small subunit encoded by the ilvN gene. The large subunit has complete catalytic activity, and the small subunit has a regulatory effect. The prior art shows that the three branched-chain amino acids can feedback inhibit the small subunit of acetohydroxy acid synthase (Elisakova, V; Patek, M; Holatko, J; Nesvera, JN; Leyval, D; Goergen, JL; Delaunay, S. Feedback-resistant acetohydroxy acid synthase increases valine production in Corynebacterium glutamicum. Appl Environ Microbiol, 2005, 71: 207-213). Therefore, obtaining an acetohydroxy acid synthase that is free of feedback inhibition is the key to synthesizing branched-chain amino acids. In recent years, a number of acetohydroxyacid synthase mutants that relieve feedback inhibition have been reported, such as CN107075496A, WO2023027284A1, and WO2022255160A1. However, the existing technology still needs to discover new mutants in order to increase the branched-chain amino acid production of the strain. Summary of the invention

[0004] Through structural prediction and functional analysis of the small subunit IlvN of acetohydroxyacid synthase, it is speculated that its V15, I22, and S41 positions are the core sites of catalysis. Further saturation mutations are performed on the above sites to obtain 6 mutants, namely I22R, I22K, S41R, S41W, S41F, and S41L. The above mutants can all increase the branched-chain amino acid production of the strain, and can be applied to the production of L-leucine, L-isoleucine and L-valine, and have potential application prospects. The present invention is completed on this basis.

[0005] In the first aspect, the present invention provides an acetohydroxyacid synthase mutant, wherein the amino acid sequence of the mutant is based on the wild-type amino acid sequence shown in SEQ ID NO:2, and the amino acid residue at position 22 and / or 41 is mutated, and the mutant can increase the production of branched-chain amino acids in the strain.

[0006] The term "wild-type" refers to an object that can be found in nature. For example, a polypeptide or polynucleotide sequence that exists in an organism, can be isolated from a source in nature, and has not been intentionally modified by humans in the laboratory is naturally occurring. As used in this disclosure, "naturally occurring" and "wild-type" are synonyms.

[0007] In some embodiments, the amino acid sequence of the "mutant" is based on the amino acid sequence shown in SEQ ID NO:2, and the 22nd position is mutated to any one of arginine and lysine, and / or the 41st position is mutated to any one of arginine, tryptophan, phenylalanine, and leucine.

[0008] In a second aspect, the present invention provides a gene encoding an acetohydroxyacid synthase mutant, a recombinant expression vector containing the gene encoding the gene, and a recombinant microorganism.

[0009] "Recombinant expression vector" refers to a DNA structure used to express a coding gene. A recombinant expression vector may include, for example, a collection of genetic elements that regulate gene expression, such as promoters and enhancers; ii) a structural or coding sequence that is transcribed into mRNA and translated into protein; and iii) appropriate transcription and translation start and stop sequences. The recombinant expression vector is constructed in any suitable manner. The nature of the vector is not important, and any vector may be used, including plasmids, viruses, phages, and transposons. Possible vectors for use in the present disclosure include, but are not limited to, chromosomal, non-chromosomal, and synthetic DNA sequences, such as bacterial plasmids, phage DNA, yeast plasmids, and vectors derived from combinations of plasmids and phage DNA, DNA from viruses such as vaccinia, adenovirus, fowlpox, baculovirus, SV40, and pseudorabies.

[0010] "Recombinant microorganism" of the present invention is the meaning that those of ordinary skill in the art usually understand, that is, the microorganism that can import the acetohydroxyacid synthase mutant of the present invention, is called recombinant microorganism after importing. In other words, the present invention can utilize any bacterial strain, as long as it can import the acetohydroxyacid synthase mutant of the present invention. The recombinant microorganism of the present invention can be a bacterium, preferably a bacterium of the genus Corynebacterium. In a specific embodiment, the recombinant microorganism is Corynebacterium glutamicum, including but not limited to Corynebacterium glutamicum ATCC 13869, Corynebacterium glutamicum ATCC 13032, Corynebacterium glutamicum B253, Corynebacterium glutamicum ATCC 14067, and the mutant or bacterial strain of the generation of branched-chain amino acids prepared by the above-mentioned bacterial strain.

