Method for detecting transgenic plant based on CRISPR technology

Abstract

The invention provides a method for detecting a transgenic plant based on a CRISPR (clustered regularly interspaced short palindromic repeats) technology. The method comprises a step of detecting by utilizing gRNA (guide Ribonucleic Acid), Cas protein and a single-stranded nucleic acid detector, by screening and optimizing the gRNA, the detection efficiency is improved, and the method has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to the field of nucleic acid detection, and in particular to a method, system and kit for detecting transgenic plants based on CRISPR technology. Background Art

[0002] As the level of industrialization of genetically modified plants continues to increase, their safety issues have attracted widespread attention from the international community and governments of various countries. Currently, the main genetically modified crops grown commercially are soybeans and corn. Research on rapid and accurate detection methods for genetically modified soybeans and genetically modified corn is a technical support and guarantee for the smooth implementation of relevant laws and regulations on genetically modified biosafety management.

[0003] GMO component detection technologies are mainly divided into two categories: one is to detect exogenous DNA, such as PCR, gene chips, etc., and the other is to detect proteins expressed by exogenous genes, such as ELISA, immune test strips, etc. Among the above methods, PCR technology is currently the most widely used, but the PCR-based GMO detection method requires professional instruments and equipment such as PCR instruments and gel imaging systems, and the amplification and product detection time is relatively long (about 3 to 4 hours), which makes it difficult to achieve the purpose of rapid on-site detection. Therefore, in actual work, a more convenient, accurate, and on-site operation-suitable new GMO detection technology is needed.

[0004] In recent years, CRISPR gene editing technology has emerged. Zhang Feng's team has developed a new nucleic acid diagnostic technology (SHERLOCK technology) targeting RNA with Cas13 as the core based on RPA technology. Doudna's team has developed a diagnostic technology (DETECTR technology) with Cas12 enzyme as the core. Dr. Wang Jin and others from the Shanghai Institute of Plant Physiology and Ecology, Chinese Academy of Sciences have also developed a new nucleic acid detection technology (HOLMES technology) based on Cas12. Nucleic acid detection technology developed based on CRISPR technology is playing an increasingly important role.

[0005] The present invention provides a novel method for detecting transgenic plants, which is based on CRISPR technology, especially based on the trans activity of V-type Cas enzyme, and provides a rapid, simple, highly specific and highly sensitive detection method. Summary of the invention

[0006] The present invention provides a method, system and kit for detecting transgenic plants based on CRISPR technology.

[0007] On the one hand, the present invention provides a gRNA for detecting transgenic plants, the gRNA comprising a region binding to a V-type Cas protein and a guide sequence hybridizing with a target nucleic acid, the guide sequence hybridizing with a sequence shown in any one of SEQ ID No.1-6 or a reverse complementary sequence thereof, and the guide sequence is a sequence shown in SEQ ID No.10, SEQ ID No.12, SEQ ID No.16, SEQ ID No.19, SEQ ID No.26 or SEQ ID No.27.

[0008] In a preferred embodiment, the guide sequence that hybridizes to the target nucleic acid contains 18-30 bases, for example, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 bases.

[0009] The hybridization with any of the sequences shown in SEQ ID No. 1-6 or the reverse complementary sequence thereof means that the guide sequence can be continuously complementary paired with a continuous section of SEQ ID No. 1-6 or the reverse complementary sequence of SEQ ID No. 1-6. For example, if the guide sequence hybridized with the target nucleic acid contains 30 bases, then the 30 bases of the guide sequence need to be complementary paired with 30 continuous bases of SEQ ID No. 1 or its complementary sequence.

[0010] In the present invention, the region that binds to the CRISPR / CAS effector protein is also called a direct repeat sequence, a backbone region or a spacer sequence, and this region interacts with the Cas protein, thereby binding to the Cas protein.

[0011] In one embodiment, the gRNA includes, from the 5' end to the 3' end, a region that binds to the Cas protein and a guide sequence that hybridizes to the target nucleic acid.

[0012] In one embodiment, the Cas protein is selected from a V-type Cas protein, for example, a Cas12, Cas14 family protein or a mutant thereof.

[0013] In one embodiment, the Cas protein is preferably a Cas12 family, including but not limited to one or any several of Cas12a, Cas12b, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, and Cas12j.

[0014] Preferably, the sequence of the region that binds to the Cas protein is shown as SEQ ID No.31.

[0015] On the one hand, the present invention provides a method for detecting transgenic plants, which comprises contacting a nucleic acid to be detected with a V-type Cas protein, the above-mentioned gRNA and a single-stranded nucleic acid detector; detecting a detectable signal generated by the Cas protein cutting the single-stranded nucleic acid detector, thereby detecting transgenic plants.

[0016] In one embodiment, the V-type Cas protein is selected from any one of the following:

[0017] (1) The amino acid sequence of the V-type Cas protein is shown in SEQ ID No.78;

[0018] (2) Compared with SEQ ID No. 78, the amino acid sequence of the V-type Cas protein has mutations at the 165th, 166th and 267th amino acids corresponding to the amino acid sequence shown in SEQ ID No. 78.

[0019] In one embodiment, the amino acid positions 165, 166 and 267 are all mutated to R.

[0020] It will be appreciated that proteins can be altered in a variety of ways, including amino acid substitutions, deletions, truncations and insertions, and methods for such manipulations are generally known in the art. For example, amino acid sequence variants of the above-mentioned proteins can be prepared by mutations in the DNA. Other forms of mutagenesis and / or directed evolution can also be accomplished, for example, using known mutagenesis, recombination and / or shuffling methods, in combination with related screening methods, to perform single or multiple amino acid substitutions, deletions and / or insertions.

[0021] Those skilled in the art will appreciate that these minor amino acid changes in the Cas proteins of the present invention can occur (e.g., naturally occurring mutations) or be generated (e.g., using r-DNA technology) without loss of protein function or activity. If these mutations occur in the catalytic domain, active site, or other functional domain of the protein, the properties of the polypeptide may be changed, but the polypeptide may retain its activity. If the mutations present are not close to the catalytic domain, active site, or other functional domain, lesser effects may be expected.

[0022] Those skilled in the art can identify the essential amino acids of the Cas mutant protein of the present invention according to methods known in the art, such as site-directed mutagenesis or protein evolution or analysis of a bioinformatics system. The catalytic domain, active site or other functional domain of the protein can also be determined by physical analysis of the structure, such as by the following techniques: such as nuclear magnetic resonance, crystallography, electron diffraction or photoaffinity labeling, combined with mutations of amino acids at putative key sites.

[0023] In the present invention, amino acid residues can be represented by single letters or three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamine (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine ​​(Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), arginine (Arg, R).

[0024] The term "AxxB" means that the amino acid A at position xx is changed to amino acid B, for example, D166R means that D at position 166 is mutated to R; D165R-D166R-D267R means that positions 165, 166 and 267 are mutated from D to R at the same time.

[0025] The specific amino acid position (number) within the protein of the present invention is determined by aligning the amino acid sequence of the target protein with SEQ ID No. 78 using standard sequence alignment tools, such as using the Smith-Waterman algorithm or using the CLUSTALW2 algorithm to align the two sequences, wherein the sequences are considered aligned when the alignment score is the highest. The alignment score can be calculated according to the method described in Wilbur, WJ and Lipman, DJ (1983) Rapid similarity searches of nucleic acid and protein data banks. Proc. Natl. Acad. Sci. USA, 80: 726-730. The default parameters are preferably used in the ClustalW2 (1.82) algorithm: protein gap open penalty = 10.0; protein gap extension penalty = 0.2; protein matrix = Gonnet; protein / DNA end gap = -1; protein / DNAGAPDIST = 4. Preferably, the AlignX program (part of the vectorNTI group) is used to determine the position of specific amino acids in the protein of the present invention by comparing the amino acid sequence of the protein with SEQ ID No.78 with default parameters suitable for multiple alignment (gap opening penalty: 10og gap extension penalty 0.05).

[0026] Furthermore, the transgenic plant is transgenic soybean or transgenic corn.

[0027] In one embodiment, the transgenic plant is soybean DBN9004, and the guide sequence of gRNA is SEQ ID No.10.

[0028] In one embodiment, the transgenic plant is soybean GTS40-3-2, and the guide sequence of gRNA is SEQ ID No.12.

[0029] In one embodiment, the transgenic plant is soybean Zhonghuang 6106, and the guide sequence of gRNA is SEQ ID No.16.

[0030] In one embodiment, the transgenic plant is corn DBN9936, and the guide sequence of gRNA is SEQ ID No.19.

[0031] In one embodiment, the transgenic plant is corn MON810, and the guide sequence of gRNA is SEQ ID No.26.

[0032] In one embodiment, the transgenic plant is corn double-resistant 12-5, and the guide sequence of gRNA is SEQ ID No.27.

[0033] In one embodiment, the method further comprises the step of obtaining the nucleic acid to be tested from the sample to be tested; preferably, the nucleic acid to be tested is obtained from the sample to be tested by amplification.

[0034] In the present invention, the nucleic acid to be detected may be a double-stranded nucleic acid or a single-stranded nucleic acid.

[0035] The amplification of the present invention is selected from one or any combination of PCR, nucleic acid sequencing-based amplification (NASBA), recombinase polymerase amplification (RPA), loop-mediated isothermal amplification (LAMP), strand displacement amplification (SDA), helicase-dependent amplification (HDA), or nickase amplification reaction (NEAR), multiple displacement amplification (MDA), rolling circle amplification (RCA), ligase chain reaction (LCR), or derivative amplification method (RAM), preferably, loop-mediated isothermal amplification (LAMP) is used.

[0036] On the other hand, the present invention provides a system, composition or kit for detecting or diagnosing whether a plant to be tested is a transgenic plant, wherein the system, composition or kit comprises the above-mentioned V-type Cas protein, the above-mentioned gRNA and a single-stranded nucleic acid detector.

[0037] Furthermore, the system, composition or kit also includes amplification primers.

[0038] In one embodiment, the amplification primer is selected from any one or more of the following groups of LAMP amplification primers: (1) the transgenic plant is soybean DBN9004, and the amplification primer sequence is shown in SEQ ID No.32-37; (2) the transgenic plant is soybean GTS40-3-2, and the amplification primer sequence is shown in SEQ ID No.43-47; (3) the transgenic plant is soybean Zhonghuang 6106, and the amplification primer sequence is shown in SEQ ID No.49-54; (4) the transgenic plant is corn DBN9936, and the amplification primer sequence is shown in SEQ ID No.55-60; (5) the transgenic plant is corn MON810, and the amplification primer sequence is shown in SEQ ID No.67-72; (6) the transgenic plant is corn Shuangkang 12-5, and the amplification primer sequence is shown in SEQ ID No.73-77.

[0039] On the other hand, the present invention also provides use of the above composition in diagnosing or detecting transgenic soybeans or transgenic corns.

[0040] On the other hand, the present invention also provides the use of the above composition in preparing a reagent or a kit for diagnosing or detecting transgenic soybean or transgenic corn.

[0041] In the present invention, the sample to be detected or diagnosed is derived from soybean or corn.

[0042] Furthermore, the V-type Cas protein is selected from Cas12, Cas14 family proteins or mutants thereof.

[0043] In one embodiment, the Cas protein is preferably a Cas12 family, including but not limited to one or any several of Cas12a, Cas12b, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, and Cas12j.

[0044] In one embodiment, the Cas12a is selected from one or any several of FnCas12a, AsCas12a, LbCas12a, Lb5Cas12a, HkCas12a, OsCas12a, TsCas12a, BbCas12a, BoCas12a or Lb4Cas12a.

[0045] In a preferred embodiment, the amino acid sequence of the Cas12i protein is selected from the group consisting of:

[0046] (1) the protein shown in SEQ ID NO.78;

[0047] (2) A derivative protein having substantially the same function formed by replacing, deleting or adding one or more (such as 2, 3, 4, 5, 6, 7, 8, 9 or 10) amino acid residues of the amino acid sequence shown in SEQ ID NO. 78 or its active fragment;

[0048] (3) A protein having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to SEQ ID NO. 78 and having trans activity.

[0049] In one embodiment, the Cas protein mutant comprises an amino acid substitution, deletion or replacement, and the mutant at least retains its trans cleavage activity. Preferably, the mutant has Cis and trans cleavage activity.

[0050] In the present invention, "Cas mutant protein" can also be referred to as a mutated Cas protein, or a Cas protein variant.

[0051] In the present invention, the single-stranded nucleic acid detector includes single-stranded DNA, single-stranded RNA or single-stranded DNA-RNA hybrid. In other embodiments, the single-stranded nucleic acid detector includes a mixture of any two or three of single-stranded DNA, single-stranded RNA or single-stranded DNA-RNA hybrid, for example, a combination of single-stranded DNA and single-stranded RNA, a combination of single-stranded DNA and single-stranded DNA-RNA hybrid, and a combination of single-stranded RNA and single-stranded DNA-RNA. In other embodiments, the single-stranded nucleic acid detector also includes a modification of the base.

[0052] In a preferred embodiment, the single-stranded nucleic acid detector is a single-stranded oligonucleic acid detector.

[0053] The single-stranded nucleic acid detector does not hybridize with the gRNA.

[0054] In the present invention, the detectable signal is realized by the following means: vision-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, fluorescence signal, colloidal phase transition / dispersion, electrochemical detection and semiconductor-based detection.

[0055] In some embodiments, the method of the present invention further comprises the step of measuring a detectable signal generated by a CRISPR / CAS effector protein (Cas protein). After the Cas protein recognizes the target nucleic acid or hybridizes with the target nucleic acid, it can stimulate the cleavage activity of any single-stranded nucleic acid, thereby cleaving the single-stranded nucleic acid detector and generating a detectable signal.

[0056] In the present invention, the detectable signal can be any signal generated when the single-stranded nucleic acid detector is cut. For example, detection based on gold nanoparticles, fluorescence polarization, fluorescence signal, colloidal phase change / dispersion, electrochemical detection, semiconductor-based sensing. The detectable signal can be read out by any suitable means, including but not limited to: measurement of detectable fluorescence signals, gel electrophoresis detection (by detecting changes in bands on the gel), detection of the presence or absence of color based on vision or sensors, or differences in the presence of colors (e.g., based on gold nanoparticles) and differences in electrical signals.

[0057] In a preferred embodiment, the detectable signal is achieved in the following manner: different reporter groups are respectively set at the 5' end and the 3' end of the single-stranded nucleic acid detector, and when the single-stranded nucleic acid detector is cut, a detectable reporter signal can be exhibited; for example, a fluorescent group and a quenching group are respectively set at the two ends of the single-stranded nucleic acid detector, and when the single-stranded nucleic acid detector is cut, a detectable fluorescent signal can be exhibited.

[0058] In one embodiment, the fluorescent group is selected from one or any several of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED460; the quenching group is selected from one or any several of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

[0059] In other embodiments, the detectable signal can also be achieved in the following manner: different labeling molecules are respectively provided at the 5' end and the 3' end of the single-stranded nucleic acid detector, and the reaction signal is detected by colloidal gold detection.

[0060] In some embodiments, the measurement of the detectable signal can be quantitative, and in other embodiments, the measurement of the detectable signal can be qualitative.

[0061] Preferably, the single-stranded nucleic acid detector generates a first detectable signal before being cleaved by the Cas protein, and generates a second detectable signal different from the first detectable signal after being cleaved.

[0062] In other embodiments, the single-stranded nucleic acid detector includes one or more modifications, such as base modifications, backbone modifications, sugar modifications, etc., to provide new or enhanced features (such as improved stability) to the nucleic acid. Examples of suitable modifications include modified nucleic acid backbones and non-natural internucleoside linkages, and nucleic acids with modified backbones include those that retain phosphorus atoms in the backbone and those that do not have phosphorus atoms in the backbone. Suitable modified oligonucleotide backbones containing phosphorus atoms include phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkylphosphonates. In some embodiments, the single-stranded nucleic acid detector contains one or more phosphorothioates and / or heteroatom nucleoside bonds. In other embodiments, the single-stranded nucleic acid detector can be a nucleic acid mimetic; in certain embodiments, the nucleic acid mimetic is a peptide nucleic acid (PNA), another type of nucleic acid mimetic is based on a linked morpholinyl unit (morpholinyl nucleic acid) having a heterocyclic base attached to a morpholine ring, and other nucleic acid mimics also include cyclohexenyl nucleic acids (CENA), and also include ribose or deoxyribose chains.

[0063] In one embodiment, the molar ratio of the Cas protein to the gRNA is (0.8-1.2):1.

[0064] In one embodiment, the final concentration of the Cas protein is 20-200 nM, preferably, 30-100 nM, more preferably, 40-80 nM, more preferably, 50 nM.

[0065] In one embodiment, the final concentration of the gRNA is 20-200 nM, preferably, 30-100 nM, more preferably, 40-80 nM, more preferably, 50 nM.

[0066] In one embodiment, the final concentration of the nucleic acid to be tested is 5-100 nM, preferably, 10-50 nM.

[0067] In one embodiment, the single-stranded nucleic acid detector is used at a final concentration of 100-1000 nM, preferably 150-800 nM, preferably 200-800 nM, preferably 200-500 nM, preferably 200-300 nM.

[0068] In one embodiment, the single-stranded nucleic acid detector has 2-300 nucleotides, preferably 3-200 nucleotides, preferably 3-100 nucleotides, preferably 3-30 nucleotides, preferably 4-20 nucleotides, more preferably 5-15 nucleotides.

[0069] The term "hybridization" or "complementary" or "substantially complementary" refers to a nucleic acid (e.g., RNA, DNA) comprising a nucleotide sequence that enables it to non-covalently bind, i.e., to form base pairs and / or G / U base pairs, "anneal" or "hybridize" with another nucleic acid in a sequence-specific, antiparallel manner (i.e., nucleic acid-specific binding to complementary nucleic acids). Hybridization requires that the two nucleic acids contain complementary sequences, although there may be mismatches between the bases. Suitable conditions for hybridization between two nucleic acids depend on the length of the nucleic acids and the degree of complementarity, which are variables well known in the art. Typically, the length of a hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).

[0070] It should be understood that the sequence of a polynucleotide need not be 100% complementary to the sequence of its target nucleic acid to specifically hybridize. A polynucleotide may comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% sequence complementarity to the target region in the target nucleic acid sequence with which it hybridizes.

[0071] General Definition:

[0072] Unless defined otherwise, technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art.

[0073] The term "amino acid" refers to a carboxylic acid containing an amino group. Various proteins in living organisms are composed of 20 basic amino acids.

[0074] The terms "polynucleotide", "nucleotide sequence", "nucleic acid sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, which may be double-stranded or single-stranded.

[0075] The term "oligonucleotide" refers to a sequence containing 3-100 nucleotides, preferably, 3-30 nucleotides, preferably, 4-20 nucleotides, more preferably, 5-15 nucleotides.

[0076] The terms "homology" or "identity" are used to refer to the sequence similarity between two polypeptides or between two nucleic acids.

[0077] Matching occurs when a position in the two sequences being compared is replaced by the same base or amino acid monomer.