[0011] In the present invention, the host cells can be cultured according to conventional methods in the art, including but not limited to well plate culture, shake flask culture, batch culture, continuous culture and fed-batch culture, etc., and various culture conditions such as temperature, time and pH value of the culture medium can be appropriately adjusted according to actual conditions.

[0012] In a third aspect, the present invention provides use of the acetohydroxyacid synthase mutant of the first aspect or the recombinant microorganism of the second aspect in the production of branched-chain amino acids.

[0013] In a fourth aspect, the present invention provides a method for producing branched-chain amino acids, the method comprising culturing the recombinant microorganism of the second aspect to produce branched-chain amino acids, and further comprising the step of separating or extracting the branched-chain amino acids from the culture medium.

[0014] In a specific embodiment, the branched-chain amino acid is selected from one or more of L-leucine, L-isoleucine and L-valine.

[0015] Beneficial effects of the present invention: The acetohydroxyacid synthase mutant obtained by the present invention has higher production of three branched-chain amino acids, namely leucine, isoleucine and valine, than the wild-type WT control, and is also higher than the known S41V+A91V positive control and the S41V control. Therefore, the mutant of the present invention can be applied to the production of leucine, isoleucine and valine, and has potential application prospects. DETAILED DESCRIPTION

[0016] In order to make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments.

[0017] Example 1: Design of feedback inhibition mutation sites for Corynebacterium glutamicum acetohydroxyacid synthase

[0018] Corynebacterium glutamicum acetohydroxyacid synthase IlvBN is a key enzyme in the synthesis of branched-chain amino acids. It consists of two subunits, namely the large subunit encoded by the ilvB gene and the small subunit encoded by the ilvN gene. The large subunit has complete catalytic activity, and the small subunit has a regulatory effect, which can activate the catalytic activity of the large subunit and give three branched-chain amino acids feedback inhibition to the whole enzyme. The amino acid sequence of IlvB in Corynebacterium glutamicum 13032 is shown in SEQ ID NO.1, the coding gene sequence is shown in SEQ ID NO.3, the amino acid sequence of IlvN is shown in SEQ ID NO.2, and the corresponding coding gene sequence is shown in SEQ ID NO.4.

[0019] Since the protein structure of acetohydroxyacid synthase IlvBN of Corynebacterium glutamicum has not been resolved, the present invention conducted homology modeling and L-valine effector-protein interaction analysis based on the crystal structure of the homologous protein acetohydroxyacid synthase from Escherichia coli (PDB code: 5YPP). It was predicted that L-valine binds to the IlvN subunit and the effector At the same time, based on 1000 homologous sequences, multiple sequence alignment was used to analyze the conservation of each amino acid. Existing studies have also confirmed that mutants that relieve feedback inhibition by valine also relieve feedback inhibition by leucine and isoleucine. The present invention speculates that the three effectors of valine, leucine and isoleucine with similar structures are all bound to the same region, and the three branched-chain amino acids mainly bind to IlvN through hydrophobic interactions, among which the conservative hydrophobic amino acids play an important role in the binding. Therefore, the L-valine effector was selected. Three sites within the range that are highly conserved and whose conserved residues are hydrophobic amino acids are mutation sites, namely, sites V15, I22, and S41 corresponding to IlvN of Corynebacterium glutamicum.

[0020] Example 2: Screening of feedback inhibition mutants of Corynebacterium glutamicum acetohydroxyacid synthase

[0021] First, a screening method for acetohydroxyacid synthase mutants that relieve feedback inhibition is designed. Since the main limitation of valine synthesis in Corynebacterium glutamicum is the feedback inhibition of acetohydroxyacid synthase IlvBN, relieving the feedback inhibition of the enzyme can enhance the synthesis of valine. The screening method designed by the present invention is as follows: the ilvBN gene encoding the acetohydroxyacid synthase and the ilvC and ilvE genes downstream of the metabolic pathway are expressed on a plasmid, a plasmid library with saturated mutations of specific sites introduced into the ilvN gene is amplified and constructed by primers carrying amino acid saturation mutations, and then the plasmid mutation library is transformed into a chassis bacteria with a biosensor that can respond to valine, and mutants that efficiently relieve feedback inhibition are screened based on fluorescence enhancement.