[0078] When the subunits are occupied (for example, one position in each of the two DNA molecules is occupied by adenine,

[0079] or a position in each of the two polypeptides is occupied by lysine, then each molecule has

[0080] is identical. Between two sequences. Usually, when two sequences are aligned to produce maximum identity

[0081] Comparison. Such comparison can be by using, for example, the identity of the amino acid sequence can be determined by conventional methods, with reference to, for example, Smith and Waterman, 1981, Adv. Appl. Math. 2: 482 Pearson & Lipman, 1988, Proc. Natl Acad. Sci. USA 85: 2444, Thompson et al., 1994, Nucleic Acids Res 22: 467 380, etc., by computerized operation algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics software package, Genetics Computer Group). The BLAST algorithm available from the National Center for Biotechnology Information (NCBI www.ncbi.nlm.nih.gov / ) can also be used, using default parameters to determine.

[0082] As used herein, the "CRISPR" refers to Clustered regularly interspaced short palindromic repeats, which are derived from the immune system of microorganisms.

[0083] As used herein, "biotin", also known as vitamin H, is a small molecule vitamin with a molecular weight of 244 Da. "Avidin", also known as anti-biotin, is an alkaline glycoprotein with 4 binding sites with extremely high affinity to biotin. Commonly used avidins include streptavidin. The extremely strong affinity of biotin and avidin can be used to amplify or enhance the detection signal in the detection system. For example, biotin can easily bind to proteins (such as antibodies, etc.) with covalent bonds, and the avidin molecules bound to the enzyme react with the biotin molecules bound to the specific antibody, which not only plays a multi-stage amplification role, but also produces color due to the catalytic effect of the enzyme when it encounters the corresponding substrate, thereby achieving the purpose of detecting unknown antigen (or antibody) molecules.

[0084] Cas proteins

[0085] The "Cas protein" described herein refers to a CRISPR-associated protein, preferably a CRISPR / CAS protein from type V or type VI, which, once bound to a characteristic sequence (target sequence) to be detected (i.e., forming a ternary complex of Cas protein-gRNA-target sequence), can induce its trans activity, i.e., randomly cutting non-targeted single-stranded nucleotides (i.e., the single-stranded nucleic acid detector described herein, preferably single-stranded DNA (ssDNA), single-stranded DNA-RNA hybrid, single-stranded RNA). When the Cas protein binds to a characteristic sequence, it can induce its trans activity by cutting or not cutting the characteristic sequence; preferably, it induces its trans activity by cutting the characteristic sequence; more preferably, it induces its trans activity by cutting the single-stranded characteristic sequence.

[0086] The Cas protein described in the present invention is a protein having at least trans cleavage activity, preferably, the Cas protein is a protein having Cis and trans cleavage activity. The Cis activity refers to the activity of the Cas protein in recognizing the PAM site and specifically cleaving the target sequence under the action of gRNA.

[0087] The Cas protein of the present invention includes type V and type VI CRISPR / CAS effector proteins, including protein families such as Cas12, Cas13, and Cas14. Preferably, for example, Cas12 protein, such as Cas12a, Cas1 2b, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, and Cas12j; preferably, the Cas protein is Cas12a, Cas12b, Cas12i, and Cas12j, and the Cas13 protein family includes Cas13a, Cas13b, and the like.

[0088] In an embodiment, the Cas protein referred to herein, such as Cas12, also encompasses functional variants of Cas or its homologs or orthologs. As used herein, the "functional variant" of a protein refers to a variant of such a protein that at least partially retains the activity of the protein. Functional variants may include mutants (which may be insertion, deletion or substitution mutants), including polymorphs, etc. Functional variants also include fusion products of such a protein with another generally unrelated nucleic acid, protein, polypeptide or peptide. Functional variants may be naturally occurring or may be artificial. Favorable embodiments may relate to engineered or non-naturally occurring V-type DNA targeting effector proteins.

[0089] In one embodiment, one or more nucleic acid molecules encoding a Cas protein, such as Cas12, or its orthologs or homologs can be codon optimized for expression in eukaryotic cells. Eukaryotic organisms can be as described herein. One or more nucleic acid molecules can be engineered or non-naturally occurring.

[0090] In one embodiment, the Cas12 protein or its ortholog or homolog may comprise one or more mutations (and thus the nucleic acid molecule encoding it may have one or more mutations. The mutation may be an artificially introduced mutation and may include, but is not limited to, one or more mutations in the catalytic domain.

[0091] In one embodiment, the Cas protein can be from: Leptotrichia, Listeria, Corynebacterium, Sutterella, Legionella, Treponema, Mycobacterium, Eubacterium, Streptococcus, Lactobacillus, Mycoplasma, Bacteroides, Flaviivola, Flavobacterium, Azospirillum, Sphaerochaeta, Gluconacetobacter, Neisseria, Roseburia, Parvibaculum, Staphylococcus, Nitratifractor, Mycoplasma, Campylobacter, and Lachnospira.

[0092] The Cas protein can be obtained by recombinant expression vector technology, that is, the nucleic acid molecule encoding the protein is constructed into a suitable vector, and then transformed into a host cell, so that the encoding nucleic acid molecule is expressed in the cell, thereby obtaining the corresponding protein. The protein can be secreted by the cell, or the cell can be cracked to obtain the protein by conventional extraction techniques. The encoding nucleic acid molecule can be integrated into the genome of the host cell for expression, or it can be expressed without being integrated into the host cell. The vector further includes regulatory elements that are conducive to sequence integration or self-replication. The vector can be a plasmid, a virus, a cosmid, a phage, etc., which are well known to those skilled in the art. Preferably, the expression vector in the present invention is a plasmid. The vector further includes one or more regulatory elements selected from promoters, enhancers, ribosome binding sites for translation initiation, terminators, polyadenylic acid sequences, and selection marker genes.

[0093] The host cell can be a prokaryotic cell, such as Escherichia coli, Streptomyces, Agrobacterium; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a plant cell. Those skilled in the art are aware of how to select appropriate vectors and host cells.

[0094] gRNA

[0095] As used herein, the "gRNA" is also referred to as guide RNA or guide RNA, and has the meaning generally understood by those skilled in the art. In general, the guide RNA may include a direct repeat sequence and a guide sequence, or may consist essentially of or consist of a direct repeat sequence and a guide sequence (also referred to as a spacer in the context of an endogenous CRISPR system). In different CRISPR systems, gRNA may include crRNA and tracrRNA, or may only contain crRNA, depending on the different Cas proteins on which it depends. CrRNA and tracrRNA may be artificially modified and fused to form a single guide RNA (sgRNA). In some cases, the guide sequence is any polynucleotide sequence that has sufficient complementarity with the target sequence (the characteristic sequence described in the present invention) to hybridize with the target sequence and guide the specific binding of the CRISPR / Cas complex to the target sequence, typically having a sequence length of 12-25nt. The direct repeat sequence may be folded to form a specific structure (such as a stem-loop structure) for recognition by the Cas protein to form a complex. The guide sequence does not need to be 100% complementary to the characteristic sequence (target sequence). The guide sequence is not complementary to the single-stranded nucleic acid detector.

[0096] In certain embodiments, when optimally aligned, the degree of complementarity (match) between a guide sequence and its corresponding target sequence is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Determining optimal alignment is within the capabilities of one of ordinary skill in the art. For example, there are publicly available and commercially available alignment algorithms and programs, such as, but not limited to, ClustalW, Smith-Waterman in matlab, Bowtie, Geneious, Biopython, and SeqMan.

[0097] The gRNA described in the present invention may be natural, or artificially modified or designed and synthesized.

[0098] Single-stranded nucleic acid detector

[0099] The single-stranded nucleic acid detector of the present invention refers to a sequence containing 2-200 nucleotides, preferably 2-150 nucleotides, preferably 3-100 nucleotides, preferably 3-30 nucleotides, preferably 4-20 nucleotides, more preferably 5-15 nucleotides, preferably a single-stranded DNA molecule, a single-stranded RNA molecule or a single-stranded DNA-RNA hybrid.

[0100] The single-stranded nucleic acid detector is used in the detection method or system to report whether the target nucleic acid exists in the sample. The single-stranded nucleic acid detector includes different reporting groups or labeling molecules at both ends. When it is in the initial state (i.e., uncleaved state), it does not present a reporting signal. When the single-stranded nucleic acid detector is cleaved, it presents a detectable signal, i.e., a detectable difference is shown after cleavage and before cleavage. In the present invention, if a detectable difference can be detected, it reflects that the target nucleic acid can be detected; or, if the detectable difference cannot be detected, it reflects that the target nucleic acid cannot be detected.

[0101] In one embodiment, the reporter group or labeling molecule includes a fluorescent group and a quencher group, the fluorescent group is selected from one or any several of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED460; the quencher group is selected from one or any several of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

[0102] In other embodiments, the single-stranded nucleic acid detector has a first molecule (such as FAM or FITC) connected to one end and a second molecule (such as biotin) connected to the other end. The reaction system containing the single-stranded nucleic acid detector is used in conjunction with a flow strip to detect target nucleic acids (preferably, colloidal gold detection). The flow strip is designed to have two capture lines, with an antibody that binds to the first molecule (i.e., the first molecule antibody) at the sample contact end (colloidal gold), an antibody that binds to the first molecule antibody at the first line (control line), and an antibody that binds to the second molecule (i.e., the second molecule antibody, such as avidin) at the second line (test line). When the reaction flows along the strip, the first molecule antibody binds to the first molecule and carries the cut or uncut oligonucleotide to the capture line, and the cut reporter will bind to the antibody of the first molecule antibody at the first capture line, and the uncut reporter will bind to the second molecule antibody at the second capture line. The binding of the reporter group to each line will result in a strong readout / signal (e.g., color). As more reporters are cut, more signals will accumulate at the first capture line, and less signals will appear at the second line. In some aspects, the present invention relates to the use of a flow strip as described herein for detecting nucleic acids. In some aspects, the present invention relates to a method for detecting nucleic acids using a flow strip as defined herein, such as a (lateral) flow test or a (lateral) flow immunochromatographic assay. In some aspects, the molecules in the single-stranded nucleic acid detector can be replaced with each other, or the position of the molecules can be changed, as long as the reporting principle is the same or similar to the present invention, the improved method is also included in the present invention.

[0103] The detection method of the present invention can be used for quantitative detection of target nucleic acid. The quantitative detection index can be quantified according to the signal strength of the reporter group, such as according to the luminescence intensity of the fluorescent group, or according to the width of the color band.

[0104] Sequence information

[0105] The partial sequence information involved in the present invention is provided as follows:

[0106]

[0107]

[0108]

[0109]

[0110]

[0111] BRIEF DESCRIPTION OF THE DRAWINGS

[0112] Figure 1 . Screening results of transgenic soybean DBN9004-gRNA; Figure 1 a-1d represent the detection results of different gRNAs from DBN9004-crRNA-1 to DBN9004-crRNA-4, respectively. Fluorescence curve 1 represents the control group, i.e., the blank control, and fluorescence curve 2 represents the experimental group.

[0113] Figure 2 .Results of primer specificity test for transgenic soybean DBN9004; Figure 2 a is the primer amplification result; Figure 2 b is the result of enzyme digestion detection; Figure 2 In a and 2b, 1-8 represent the internal reference gene Lectin, DBN9004, Zhonghuang 6106, GTS40, non-transgenic soybean, rice, wheat and negative control NTC, respectively.

[0114] Figure 3 .Sensitivity test results of the detection system for genetically modified soybean DBN9004; fluorescence curves 1-5 represent template concentrations of 2copy / ul, 4copy / ul, 8copy / ul, 16copy / ul, and 32copy / ul, respectively; NTC represents the negative control.

[0115] Figure 4 .Identification and screening results of genetically modified soybean DBN9004 samples.

[0116] Figure 5 . Screening results of transgenic soybean GTS40-3-2-gRNA; Figure 5 a-5d represent the detection results of different gRNAs from GTS40-crRNA-1 to GTS40-crRNA-4, respectively. Fluorescence curve 1 represents the control group, i.e., blank control, and fluorescence curve 2 represents the experimental group.

[0117] Figure 6 .Results of primer specificity test for transgenic soybean GTS40-3-2; Figure 6 a is the primer amplification result; Figure 6 b is the result of enzyme digestion detection; Figure 6 In a and 6b, 1-8 represent the internal reference gene Lectin, GTS40, Zhonghuang 6106, Meng 810, non-transgenic soybean, rice, wheat and negative control NTC, respectively.

[0118] Figure 7 .Sensitivity test results of the transgenic soybean GTS40-3-2 detection system; fluorescence curves 1-5 represent template concentrations of 2copy / ul, 4copy / ul, 8copy / ul, 16copy / ul, and 32copy / ul respectively; NTC represents the negative control.

[0119] Figure 8 .Identification and screening results of genetically modified soybean GTS40-3-2 samples.

[0120] Fig. 9 . Screening results of transgenic soybean Zhonghuang 6106-gRNA; Fig. 9 a-9d represent the detection results of different gRNAs from ZH6106-crRNA-1 to ZH6106-crRNA-4, respectively. Fluorescence curve 1 represents the control group, i.e., the blank control, and fluorescence curve 2 represents the experimental group.

[0121] Fig.10 .Results of primer specificity test for transgenic soybean Zhonghuang 6106; Fig.10 a is the primer amplification result; Fig.10 b is the result of enzyme digestion detection; Fig.10 In a and 10b, 1-8 represent the internal reference gene Lectin, ZH6106, DBN9004, GTS40, non-transgenic soybean, rice, wheat and negative control NTC, respectively.

[0122] Fig.11 . Sensitivity test results of the detection system for transgenic soybean Zhonghuang 6106; fluorescence curves 1-5 represent template concentrations of 2copy / ul, 4copy / ul, 8copy / ul, 16copy / ul, and 32copy / ul, respectively; NTC represents the negative control.

[0123] Fig.12.Identification and screening results of genetically modified soybean Zhonghuang 6106 sample.

[0124] Fig.13 . Screening results of transgenic corn DBN9936-gRNA; Fig.13 a-13d represent the detection results of different gRNAs from DBN9936-crRNA-1 to DBN9936-crRNA-4, respectively. Fluorescence curve 1 represents the control group, i.e., the blank control, and fluorescence curve 2 represents the experimental group.

[0125] Fig.14 .Results of primer specificity test for transgenic corn DBN9936; Fig.14 a is the primer amplification result; Fig.14 b is the result of enzyme digestion detection; Fig.14 In a and 14b, 1-8 represent the internal reference genes zSSIIB, DBN9936, Meng 810, Shuangkang 12-5, non-transgenic corn, rice, wheat and negative control NTC, respectively.

[0126] Fig.15 .Sensitivity test results of the detection system for transgenic corn DBN9936; fluorescence curves 1-5 represent template concentrations of 2copy / ul, 4copy / ul, 8copy / ul, 16copy / ul, and 32copy / ul, respectively; NTC represents the negative control.

[0127] Fig.16 .Identification and screening results of genetically modified corn DBN9936 samples.

[0128] Fig.17 . Screening results of transgenic maize MON810-gRNA; Fig.17 a-17d represent the detection results of different gRNAs from M810-crRNA-1 to M810-crRNA-4, respectively. Fluorescence curve 1 represents the control group, i.e., blank control, and fluorescence curve 2 represents the experimental group.

[0129] Fig.18 .Results of primer specificity test for transgenic corn MON810; Fig.18 a is the primer amplification result; Fig.18 b is the result of enzyme digestion detection; Fig.18 In a and 18b, 1-8 represent the internal reference genes zSSIIB, M810, DBN9936, Shuangkang 12-5, non-transgenic corn, rice, wheat and negative control NTC, respectively.

[0130] Fig.19.Sensitivity test results of the genetically modified corn MON810 detection system; fluorescence curves 1-5 represent template concentrations of 2copy / ul, 4copy / ul, 8copy / ul, 16copy / ul, and 32copy / ul respectively; NTC represents the negative control.

[0131] Fig. 20 .Identification and screening results of genetically modified corn MON810 samples.

[0132] Fig.21 . Screening results of transgenic maize dual resistance to 12-5-gRNA; Fig.21 a-21d represent the detection results of different gRNAs from 12-5-crRNA-1 to 12-5-crRNA-4, respectively. Fluorescence curve 1 represents the control group, i.e., blank control, and fluorescence curve 2 represents the experimental group.

[0133] Fig. 22 .Results of primer specificity test for transgenic corn double resistance 12-5; Fig. 22 a is the primer amplification result; Fig. 22 b is the result of enzyme digestion detection; Fig.18 In a and 18b, 1-8 represent the internal reference gene zSSIIB, 12-5, DBN9936, Meng 810, non-transgenic maize, rice, wheat and negative control NTC, respectively.

[0134] Fig.23 .Sensitivity test results of transgenic corn dual-resistance 12-5 detection system; fluorescence curves 1-5 represent template concentrations of 2copy / ul, 4copy / ul, 8copy / ul, 16copy / ul, and 32copy / ul respectively; NTC represents the negative control.

[0135] Fig.24 .Identification and screening results of transgenic corn double-resistant 12-5 samples.

[0136] Fig.25 . Cas protein editing efficiency after mutation. DETAILED DESCRIPTION

[0137] The present invention is further described below in conjunction with the embodiments. The following description is only a preferred embodiment of the present invention, and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change it into an equivalent embodiment with equivalent changes. Any simple modification or equivalent change made to the following embodiments based on the technical essence of the present invention without departing from the content of the present invention falls within the protection scope of the present invention.

[0138] The technical solution of the present invention is based on the following principles, combining LAMP amplification with CRISPR technology, and has the characteristics of rapidity, sensitivity, specificity and high efficiency. Under the premise that there is a specific nucleic acid of the target pathogen in the sample, the specific primer binds to the target sequence, and the target sequence is enriched by LAMP amplification. The Cas enzyme (Cas protein) binds to the amplified product under the guidance of gRNA, activates the trans-scission (trans) activity of the Cas protein, and the Reporter in the shearing system (Reporter is connected to a fluorescent group at one end and a quenching group at the other end). After being sheared by the Cas protein, the Reporter will release fluorescence to present the test results. In other embodiments, the two ends of the single-stranded nucleic acid detector (Reporter) can also be set as a marker that can be detected by colloidal gold.

[0139] Example 1. Transgenic soybean DBN9004-LAMP amplification primers and gRNA screening 1. Amplification primer design:

[0140] The present invention amplifies two regions (target sites), including the T-DNA sequence specific to the transgenic soybean DBN9004 variety and the soybean endogenous sequence adjacent thereto. The information of the specific sequence SEQ ID NO.1 is as follows:

[0141] ACCCTTACTAGCTTACCCTAGTTCCGTTTGTATCCTTCTCTGCTTTCGTAGCGACAATTGAAACGCTCGCTAAAGCGCGTGCTTCTCACGTCTCGTAGTTAAGCTTGATAACGCGGCCGCTCTAGGGCGCCGGGTCCCGTTTAAACTATCAGTGTTTGAAGACATATTTTTGTGGATCTAGGTTCATCACCTACATC

[0142] The Lectin gene was selected as the soybean internal reference gene and used as the quality control system of the kit.

[0143] The LAMP isothermal amplification primers were designed according to the specific target sequence:

[0144]

[0145]

[0146] 2. Sample processing:

[0147] After soybean leaves were lysed using self-developed lysis buffer, the supernatant was used as a template for amplification. The experimental steps are as follows:

[0148] (1) Take a 0.5 cm × 0.5 cm leaf or embryo and place it in a 1.5 ml or 2 ml centrifuge tube;

[0149] (2) Add 300 μL of lysis buffer until the lysis buffer covers the sample;

[0150] (3) breaking up the leaves or embryos by proofing or grinding;

[0151] (4) Centrifuge at 7500 rpm for 2 min and collect the supernatant as the amplification template (be careful not to aspirate any residue or foam).