[0022] Construction of a valine biosensor chassis bacteria: Based on the lysine biosensor expression plasmid pLysGWT (BiosensBioelectron.2023Feb 15;222:115004.) with eYFP as the reporter gene, the expression plasmid of the valine biosensor was constructed. The pLysGWT plasmid was used as a template, and pG-1 and pG-2 were used as primers to amplify the plasmid backbone. Based on the reported genome sequence of Corynebacterium glutamicum ATCC13032 (GenBank:BA000036.3), the ATCC13032 genome was used as a template, and LB-1 and LB-2 were used as primers to amplify the endogenous lrp-brnF gene fragment. After the above plasmid backbone and target gene fragment were recovered, they were connected and transformed into E. coli Trans-T1 (Beijing Quanshijin Biotechnology Co., Ltd.) through the one-step recombination kit of Novozyme, and then coated on LB solid medium containing 25 μg / mL kanamycin, cultured overnight at 37°C, and the obtained transformants were verified by PCR using plasmid universal primers PTRC99C-F and PBV220-R, and sent to a sequencing company for sequencing verification. The correct recombinant plasmid was named pEC-LB. LB medium: 5g / L yeast powder, 10g / L peptone, 10g / L NaCl, and 15g / L agar powder was added to prepare solid medium. The correct pEC-LB plasmid was introduced into Corynebacterium glutamicum ATCC13032 by conventional electrotransformation method to obtain ATCC13032 (pEC-LB) strain.

[0023] The plasmids for overexpressing ilvBN, ilvC and ilvE genes were constructed as follows: ilvBN, ilvC and ilvE genes were expressed on the basis of pXMJ19 plasmid (GenBank: AJ133195.1), and P trcThe promoter controls the expression of the gene. The pXMJ19 plasmid was used as a template and pXMJ19-1 and pXMJ19-2 were used as primers to amplify the plasmid backbone. Using the ATCC13032 genome (GenBank: BA000036.3) as a template, ilvBN-1 and ilvBN-2 were used as primers to amplify the ilvBN gene fragment, corresponding to the Cgl1271-Cgl1272 fragment in the ATCC13032 genome (GenBank: BA000036.3); ilvC-1 and ilvC-2 were used as primers to amplify the ilvC gene fragment, corresponding to the Cgl1273 gene fragment in the ATCC13032 genome (GenBank: BA000036.3); ilvE-1 and ilvE-2 were used as primers to amplify the ilvE gene fragment, corresponding to the Cgl2204 gene fragment in the ATCC13032 genome (GenBank: BA000036.3). The plasmid backbone and three gene fragments were recovered and connected through the one-step recombination kit of Novagen, and then transformed into E. coli Trans-T1, spread on LB solid culture medium containing 20 μg / mL chloramphenicol, and cultured at 37°C overnight. The obtained transformants were verified by PCR using the plasmid universal primers pXMJ19-F and pXMJ19-R, and sent to a sequencing company for sequencing verification. The correct recombinant plasmid was named pQ-ilvBNCE.

[0024] The single-site saturation mutation library plasmids and control plasmids of the three sites were constructed as follows: pQ-ilvBNCE was used as a template, and the corresponding site XXX-F (such as V15-F) and ilvBNCE-R were used as primers, and XXX-R (such as V15-R) and ilvBNCE-F were used as primers to amplify two fragments of each site. After the fragments were recovered, they were connected through the one-step recombination kit of Novozymes and transformed into E. coli Trans-T1, and spread on LB solid medium containing 20μg / mL chloramphenicol. The transformants needed to be greater than 300 clones. 2mL of sterile water was added to the plate of each library, and the colonies were collected with a coating rod. The collected bacterial liquid was centrifuged and the plasmid library was extracted to obtain the saturation mutation library plasmids of the four sites. At the same time, a similar method as above was used to introduce the S41V and A91V combined advantageous mutants identified in branched-chain amino acid producing bacteria into the pQ-ilvBNCE plasmid (Protein Expr Purif. 2015 May; 109: 106-12.), the plasmid backbone was amplified with S41V-1 and A91V-2 primers, and the ilvN fragment was amplified with S41V-2 and A91V-1 primers. After the fragments were recovered, they were connected through the one-step recombination kit of Novozymes and transformed into E. coli Trans-T1, coated on LB solid medium containing 20 μg / mL chloramphenicol, and the correct pQ-ilvBNCE was obtained by sequencing. S41V+A91V CE plasmid. The primers used in this example are shown in Table 1.