[0152] 3. Design and activity verification of gRNA:

[0153] Four crRNAs were designed in the amplification section. The three bases before the 5' end of each crRNA were TTN (PAM sequence). The four crRNAs were: DBN9004-crRNA-1, DBN9004-crRNA-2, DBN9004-crRNA-3, DBN9004-crRNA-4. The crRNAs needed to be connected with the spacer sequence (AGAGAAUGUGUGCAUAGUCACAC) to function together. The underlined region is the target region of the gRNA, and the sequence is as follows:

[0154] DBN9004-crRNA-1:agagaaugugugcauagucacac cguuuguauccuucucugcu

[0155] DBN9004-crRNA-2:agagaaugugugcauagucacac caauugucgcuacgaaagcag

[0156] DBN9004-crRNA-3: agagaauguggcauagucacac agcgagcguuucaauugucgc

[0157] DBN9004-crRNA-4:agagaaugugcauagucacac auaacgcggccgcucuagggcg

[0158] Double-strand cleavage experiments were performed on the four designed crRNAs, and the double-strand was a double-stranded DNA containing the crRNA cleavage target site.

[0159] LAMP amplification system:

[0160] Components Working fluid Final concentration Dosage BST DNA Polmerase 40U / μl 40U / kit 1.4 10*Primer MIX 2.5 Reporter 50mM 1 MgSO4 100mM 4 2.2 10*rection Buffer 10* 1* 2.5 dNTP 10mM 1.6mM 4 BSA 1.5mg / ml 1.25 H2O Up to 25 stencil 2

[0161] Cas12i enzyme digestion system (25ul) is as follows:

[0162]

[0163]

[0164] Screening steps:

[0165] (1) Add LAMP system, paraffin oil, and template and centrifuge for 15 seconds;

[0166] (2) Open the lid and add 25 μl of enzyme digestion system to the lid;

[0167] (3) Amplification temperature: 65°C, amplification time: 15 min;

[0168] (4) After amplification, centrifuge for 15 seconds to centrifuge the enzyme digestion system to the bottom of the tube, vortex to mix, and centrifuge again;

[0169] (5) Perform enzyme digestion reaction at 37°C in a qPCR instrument, read fluorescence every 20 seconds, and react for 7 minutes;

[0170] (6) After the enzyme digestion is completed, select blue light to take a photo on the gel imaging instrument;

[0171] The results are as follows Figure 1 As shown, the horizontal axis represents the number of cycles, each cycle is 20s, and the vertical axis represents the fluorescence intensity. According to the results, the double-stranded cleavage activity of DBN9004-crRNA-4 is better than the other four, and no non-specific cleavage occurs. The length of the crRNA designed in the experiment is 22bp. Adding or reducing bases at the 3' end based on this length will not have a substantial effect on the activity of the crRNA. The crRNA length can be 16-28bp. Subsequent experiments were conducted using DBN9004-crRNA-4.

[0172] The sequence of the wild-type Cas12i protein used in this embodiment and subsequent embodiments is

[0173]

[0174] Example 2. Transgenic soybean DBN9004-primer specificity detection experiment

[0175] LAMP amplification was performed using DNA extracted from leaves and seeds of soybean DBN9004, Zhonghuang 6106, GTS40-3-2 and non-genetically modified soybeans, as well as rice and wheat samples as templates to verify the amplification specificity of the system.

[0176] The LAMP amplification system and enzyme digestion system refer to Example 1, and the amplification results are as follows Figure 2 As shown in a, in this amplification system, only the DBN9004 variety and the internal reference gene Lectin showed normal amplification results, and there was no amplification signal in Zhonghuang 6106, GTS40-3-2 and non-genetically modified soybean, rice, and wheat samples, indicating that the system has good specificity.

[0177] The results of enzyme digestion are as follows Figure 2 As shown in b, only the normally amplified DBN9004 variety and the internal reference gene Lectin could detect fluorescence after enzyme digestion.

[0178] Example 3. Transgenic soybean DBN9004-detection system sensitivity experiment

[0179] The concentration of the synthesized plasmid containing the detection sequence was accurately quantified using a Qubit fluorescence quantifier, and its copy number was calculated. Plasmid samples of 32, 16, 8, 4, and 2 copies / ul were obtained by gradient dilution. The above 5 concentrations of plasmid samples were used as templates, and RNA-Free H2O was used as a negative control to perform LAMP amplification to explore the detection limit of the system. The amplification and enzyme digestion system was performed with reference to Example 1.

[0180] The results of enzyme digestion are as follows Figure 3 As shown, all templates can be detected when the lowest concentration is 4 copy / ul, but when it is reduced to 2 copy, three replicates cannot detect it, so the detection limit of this system is 4 copy / ul.

[0181] Example 4. Identification and screening of transgenic event DBN9004

[0182] Take 20 unknown samples of leaves with a length of 0.5 cm 2 The size is about 100 mg, or the seed powder is about 100 mg. The nucleic acid is quickly released using a nucleic acid rapid release agent. Centrifuge and take 2uL of the supernatant as a template. The optimized system is used for detection. The test results are as follows Figure 4 The statistical results are shown in the table below.

[0183]

[0184] The sample numbers and plant types are shown in the following table, where “+” indicates positive plants and “-” indicates negative plants.

[0185] The results of enzyme digestion are as follows Figure 4 As shown, all samples were further verified by Sanger sequencing, and the results were consistent with the results of this experiment, with a coincidence rate of 100%, further proving the accuracy of the present invention.

[0186] Example 5. Transgenic soybean GTS40-3-2 LAMP amplification primers and gRNA screening

[0187] 1. Amplification primer design:

[0188] The present invention amplifies two regions (target sites), including the T-DNA sequence specific to the transgenic soybean GTS40-3-2 (also referred to as GTS40 in the present invention) and the soybean endogenous sequence adjacent thereto. The information of the specific sequence SEQ ID NO.2 is as follows:

[0189] AAGACTTCATAGTACACTACACTACTTCTTTAAAAATGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCCACTATCCTTCGCAAGACCCTTCCTCTATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTGACAAGCTGACTCTAGCAGATCTTTTCAAGAATGGCACAAATTAACAACATGGCTCAAGGGATACA

[0190] The Lectin gene was selected as the soybean internal reference gene, and the amplification primers were used as the quality control system of the kit according to Example 1.

[0191] The LAMP isothermal amplification primers were designed according to the specific target sequence:

[0192]

[0193]

[0194] 2. Sample processing:

[0195] Refer to the sample processing method in Example 1.

[0196] 3. Design and activity verification of gRNA:

[0197] Four crRNAs were designed in the amplification section. The three bases before the 5' end of each crRNA were TTN (PAM sequence). The four crRNAs were GTS40-crRNA-1, GTS40-crRNA-2, GTS40-crRNA-3, and GTS40-crRNA-4. The crRNAs needed to be connected with the spacer sequence (AGAGAAUGUGUGCAUAGUCACAC) to function together. The underlined region is the target region of the gRNA, and the sequence is as follows:

[0198] GTS40-crRNA-1:agagaaugugugcauagucacac cucuauauaaggaaguucauu

[0199] GTS40-crRNA-2:agagaaugugcauagucacac gaacgucuucuuuuuuccacga

[0200] GTS40-crRNA-3:agagaaugugcauagucacac auuucauuuggagaggacacg

[0201] GTS40-crRNA-4:agagaaugugugcauagucacac uugaaagaucugcuagaguca

[0202] The designed 4 crRNAs were subjected to double-stranded cleavage experiments respectively. The double-stranded DNA contained the crRNA cleavage target. The amplification system and the enzyme cleavage system were referred to Example 1. The results are as follows Figure 5 As shown, the horizontal axis represents the number of cycles, each cycle is 20s, and the vertical axis represents the fluorescence intensity. The double-stranded cleavage activity of GTS40-crRNA-2 is better than the other four, and no non-specific cleavage occurs. The crRNA length designed in the experiment is 21bp. Adding or reducing bases at the 3' end based on this length will not have a substantial effect on the activity of crRNA. The crRNA length can be between 16-28bp. Subsequent experiments were performed using GTS40-crRNA-2.

[0203] Example 6. Transgenic soybean GTS40-3-2-primer specificity detection experiment

[0204] LAMP amplification was performed on DNA extracted from leaves and seeds of soybean GTS40, Zhonghuang 6106, DBN9004 and non-GM soybeans, as well as rice and wheat samples as templates to verify the amplification specificity of the system. The LAMP amplification system and enzyme digestion system refer to Example 1. The amplification results are shown in 6a. In this system, only the GTS40-3-2 variety and the internal reference gene Lectin can be amplified normally. There is no amplification signal in Zhonghuang 6106, Meng 810 and non-GM soybeans, rice and wheat samples, indicating that the system has good specificity. The enzyme digestion results are shown in Figure 6 As shown in b, only the normally amplified GTS40-3-2 variety and the internal reference gene Lectin could detect fluorescence after enzyme digestion.

[0205] Example 7. Transgenic soybean GTS40-3-2-detection system sensitivity experiment

[0206] The concentration of the synthesized plasmid containing the detection sequence was accurately quantified using a Qubit fluorescence quantifier, and its copy number was calculated. Plasmid samples of 32, 16, 8, 4, and 2 copies / ul were obtained by gradient dilution. The above 5 concentrations of plasmid samples were used as templates, and RNA-Free H2O was used as a negative control to perform LAMP amplification to explore the detection limit of the system. The amplification and enzyme digestion system was performed with reference to Example 1.

[0207] The results of enzyme digestion are as follows Figure 7 As shown, all templates can be detected when the concentration is 2 copy / ul, so the detection limit of this system is 2 copy / ul.