[0025] Table 1. Primer information

[0026]

[0027]

[0028] High-throughput screening based on biosensors: According to the conventional literature method, competent cells of ATCC13032 (pEC-LB) strain were prepared, and the saturation mutation library plasmids of the four sites constructed above and the positive control pQ-ilvBN S41V +A91V CE plasmids were transferred into competent cells of ATCC13032 (pEC-LB), 1 mL of TSB medium preheated at 46°C was added, and the cells were incubated at 46°C for 6 min and 30°C for 2 h. The above culture solutions were transferred to 100 mL Erlenmeyer flasks containing 20 mL of TSB liquid medium supplemented with 5 μg / mL chloramphenicol and 25 μg / mL kanamycin, and cultured at 30°C in a shaking incubator until OD 600 The obtained bacterial solution was about 5. The initial OD 600Transfer to 30 mL fermentation medium (250 mL Erlenmeyer flask) supplemented with 5 μg / mL chloramphenicol, 25 μg / mL kanamycin and 1 mM IPTG, culture at 30°C for 5-6 h, and dilute the bacterial cell concentration to OD 600 The fluorescence intensity of single cells in the above bacterial solution was analyzed by flow cytometry, and the results showed that compared with the positive control pQ-ilvBN S41V+A91V Compared with the CE plasmid transformation library, only the single cell fluorescence intensity of the I22 and S41 libraries can be significantly higher than the positive control. For the above two libraries, the area with a significantly higher ratio of high fluorescence intensity than the positive control was selected as the sorting area, and the cells in this area were sorted to the plate for culture to obtain single clones. The components of TSB culture medium are: glucose, 5g / L; yeast powder, 5g / L; soy peptone, 9g / L; urea, 3g / L; succinic acid, 0.5g / L; K2HPO4·3H2O, 1g / L; MgSO4·7H2O, 0.1g / L; biotin, 0.01mg / L; vitamin B1, 0.1mg / L; MOPS, 20g / L; pH7-7.2.

[0029] The fluorescence intensity of each of the approximately 80 clones sorted from the above two libraries was screened again in a 96-well plate. Single clones were picked and cultured overnight in a 96-well plate containing TSB medium. Each well was filled with 200 μL of liquid containing 5 μg / mL chloramphenicol and 25 μg / mL kanamycin. Subsequently, the initial OD 600 The same volume of about 0.05 was transferred to a 96-well plate containing fermentation medium, with 200 μL of liquid in each well, containing 5 μg / mL chloramphenicol, 25 μg / mL kanamycin and 1 mM IPTG, and cultured for 6 h at a temperature of 30°C. After the culture, the fluorescence (excitation wavelength: 488 nm, emission wavelength: 520 nm) and OD of the strain were detected using an ELISA reader. 600 , calculate the fluorescence intensity (fluorescence / OD 600 ). Fermentation medium formula: glucose, 80g / L; yeast powder, 2g / L; (NH4)2SO4, 20g / L; urea, 5g / L; KH2PO4, 1g / L; K2HPO4·3H2O, 1.3g / L; MOPS, 42g / L; CaCl2, 0.01g / L; FeSO4·7H2O, 0.01g / L; MnSO4·H2O, 0.01g / L; ZnSO4·7H2O, 0.001g / L; CuSO4, 0.0002g / L; NiCl·6H2O, 0.00002g / L; MgSO4·7H2O, 0.25g / L; protocatechuic acid, 0.03g / L; vitamin B1, 0.0001g / L; biotin, 0.0002g / L; pH 7-7.2.

[0030] For clones in the above library whose fluorescence intensity was increased by more than 30% compared with the positive control strain, PCR was performed using plasmid universal primers pXMJ19-F and pXMJ19-R and sent to a sequencing company for sequencing verification. Finally, a total of 6 mutants were obtained. The corresponding strains, fluorescence intensity increase and mutation status are shown in Table 2.

[0031] Table 2. Increase in fluorescence intensity and mutation status of mutant strains

[0032]

[0033] Example 3 Evaluation of L-valine production of acetohydroxyacid synthase mutants of Corynebacterium glutamicum

[0034] The L-valine production of the six strains obtained above was evaluated using a 24-well plate, with the wild-type plasmid and the positive control plasmid strains as controls (the strains were named CgL-WT and CgL-S41V+A91V, respectively). First, the strains were inoculated into a 24-well plate containing 800 μL of TSB liquid medium per well and cultured for 6-8 h. The culture was inoculated as seeds into a 24-well plate containing 800 μL of fermentation medium supplemented with 5 μg / mL chloramphenicol, 25 μg / mL kanamycin and 1 mM IPTG per well. The initial OD 600 The control was about 0.06, cultured at 30℃ for 24h, the plate shaker speed was 800rpm, and the relative humidity was 90%. After the fermentation was completed, the OD was measured 600 The experiment was set up in three parallels, and the L-valine concentration was determined by a conventional amino acid liquid phase detection method. The results are shown in Table 3. The L-valine production of all mutants was higher than that of the wild-type WT control and also higher than the known S41V+A91V positive control.

[0035] Table 3. Evaluation of L-valine production

[0036] strain L-Valine(g / L) CgL-WT 0.04±0.01 CgL-S41V+A91V 7.03±0.11 CgL-I22R 9.21±0.07 CgL-I22K 8.79±0.19 CgL-S41R 6.82±0.06 CgL-S41W 8.91±0.23 CgL-S41F 8.82±0.09 CgL-S41L 7.61±0.12

[0037] Example 4: Reconstruction of Corynebacterium glutamicum acetohydroxyacid synthase mutant and evaluation of its application in branched-chain amino acid production

[0038] In order to further confirm the functions of the above-mentioned specific site mutations, the CgL-I22R, CgL-I22K, CgL-S41W, CgL-S41F and CgL-S41L strains containing dominant mutants were selected for reconstruction.

[0039] The mutants were reconstructed using a similar method as in Example 2, and the corresponding mutants were introduced into the pQ-ilvBNCE plasmid (the newly added primers are shown in Table 4), and pQ-ilvBN I22RCE, pQ-ilvBN I22K CE, pQ-ilvBN S41W CE, pQ-ilvBN S41F CE and pQ-ilvBN S41L The above plasmids were respectively transformed into competent cells of ATCC13032 (pEC-LB) to obtain CgL-I22R*, CgL-I22K*, CgL-S41W*, CgL-S41F* and CgL-S41L* strains.

[0040] Table 4. Primer information

[0041] Primers Nucleotide sequence I22R-F CGTTCAGGACGTAGACGGAATCAGGTCCCGCGTATCAGGTATG I22K-F CGTTCAGGACGTAGACGGAATCAAATCCCGCGTATCAGGTATG I22-R GATTCCGTCTACGTCCTGAACG S41W-F CAACCTCGTGTCCCTCGTGTGGGCAAAGACCGAAACACACGG S41F-F CAACCTCGTGTCCCTCGTGTTTGCAAAGACCGAAACACACGG S41L-F CAACCTCGTGTCCCTCGTGCTGGCAAAGACCGAAACACACGG S41-R CACGAGGGACACGAGGTTG

[0042] The above strains and control strains were evaluated by well plate fermentation using the same method as in Example 3, and the concentrations of the three branched-chain amino acids were determined using the amino acid liquid phase detection method of Example 3. As shown in Table 5, the yields of the three branched-chain amino acids of all mutants were higher than those of the wild-type WT control strain, the yields of L-valine of all mutants were higher than those of the known control strain containing the S41V+A91V combination mutant, and the yields of L-leucine and L-isoleucine of multiple mutants were higher than or comparable to those of the known control strain containing the S41V+A91V combination mutant, indicating that the acetohydroxyacid synthase mutants obtained by the present invention are beneficial to the synthesis of the three branched-chain amino acids and can be applied to the production of branched-chain amino acids.

[0043] Table 5. Production of three branched-chain amino acids

[0044]

[0045]

[0046] Example 5: Evaluation of the application of Corynebacterium glutamicum acetohydroxyacid synthase mutants in L-isoleucine production

[0047] In order to further evaluate the application of the superior mutants obtained above in L-isoleucine production, mutants containing the superior mutants I22K and S41W and a WT control were selected for comparative analysis.