[0208] Example 8. Identification and screening of transgenic event GTS40-3-2

[0209] Take 20 unknown sample leaves of 0.5cm2 in size, or about 100mg of seed powder, use a nucleic acid rapid release agent to quickly release the nucleic acid, centrifuge, take 2uL of the supernatant as a template, and use the optimized system for detection. The test results are shown in the table below.

[0210]

[0211] The sample numbers and plant types are shown in the following table, where “+” indicates positive plants and “-” indicates negative plants.

[0212] The results of enzyme digestion are as follows Figure 8 As shown, all samples were further verified by Sanger sequencing, and the results were consistent with the results of this experiment, with a coincidence rate of 100%, further proving the accuracy of the present invention.

[0213] Example 9. Transgenic soybean Zhonghuang 6106-LAMP amplification primers and gRNA screening

[0214] 1. Amplification primer design:

[0215] The present invention amplifies two regions (target sites), including the T-DNA sequence specific to the transgenic soybean Zhonghuang 6106 (also referred to as ZH6106 in the present invention) and the adjacent soybean endogenous sequence. The information of the specific sequence SEQ ID NO.3 is as follows:

[0216] CGTGACTGGAGAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGCTAGAGCAGCTTGAGCTTGGATCAGATTGTCGTTTCCCGC

[0217] The Lectin gene was selected as the soybean internal reference gene, and the amplification primers were used as the quality control system of the kit according to Example 1.

[0218] The LAMP isothermal amplification primers were designed according to the specific target sequence:

[0219]

[0220] 2. Sample processing:

[0221] Refer to the sample processing method in Example 1.

[0222] 3. Design and activity verification of gRNA:

[0223] Four crRNAs were designed in the amplification section. The three bases before the 5' end of each crRNA were TTN (PAM sequence). The four crRNAs were: ZH6106-crRNA-1, ZH6106-crRNA-2, ZH6106-crRNA-3, and ZH6106-crRNA-4. The crRNA needs to be connected with the spacer sequence (AGAGAAUGUGUGCAUAGUCACAC) to function together. The underlined area is the target area of ​​the gRNA, and the sequence is as follows:

[0224] ZH6106-crRNA-1:agagaaugugcauagucacac ccaacaguugcgcagccugaa

[0225] ZH6106-crRNA-2:agagaaugugugcauagucacaccgcagccugaauggcgaaugc

[0226] ZH6106-crRNA-3:agagaaugugcauagucacac gccagcuggcguaauagcgaa

[0227] ZH6106-crRNA-4:agagaaugugcauagucacac cagcacaucccccuuucgcc

[0228] The designed 4 crRNAs were subjected to double-stranded cleavage experiments respectively. The double-stranded DNA contained the crRNA cleavage target. The amplification system and the enzyme cleavage system were referred to Example 1. The results are as follows Fig. 9 As shown, the horizontal axis represents the number of cycles, each cycle is 20s, and the vertical axis represents the fluorescence intensity. The double-stranded cleavage activity of ZH6106-crRNA-2 is better than the other four, and no non-specific cleavage occurs. The crRNA length designed in the experiment is 21bp. Adding or reducing bases at the 3' end based on this length will not have a substantial effect on the activity of crRNA. The crRNA length can be between 16-28bp. Subsequent experiments were carried out using ZH6106-crRNA-2.

[0229] Example 10. Transgenic soybean ZH6106-primer specificity detection experiment

[0230] LAMP amplification was performed using DNA extracted from leaves and seeds of soybeans ZH6106, DBN9004, GTS40 and non-genetically modified soybeans, as well as rice and wheat samples as templates to verify the amplification specificity of the system. The LAMP amplification system and enzyme digestion system refer to Example 1.

[0231] The amplification results are shown in 10a. In this system, only ZH6106 variety and internal reference gene Lectin can be amplified normally. There is no amplification signal in DBN9004, GTS40 and non-transgenic soybean, rice and wheat samples, indicating that the system has good specificity. Fig.10 As shown in b, only the normally amplified ZH6106 variety and the internal reference gene Lectin could detect fluorescence after enzyme digestion.

[0232] Example 11. Transgenic soybean ZH6106-sensitivity experiment of detection system

[0233] The concentration of the synthesized plasmid containing the detection sequence was accurately quantified using a Qubit fluorescence quantifier, and its copy number was calculated. Plasmid samples of 32, 16, 8, 4, and 2 copies / ul were obtained by gradient dilution. The above 5 concentrations of plasmid samples were used as templates, and RNA-Free H2O was used as a negative control to perform LAMP amplification to explore the detection limit of the system. The amplification and enzyme digestion system was performed with reference to Example 1.

[0234] The results of enzyme digestion are as follows Fig.11 As shown, all templates can be detected when the concentration is 2 copy / ul, so the detection limit of this system is 2 copy / ul.

[0235] Example 12. Identification and screening of transgenic event ZH6106

[0236] Take 20 unknown sample leaves of 0.5cm2 in size, or about 100mg of seed powder, use a nucleic acid rapid release agent to quickly release the nucleic acid, centrifuge, take 2uL of the supernatant as a template, and use the optimized system for detection. The test results are shown in the table below.

[0237]

[0238] The sample numbers and plant types are shown in the following table, where “+” indicates positive plants and “-” indicates negative plants.

[0239] The results of enzyme digestion are as follows Fig.12 As shown, all samples were further verified by Sanger sequencing, and the results were consistent with the results of this experiment, with a coincidence rate of 100%, further proving the accuracy of the present invention.

[0240] Example 13. Transgenic corn DBN9936-LAMP amplification primers and gRNA screening

[0241] 1. Amplification primer design:

[0242] The present invention amplifies two regions (target sites), including the T-DNA sequence specific to the transgenic corn DBN9936 variety and the adjacent corn endogenous sequence. The information of the specific sequence SEQ ID NO.4 is as follows:

[0243] ATCAGGAGCAAGAAAACATCCCAAAACGCTAGGCTCATGGGCACACAAGACACATTGTGGTGTAAACAAATTGACGCTTAGACAACTTAATAACACATTGCGGATACGGCCATGCTGGCCGCCCCGCGCCGATCTAGTAACATAGATGACACCGCGCGCGATAATTTATCCTAGTTTGCGCGCTATATTTTGTTTTCTATCGCGTATTAAATGTATAATTGCGGGACTCTAATCAT

[0244] The ZSSIIB gene was selected as the maize internal reference gene and used as the quality control system of the kit.

[0245] The LAMP isothermal amplification primers were designed according to the specific target sequence:

[0246]

[0247] 2. Sample processing:

[0248] Refer to the sample processing method in Example 1.

[0249] 3. Design and activity verification of gRNA:

[0250] Four crRNAs were designed in the amplification section. The three bases before the 5' end of each crRNA were TTN (PAM sequence). The four crRNAs were DBN9936-crRNA-1, DBN9936-crRNA-2, DBN9936-crRNA-3, and DBN9936-crRNA-4. The crRNA needs to be connected with the spacer sequence (AGAGAAUGUGUGCAUAGUCACAC) to function together. The underlined area is the target area of ​​the gRNA, and the sequence is as follows:

[0251] DBN9936-crRNA-1:agagaaugugcauagucacac auaacacauugcggauacggcc

[0252] DBN9936-crRNA-2:agagaaugugcauagucacac uuaaguugucuaagcgucaauu

[0253] DBN9936-crRNA-3:agagaaugugcauagucacac ucuaagcgucaauuuguuuaca

[0254] DBN9936-crRNA-4:agagaaugugcauagucacac guuuacaccacaaugugucuug

[0255] The designed 4 crRNAs were subjected to double-stranded cleavage experiments respectively. The double-stranded DNA contained the crRNA cleavage target. The amplification system and the enzyme cleavage system were referred to Example 1. The results are as follows Fig.13 As shown, the horizontal axis represents the number of cycles, each cycle is 20s, and the vertical axis represents the fluorescence intensity. The double-stranded cleavage activity of DBN9936-crRNA-1 is better than the other four, and no non-specific cleavage occurs. The crRNA length designed in the experiment is 22bp. Adding or reducing bases at the 3' end based on this length will not have a substantial effect on the activity of crRNA. The crRNA length can be between 16-28bp. Subsequent experiments were carried out using DBN9936-crRNA-1.

[0256] Example 14. Transgenic corn DBN9936-primer specificity detection experiment

[0257] LAMP amplification was performed using DNA extracted from leaves and seeds of maize DBN9936, MON810, double-resistant 12-5 and non-transgenic maize, as well as rice and wheat samples as templates to verify the amplification specificity of the system. The LAMP amplification system and enzyme digestion system refer to Example 1.

[0258] The amplification results are as follows Fig.14 As shown in a, in this system, only the DBN9936 variety and the internal reference gene zSSIIB can be amplified normally, and there is no amplification signal in MON810, double-antibody 12-5 and non-transgenic corn, rice, and wheat samples, indicating that the system has good specificity. Fig.14 As shown in b, only the normally amplified DBN9936 variety and the internal reference gene zSSIIB could detect fluorescence after enzyme digestion.

[0259] Example 15. Transgenic corn DBN9936-detection system sensitivity experiment

[0260] The concentration of the synthesized plasmid containing the detection sequence was accurately quantified using a Qubit fluorescence quantifier, and its copy number was calculated. Plasmid samples of 32, 16, 8, 4, and 2 copies / ul were obtained by gradient dilution. The above 5 concentrations of plasmid samples were used as templates, and RNA-Free H2O was used as a negative control to perform LAMP amplification to explore the detection limit of the system. The amplification and enzyme digestion system was performed with reference to Example 1.

[0261] The results of enzyme digestion are as follows Fig.15 As shown, all the templates can be detected when the concentration is 4 copy / ul, but when it is reduced to 2 copy, no detection can be made after 3 replicates. Therefore, the detection limit of this system is 4 copy / ul.

[0262] Example 16. Identification and screening of transgenic corn DBN9936

[0263] Take 20 unknown sample leaves of 0.5cm2 in size, or about 100mg of seed powder, use a nucleic acid rapid release agent to quickly release the nucleic acid, centrifuge, take 2uL of the supernatant as a template, and use the optimized system for detection. The test results are shown in the table below.

[0264]

[0265] The sample numbers and plant types are shown in the following table, where “+” indicates positive plants and “-” indicates negative plants.

[0266] The results of enzyme digestion are as follows Fig.16As shown, all samples were further verified by Sanger sequencing, and the results were consistent with the results of this experiment, with a coincidence rate of 100%, further proving the accuracy of the present invention.

[0267] Example 17. Transgenic corn MON810-LAMP amplification primers and gRNA screening

[0268] 1. Amplification primer design:

[0269] The present invention amplifies two regions (target sites), including the T-DNA sequence specific to the transgenic corn MON810 (also referred to as M810 in the present invention) and the adjacent endogenous corn sequence. The information of the specific sequence SEQ ID NO.5 is as follows:

[0270] CATCGAAGACAGCCACGACCTCGAGATTTACCTGATCCGCTACAACGCCAAGCACGAGACCGTCAACGTGCCCGGTACTGGTTCCCTCTGGCCGCTGAGCGCCCCCAGCCCGATCGGCAAGTGTGCCCACCACAGCCACCACTTCTCCTTGGACATCGATGTGGGCTGCACCGACCTGAACGAGGACTTTCGGTAGCCTTCTTTCATTTCCGAATTTGCTTGCGAGCAGTCAGGTCCTT

[0271] The ZSSIIB gene was selected as the corn internal reference gene, and the amplification primers were referred to Example 13 as the quality control system of the kit.

[0272] The LAMP isothermal amplification primers were designed according to the specific target sequence:

[0273]

[0274] 2. Sample processing:

[0275] Refer to the sample processing method in Example 1.

[0276] 3. Design and activity verification of gRNA:

[0277] Four crRNAs were designed in the amplification section. The three bases before the 5' end of each crRNA were TTN (PAM sequence). The four crRNAs were M810-crRNA-1, M810-crRNA-2, M810-crRNA-3, and M810-crRNA-4. The crRNA needs to be connected with the spacer sequence (AGAGAAUGUGUGCAUAGUCACAC) to function together. The underlined area is the target area of ​​the gRNA, and the sequence is as follows:

[0278] M810-crRNA-1:agagaaugugcauagucacac acggucucgugcuuggcguug

[0279] M810-crRNA-2:agagaaugugcauagucacac ccgaucgggcugggggcgcuc

[0280] M810-crRNA-3:agagaaugugcauagucacac uccuuggacaucgaugugggc

[0281] M810-crRNA-4:agagaaugugcauagucacac ccucuggccgcugagcgcccc

[0282] The designed 4 crRNAs were subjected to double-stranded cleavage experiments respectively. The double-stranded DNA contained the crRNA cleavage target. The amplification system and the enzyme cleavage system were referred to Example 1. The results are as follows Fig.17 As shown, the horizontal axis represents the number of cycles, each cycle is 20s, and the vertical axis represents the fluorescence intensity. The double-stranded cleavage activity of M810-crRNA-4 is better than the other four, and no non-specific cleavage occurs. The length of the crRNA designed in the experiment is 21bp. Adding or reducing bases at the 3' end based on this length will not have a substantial effect on the activity of the crRNA. The crRNA length can be 16-28bp. M810-crRNA-4 was used for subsequent experiments.

[0283] Example 18. Transgenic corn MON810-primer specificity detection experiment

[0284] LAMP amplification was performed using DNA extracted from leaves and seeds of corn M810, DBN9936, double-resistant 12-5 and non-transgenic corn, as well as rice and wheat samples as templates to verify the amplification specificity of the system. The LAMP amplification system and enzyme digestion system refer to Example 1.

[0285] The amplification results are as follows Fig.18As shown in a, in this system, only the M810 variety and the internal reference gene zSSIIB can be amplified normally, and there is no amplification signal in DBN9936, double-antibody 12-5 and non-transgenic corn, rice, and wheat samples, indicating that the system has good specificity. Fig.18 As shown in b, only the normally amplified M810 variety and the internal reference gene zSSIIB could detect fluorescence after enzyme digestion.

[0286] Example 19. Transgenic corn MON 810-detection system sensitivity experiment

[0287] The concentration of the synthesized plasmid containing the detection sequence was accurately quantified using a Qubit fluorescence quantifier, and its copy number was calculated. Plasmid samples of 32, 16, 8, 4, and 2 copies / ul were obtained by gradient dilution. The above 5 concentrations of plasmid samples were used as templates, and RNA-Free H2O was used as a negative control to perform LAMP amplification to explore the detection limit of the system. The amplification and enzyme digestion system was performed with reference to Example 1.

[0288] The results of enzyme digestion are as follows Fig.19 As shown, all the templates can be detected when the concentration is 4 copy / ul, but when it is reduced to 2 copy, no detection can be made after 3 replicates. Therefore, the detection limit of this system is 4 copy / ul.

[0289] Example 20. Identification and screening of transgenic maize MON810-

[0290] Take 20 unknown sample leaves of 0.5cm2 in size, or about 100mg of seed powder, use a nucleic acid rapid release agent to quickly release the nucleic acid, centrifuge, take 2uL of the supernatant as a template, and use the optimized system for detection. The test results are shown in the table below.

[0291]

[0292] The sample numbers and plant types are shown in the following table, where “+” indicates positive plants and “-” indicates negative plants.

[0293] The results of enzyme digestion are as follows Fig. 20 As shown, all samples were further verified by Sanger sequencing, and the results were consistent with the results of this experiment, with a coincidence rate of 100%, further proving the accuracy of the present invention.

[0294] Example 21. Transgenic corn dual-resistance 12-5-LAMP amplification primers and gRNA screening

[0295] 1. Amplification primer design:

[0296] The present invention amplifies two regions (target sites), including the T-DNA sequence specific to the transgenic corn double-resistant 12-5 variety and the adjacent corn endogenous sequence. The information of the specific sequence SEQ ID NO.6 is as follows:

[0297] CCTGAATGATGAATGCTAGAGCAGCTTGAGCTTGGATCAGATTGTCGTTTCCCGCCTTCAGTTTAAACTATCAGTCTCGTTGTAGCGTCGGGCGATGTGGTTGAGCTCGAGCCCGTAGAACTTGTCTTCCAGGCACCGAACGTCATCGCAGTAGGCCTCCATCTTCGGGTCGCGGCAGTGGGAGTTCTTC

[0298] The zSSIIB gene was selected as the corn internal reference gene, and the amplification primers were referred to Example 13 as the quality control system of the kit.

[0299] The LAMP isothermal amplification primers were designed according to the specific target sequence:

[0300]

[0301]

[0302] 2. Sample processing:

[0303] Refer to the sample processing method in Example 1.

[0304] 3. Design and activity verification of gRNA:

[0305] Four crRNAs were designed in the amplification section. The three bases before the 5' end of each crRNA were TTN (PAM sequence). The four crRNAs were 12-5-crRNA-1, 12-5-crRNA-2, 12-5-crRNA-3, and 12-5-crRNA-4. The crRNA needs to be connected with the spacer sequence (AGAGAAUGUGUGCAUAGUCACAC) to function together. The underlined area is the target area of ​​the gRNA, and the sequence is as follows:

[0306] 12-5-crRNA-1:agagaaugugcauagucacac uagcgucgggcgaugugguug

[0307] 12-5-crRNA-2:agagaaugugcauagucacac ucguuucccgccuucaguuuaa

[0308] 12-5-crRNA-3:agagaaugugcauagucacac agcucgagcccguagaacuug

[0309] 12-5-crRNA-4:agagaaugugcauagucacac aguuuaaacuaucagucucg

[0310] The designed 4 crRNAs were subjected to double-stranded cleavage experiments respectively. The double-stranded DNA contained the crRNA cleavage target. The amplification system and the enzyme cleavage system were referred to Example 1. The results are as follows Fig.21 As shown, the horizontal axis represents the number of cycles, each cycle is 20s, and the vertical axis represents the fluorescence intensity. The double-stranded cleavage activity of 12-5-crRNA-1 is better than the other four, and no non-specific cleavage occurs. The length of the crRNA designed in the experiment is 22bp. Adding or reducing bases at the 3' end based on this length will not have a substantial effect on the activity of the crRNA. The crRNA length can be 16-28bp. Subsequent experiments use 12-5-crRNA-1 for experiments.

[0311] Example 22. Transgenic corn dual resistance 12-5-primer specificity detection experiment

[0312] LAMP amplification was performed using DNA extracted from leaves and seeds of maize 12-5, DBN9936, Meng 810, non-transgenic maize, rice, wheat and other samples as templates to verify the amplification specificity of the system. The LAMP amplification system and enzyme digestion system refer to Example 1.

[0313] The amplification results are as follows Fig. 22 As shown in a, in this system, only 12-5 varieties and the internal reference gene zSSIIB can be amplified normally, and there is no amplification signal in DBN9936, Meng 810 and non-transgenic corn, rice, and wheat samples, indicating that the system has good specificity. Fig. 22 As shown in b, only the normally amplified M810 variety and the internal reference gene zSSIIB could detect fluorescence after enzyme digestion.

[0314] Example 23. Transgenic corn dual resistance 12-5-detection system sensitivity experiment

[0315] The concentration of the synthesized plasmid containing the detection sequence was accurately quantified using a Qubit fluorescence quantifier, and its copy number was calculated. Plasmid samples of 32, 16, 8, 4, and 2 copies / ul were obtained by gradient dilution. The above 5 concentrations of plasmid samples were used as templates, and RNA-Free H2O was used as a negative control to perform LAMP amplification to explore the detection limit of the system. The amplification and enzyme digestion system was performed with reference to Example 1.