[0048] In order to enhance the synthesis of L-isoleucine, firstly, pQ-ilvBNCE, pQ-ilvBN I22K CE and pQ-ilvBN S41W Further overexpression of the threonine dehydratase gene ilvA that relieves feedback inhibition based on the CE plasmid F383V . pQ-ilvBNCE, pQ-ilvBN I22K CE and pQ-ilvBN S41WCE plasmid was used as template, pXM-1 and pXM-2 were used as primers to amplify the backbone part respectively; 13032 genome was used as template, ilvA-1 and ilvA-2 were used as primers to amplify part of the ilvA gene, ilvA-3 and ilvA-4 were used as primers to amplify another part of the ilvA gene, and the F383V mutant was introduced through the primers. The above plasmid backbones were recombined with the two ilvA gene fragments for three fragments to obtain pQ-ilvBNCEA F383V 、pQ-ilvBN I22K CEA F383V and pQ-ilvBN S41W CEA F383V In order to enhance the supply of L-threonine precursors to chassis cells, the T311I mutation of the aspartate kinase lysC gene (base mutation ACC→ATC) that relieves feedback inhibition, the G378E mutation of the homoserine dehydrogenase hom gene (GGG→GAG), the start codon of the lysC gene GTG mutation to ATG, and the artificial strong promoter P were successively introduced into the genome of Corynebacterium glutamicum ATCC13032. pyc -20 (CN113755492A), an artificial strong promoter P was inserted before the start codon of the hom gene gpmA -16 (CN115506035A), the resulting strain was named ZLJHT4 strain. F383V 、pQ-ilvBN I22K CEA F383V and pQ-ilvBN S41W CEA F383V , respectively electroporated into ZLJHT4 strain competent cells to obtain CgL-ilvBNCEA F383V 、CgL-ilvBN I22K CEA F383V and CgL-ilvBN S41W CEA F383V The primers used in this example are shown in Table 6.

[0049] Table 6. Primer information

[0050]

[0051]

[0052] The above strains were evaluated by well plate fermentation using the same method as in Example 3, and the concentration of L-isoleucine was determined using the amino acid liquid phase detection method of Example 3. The results are shown in Table 7. The L-isoleucine production of the acetohydroxyacid synthase I22K and S41W mutants was increased by more than 78% compared with the wild-type WT control strain, indicating that the mutants obtained in the present invention are conducive to the efficient synthesis of L-isoleucine and can be applied to the production of L-isoleucine.

[0053] Table 7. Production of L-isoleucine

[0054] strain L-Isoleucine(g / L) <![CDATA[CgL-ilvBNCEA F383V ]]> 0.51±0.01 <![CDATA[CgL-ilvBN I22K THE F383V ]]> 0.91±0.02 <![CDATA[CgL-ilvBN S41W THE F383V ]]> 0.97±0.02

[0055] Example 6 Characterization of the feedback inhibition-resistant enzymatic properties of the acetohydroxyacid synthase mutant of Corynebacterium glutamicum

[0056] In order to further characterize the feedback inhibition relief level of the mutants, the WT, I22R and S41W mutants were recombinantly expressed in Escherichia coli, respectively, and their feedback inhibition relief effects were characterized.

[0057] Recombinant expression of enzyme and preparation of crude enzyme solution: pET-28a protein expression plasmid and Escherichia coli BL21 (DE3) (Beijing Quanshijin Biotechnology Co., Ltd.) were used as hosts to express recombinant proteins. Recombinant expression plasmids were constructed by using 28a-F and 28a-R primers and pET-28a plasmid as template to amplify the plasmid backbone; ilvBN-F and ilvBN-R primers were used to amplify the corresponding ilvBN gene fragments using plasmids containing the corresponding wild type or mutant (I22R and S41W) as templates; the above two fragments were recovered and connected by the one-step recombination kit of Novozymes and then transformed into E. coli Trans-T1 (Beijing Quanshijin Biotechnology Co., Ltd.), and were respectively coated on LB solid medium containing 50 μg / mL kanamycin. The transformants were verified by PCR and sequencing to obtain expression plasmids pET-WT, pET-I22R and pET-S41W, respectively. The above expression plasmids were transformed into Escherichia coli BL21 (DE3) to obtain recombinant expression strains. The recombinant expression strains were cultured overnight in LB medium, and transferred to 40 mL LB liquid medium supplemented with 50 μg / mL kanamycin at a 1% inoculum. A 500 mL Erlenmeyer flask was used to culture in a shaker at 37°C and 220 rpm until OD 600The recombinant protein was induced to express at a final concentration of 0.5 mM IPTG and cultured at 16 ° C and 220 rpm for 16 h. The recombinant expression bacteria were washed twice with 100 mM potassium phosphate buffer (pH 7.4), then resuspended at the same bacterial concentration, ultrasonically broken and centrifuged at 12000 rpm for 15 minutes at 4 ° C. The supernatant collected was the crude enzyme solution. The primers used in this example are shown in Table 8.

[0058] Table 8. Primers for constructing the recombinant expression plasmid of acetohydroxyacid synthase

[0059] Primers Nucleotide sequence 28a-F CTCGAGCACCACCACCACCAC 28a-R GCTGCTGTGATGATGATGATG ilvBN-F CATCATCATCATCACAGCAGCGTGAATGTGGCAGCTTCTCAAC ilvBN-R TGGTGGTGGTGGTGCTCGAGTTAGATCTTGGCCGGAGCCATG

[0060] The enzyme activity assay system of acetohydroxyacid synthase is: 100mM potassium phosphate buffer (pH 7.4), 50mM sodium pyruvate, 10mM MgCl2, 100μM thiamine pyrophosphate (TPP) and 100μM flavin adenine dinucleotide (FAD), appropriate amount of crude enzyme solution and corresponding concentration of inhibitor. OD was measured by microplate reader 525nm The change of absorbance value, the reaction temperature is 37℃. The enzyme activity of each mutant or wild type without adding inhibitor is set to 100%, and the relative enzyme activity remaining after adding inhibition is calculated. The enzyme activity unit is defined as follows: the amount of enzyme required to produce 1 nanomole of product in 1 minute is 1U. The specific enzyme activity refers to the catalytic activity of the enzyme contained in each milligram of crude enzyme. Three parallel experiments were set up.

[0061] The residual relative enzyme activities of the wild-type and mutant enzymes under the condition of adding 10mM L-valine, L-leucine and L-isoleucine inhibitors are shown in Table 9. The wild-type WT enzyme retains 42±13% of the relative enzyme activity after adding 10mM inhibitor, while the mutants I22R and S41W still have 80±9% and 90±2% of residual activities, respectively, after adding 10mM inhibitor, indicating that the mutants of the present invention can simultaneously relieve the feedback inhibition of L-valine, L-leucine and L-isoleucine, which is beneficial to the efficient production of L-valine, L-leucine and L-isoleucine and their derivatives.

[0062] Table 9. Residual relative enzyme activity of wild-type and mutant enzymes with and without inhibitor addition

[0063]

[0064] The above is an explanation of the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An acetohydroxyacid synthase mutant, characterized in that: The amino acid sequence of the mutant is based on the amino acid sequence shown in SEQ ID NO: 2, and the amino acid residues at positions 22 and / or 41 are mutated, and the mutant can increase the production of branched-chain amino acids in the strain.

2. The acetohydroxyacid synthase mutant according to claim 1, characterized in that The amino acid sequence of the mutant is based on the amino acid sequence shown in SEQ ID NO: 2, wherein the 22nd position is mutated to any one of arginine and lysine, and / or the 41st position is mutated to any one of arginine, tryptophan, phenylalanine and leucine.

3. A gene encoding the acetohydroxyacid synthase mutant according to claim 1 or 2.

4. A recombinant expression vector containing the coding gene as claimed in claim 3.

5. A recombinant microorganism containing the coding gene as claimed in claim 3 or the recombinant expression vector as claimed in claim 4.

6. The recombinant microorganism according to claim 5, characterized in that The recombinant microorganism is a microorganism of the genus Corynebacterium having branched-chain amino acid production.

7. The recombinant microorganism according to claim 6, characterized in that The recombinant microorganism is Corynebacterium glutamicum.

8. Use of the acetohydroxyacid synthase mutant according to claim 1 or 2 or the recombinant microorganism according to claims 5-6 in the production of branched-chain amino acids.

9. A method for producing branched-chain amino acids, characterized in that: The method comprises culturing the recombinant microorganism of claim 5 or 6 to produce branched-chain amino acids, and further comprises the step of separating or extracting the branched-chain amino acids from the culture medium.

10. The method according to claim 9, characterized in that The branched-chain amino acids are selected from one or more of L-leucine, L-isoleucine and L-valine.

Images