[0316] The results of the enzyme digestion experiment are shown in the figure below. When the template concentration is 4 copy / ul, all can still be detected, but after reducing it to 2 copy, 3 repeats cannot be detected. Therefore, the detection limit of this system is 4 copy / ul.

[0317] Example 24. Identification and screening of transgenic corn with dual resistance to 12-5-

[0318] Take 20 unknown sample leaves of 0.5cm2 in size, or about 100mg of seed powder, use a nucleic acid rapid release agent to quickly release the nucleic acid, centrifuge, take 2uL of the supernatant as a template, and use the optimized system for detection. The detection results are shown in the table below.

[0319]

[0320]

[0321] The sample numbers and plant types are shown in the following table, where “+” indicates positive plants and “-” indicates negative plants.

[0322] The results of enzyme digestion are as follows Fig.24 As shown, all samples were further verified by Sanger sequencing, and the results were consistent with the results of this experiment, with a coincidence rate of 100%, further proving the accuracy of the present invention.

[0323] Supplementary examples are provided to reflect that: Cas12i with improved editing activity was screened in the above-mentioned Cas12i protein, and 165 / 166 / 267 combined mutations were used; the Cas12i and the above-screened crRNA were tested in the above manner, and the results showed that the trans cutting activity of different crRNAs was further improved.

[0324] Example 25. Further improving detection efficiency by optimizing Cas protein

[0325] In order to further improve the detection efficiency of transgenic plants, the present embodiment performs mutation optimization on Cas protein to improve its editing and detection activity. The applicant predicts the key amino acid sites that may affect its biological function through bioinformatics, and mutates the amino acid sites to obtain Cas mutant proteins with improved detection activity. Specifically, the amino acids that the potential Cas12i3 binds to the target sequence are subjected to site-directed mutagenesis by bioinformatics methods. In the present embodiment, the 165th, 166th and 267th amino acid sites from the N-terminus shown in SEQ ID No.78 are predicted by bioinformatics methods, and site-directed mutagenesis is performed, and the amino acid sequence of wild-type Cas12i3 is shown in SEQ ID No.78.

[0326] Variants of Cas proteins are generated by PCR-based site-directed mutagenesis. The specific method is to divide the DNA sequence of Cas12i3 protein into two parts with the mutation site as the center, design two pairs of primers to amplify the two parts of DNA sequence respectively, introduce the sequence to be mutated on the primers, and finally load the two fragments into the pcDNA3.3-eGFP vector by Gibson cloning. The combination of mutants is constructed by splitting the DNA of Cas12i3 protein into multiple segments and using PCR and Gibsonclone. Fragment amplification kit: TransStartFastPfu DNA Polymerase (containing 2.5mM dNTPs), please refer to the instructions for the specific experimental process. Gel recovery kit: Gel DNA Extraction Mini Kit, please refer to the instructions for the specific experimental process. Kit used for vector construction: pEASY-Basic Seamless Cloning and Assembly Kit (CU201-03), please refer to the instructions for the specific experimental process. In this embodiment, the Cas protein D165R-D166R-D267R with simultaneous mutations of amino acids at positions 165, 166 and 267 of SEQ ID No.78 is obtained, and the above-mentioned amino acid sites at positions 165, 166 and 267 are all mutated to R. The activity of the obtained mutant protein D165R-D166R-D267R was verified, and a fluorescent reporter system suitable for verifying Cas12i3 cutting was constructed with reference to the literature (Yang, Yi, et al. "Highly efficient and rapid detection of the cleavage activity of Cas9 / gRNA via a fluorescent reporter." Applied biochemistry and biotechnology 180.4 (2016): 655-667.). The fluorescent reporter vector contains RFP and non-luminescent GFFP fluorescent proteins, and the Cas vector contains CFP fluorescent protein. TTT The target site TTTAACAGTGGCCTTATTAA was tested. The underlined position is the PAM sequence. After transfection of CHO cells for 48 hours, the editing efficiency can be determined by flow cytometry sorting the ratio of GFP fluorescence in CFP and RFP. Fig.25 As shown, the mutated Cas protein has significantly improved editing activity compared to the wild-type Cas12i3.

[0327] The mutated Cas protein D165R-D166R-D267R was combined with the above-screened gRNA for the detection of transgenic soybean DBN9004, transgenic soybean GTS 40-3-2, transgenic soybean Zhonghuang 6106, transgenic corn DBN9936, transgenic corn MON810 and transgenic corn Shuangkang 12-5. The gRNA sequences are shown in the following table:

[0328] DBN9004-crRNA-4 <![CDATA[agagaaugugugcauagucacac auaacgcggccgcucuagggcg ]]> GTS40-crRNA-2 <![CDATA[agagaaugugugcauagucacac gaacgucuucuuuuuuccacga ]]> ZH6106-crRNA-2 agagaaugugugcauagucacaccgcagccugaauggcgaaugc DBN9936-crRNA-1 <![CDATA[agagaaugugugcauagucacac auaacacauugcggauacggcc ]]> M810-crRNA-4 <![CDATA[agagaaugugugcauagucacac ccucuggccgcugagcgcccc ]]> 12-5-crRNA-1 <![CDATA[agagaaugugugcauagucacac uagcgucgggcgaugugguug ]]>

[0329] According to the detection method in the above embodiment, the fluorescence intensity of the Cas protein D165R-D166R-D267R when used in combination with the above-mentioned gRNA was tested to reflect its cutting activity. The results showed that in different detection items, compared with the wild-type Cas12i3, the use of the mutated Cas protein in combination with the above-mentioned gRNA can further improve the detection efficiency, and the detection time is shortened by 2-4min (the peak of the fluorescence signal is advanced by 2-4min).

[0330] Although the specific embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that various modifications and changes may be made to the details according to all the teachings that have been published, and these changes are within the scope of protection of the present invention. The entire invention is given by the attached claims and any equivalents thereof.

Claims

1. A gRNA for detecting transgenic plants, the gRNA comprising a region binding to a V-type Cas protein and a guide sequence hybridizing to a target nucleic acid, characterized in that: The guide sequence hybridizes with any one of the sequences shown in SEQ ID No.1-6 or its reverse complementary sequence, and the guide sequence is the sequence shown in SEQ ID No.10, SEQ ID No.12, SEQ ID No.16, SEQ ID No.19, SEQ ID No.26 or SEQ ID No.

27.

2. A method for detecting transgenic plants, the method comprising contacting a nucleic acid to be detected with a V-type Cas protein, the gRNA according to claim 1, and a single-stranded nucleic acid detector; detecting a detectable signal generated by cleavage of the single-stranded nucleic acid detector by the Cas protein, thereby detecting transgenic plants.

3. The method according to claim 2, characterized in that The V-type Cas protein is selected from any one of the following: (1) The amino acid sequence of the V-type Cas protein is shown in SEQ ID No.78; (2) Compared with SEQ ID No. 78, the amino acid sequence of the V-type Cas protein has mutations at the 165th, 166th and 267th amino acids corresponding to the amino acid sequence shown in SEQ ID No.

78.

4. The method according to claim 3, characterized in that The transgenic plant is transgenic soybean or transgenic corn.

5. The method according to claim 4, characterized in that The transgenic plant is soybean DBN9004, and the guiding sequence of gRNA is SEQ ID No.10; or, the transgenic plant is soybean GTS40-3-2, and the guiding sequence of gRNA is SEQ ID No.12; or, the transgenic plant is soybean Zhonghuang 6106, and the guiding sequence of gRNA is SEQ ID No.16; or, the transgenic plant is corn DBN9936, and the guiding sequence of gRNA is SEQ ID No.19; or, the transgenic plant is corn MON810, and the guiding sequence of gRNA is SEQ IDNo.26; or, the transgenic plant is corn Shuangkang 12-5, and the guiding sequence of gRNA is SEQ ID No.

27.

6. The method according to claim 2, characterized in that The method further comprises the step of obtaining the nucleic acid to be tested from the sample to be tested.

7. The method according to claim 2, characterized in that The detectable signal can be achieved by any of the following: vision-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, fluorescence polarization, fluorescence signal, colloidal phase transition, electrochemical detection or semiconductor-based detection.

8. A system, composition or kit for detecting or diagnosing whether a plant to be tested is a transgenic plant, the system, composition or kit comprising the V-type Cas protein described in claim 3, the gRNA described in claim 1, and a single-stranded nucleic acid detector.

9. The system, composition or kit according to claim 8, characterized in that The system, composition or kit also includes any one or more of the following groups of LAMP amplification primers: (1) the transgenic plant is soybean DBN9004, and the amplification primer sequences are shown in SEQ ID Nos.32-37; (2) the transgenic plant is soybean GTS40-3-2, and the amplification primer sequences are shown in SEQ ID Nos.43-47; (3) the transgenic plant is soybean Zhonghuang 6106, and the amplification primer sequences are shown in SEQ ID Nos.49-54; (4) the transgenic plant is corn DBN9936, and the amplification primer sequences are shown in SEQ ID Nos.55-60; (5) the transgenic plant is corn MON810, and the amplification primer sequences are shown in SEQ ID Nos.67-72; (6) the transgenic plant is corn Shuangkang 12-5, and the amplification primer sequences are shown in SEQ ID Nos.73-77.

10. Use of the composition according to claim 9 in diagnosing or detecting transgenic soybeans or transgenic corns, or in preparing reagents or kits for diagnosing or detecting transgenic soybeans or transgenic corns.

11. The use according to claim 10, characterized in that The sample to be tested for detection or diagnosis is derived from soybean or corn.

Images