HrGA2ox gene of seabuckthorn for reducing plant gibberellin content and plant height and its application

Abstract

The present invention belongs to the field of plant molecular biology, and specifically relates to a seabuckthorn HrGA2ox gene for reducing the gibberellin content and plant height of a plant and its application. The nucleotide sequence of the seabuckthorn HrGA2ox gene is shown in SEQ ID NO.1. The present invention performs functional identification on the seabuckthorn HrGA2ox gene, and the results show that the gene is involved in the decomposition of gibberellin, and its expression level plays an important role in the growth and development of plants. The gibberellin content and plant height of the overexpressed plants in the present invention are significantly reduced. These results show that the seabuckthorn HrGA2ox gene affects the plant growth height by reducing the gibberellin content.

Description

Technical Field

[0001] The invention belongs to the technical field of plant molecular biology, and more specifically, relates to a seabuckthorn HrGA2ox gene for reducing plant gibberellin content and plant height and an application thereof. Background Art

[0002] Gibberellins are a class of diterpenoid compounds whose synthesis and degradation play an important regulatory role in plant growth and development. The reduction of endogenous gibberellins levels increases plant resistance to various stresses, such as drought, salinity and cold.

[0003] Gibberellin 2-oxidase, abbreviated as GA2ox, is a key enzyme involved in the catabolism of gibberellins. The expression level of gibberellin 2-oxidase in plants plays an important role in the growth and development of plants. Gibberellin 2-oxidase is a dioxygenase that relies on α-ketoglutarate and oxygen molecules as cosubstrates. It converts active gibberellins and their precursors into inactive gibberellins in the gibberellin synthesis pathway, thereby controlling the dynamic balance of active gibberellins in plants.

[0004] Sea buckthorn Hippophae rhamnoides Linn.) As a drought-resistant and wind-resistant plant, the research results on its development and response to abiotic stresses are mainly concentrated on physiological mechanisms. Currently, there are few in-depth studies on the identification, molecular mechanism and function of the GA2ox gene in seabuckthorn. Summary of the invention

[0005] The purpose of the present invention is to provide a seabuckthorn HrGA2ox gene for reducing the gibberellin content and plant height of plants and its application, so as to solve the above technical problems.

[0006] To achieve the above object, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a seabuckthorn HrGA2ox gene for reducing the gibberellin content and plant height of a plant. The nucleotide sequence of the HrGA2ox gene is shown in SEQ ID NO.1.

[0008] Based on the sequencing analysis of seabuckthorn transcriptome, the present invention combines bioinformatics analysis and relative expression analysis in different tissue parts and at different periods to screen out the functional gene HrGA2ox of the GA2ox gene family related to gibberellin anabolism, and clarifies the biological function of the HrGA2ox gene in the regulation of endogenous gibberellins by constructing an overexpression vector and using Arabidopsis thaliana as the receptor material for genetic transformation.

[0009] In a second aspect, the present invention further provides a recombinant expression vector comprising the seabuckthorn HrGA2ox gene.

[0010] Furthermore, the vector is composed of the HrGA2ox gene of seabuckthorn inserted into the pCAMBIA3301 overexpression vector plasmid. Nco Ⅰ and Bgl Obtained between sites II.

[0011] In a third aspect, the present invention comprises the recombinant engineered bacteria including the above-mentioned recombinant expression vector.

[0012] Furthermore, the recombinant engineered bacteria are obtained by transferring the recombinant expression vector into Agrobacterium competent cells EHA105.

[0013] In a fourth aspect, the present invention provides the use of the seabuckthorn HrGA2ox gene in reducing the gibberellin content and plant height of plants, including the plants including Arabidopsis thaliana.

[0014] In a fifth aspect, the present invention provides the use of the recombinant expression vector in reducing the gibberellin content and plant height of plants, including the plants including Arabidopsis thaliana.

[0015] Furthermore, the recombinant expression vector is transformed into cells of target plants to overexpress the HrGA2ox gene sequence to reduce the plant's gibberellin content and plant height.

[0016] Furthermore, the transformation adopts the inflorescence infection method.

[0017] In a sixth aspect, the present invention provides the use of the recombinant engineered bacteria in reducing the gibberellin content and plant height of plants, wherein the plants include Arabidopsis thaliana.

[0018] The present invention has at least the following beneficial effects:

[0019] The present invention clones the HrGA2ox gene sequence from seabuckthorn fruit, and introduces the coding sequence of the HrGA2ox gene sequence into a plant using an exogenous gene sequence expression vector, thereby obtaining a transgenic Arabidopsis thaliana overexpressing the HrGA2ox gene sequence, and the plant exhibits reduced gibberellin content and a gibberellin deficiency phenotype. The present invention regulates the expression of the HrGA2ox gene sequence in plants and is used to reduce the gibberellin content of a new plant variety, thereby providing a new idea for cultivating new crop varieties and having great application value in molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the electrophoresis diagram of the CDS sequence cloning of the HrGA2ox gene sequence, M: DNA Marker; 1~4: HrGA2ox; - is the negative control without the target gene.

[0021] Figure 2This is an identification diagram of the HrGA2ox recombinant expression vector of the present invention, wherein:

[0022] A is the electrophoresis diagram of vector digestion, M: DNA Marker; 1~5: digestion fragments,

[0023] B is the electrophoresis diagram of bacterial solution PCR identification, M: DNA Marker; 1-4: PCR fragments; - is the negative control without recombinant vector; + is the positive control with added recombinant vector.

[0024] Figure 3 This is the screening diagram of transgenic plants with high expression of HrGA2ox transgenic sequence, **** represents 0.001 <p<0.0001。

[0025] Figure 4 This is a phenotypic analysis diagram of Arabidopsis wild-type plants and T3 generation HrGA2ox transgenic sequence plants.

[0026] Figure 5 The results of determination of endogenous gibberellin content in Arabidopsis wild-type plants and T3 generation HrGA2ox transgenic plants, * indicates statistical difference of p<0.05. DETAILED DESCRIPTION

[0027] The present invention is described in detail with respect to specific examples below, but it should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0028] In the following examples, the competent cells of Escherichia coli DH5α and the competent cells of Agrobacterium tumefaciens EHA105 were purchased from Ang Yu Biotechnology Co., Ltd.; the pCAMBIA3301 vector and wild-type Arabidopsis seeds used in the construction of the expression vector were preserved by this laboratory.

[0029] Example 1

[0030] DH5α competent cells and Agrobacterium EHA105 competent cells were purchased from Ang Yu Biotechnology Co., Ltd.; the pCAMBIA3301 vector and wild-type Arabidopsis seeds used in the construction of the expression vector were preserved in this laboratory.

[0031] (1) Cloning of the HrGA2ox gene

[0032] This example uses the cDNA of seabuckthorn fruit as a template. Figure 1 As shown, the CDS sequence of the HrGA2ox gene was obtained by PCR amplification. The primers are shown in Table 1:

[0033] Table 1 Primer sequences for cloning HrGA2ox gene

[0034]

[0035] The HrGA2ox gene sequence is shown in SEQ ID NO.1.

[0036] SEQ ID NO.1:ATGGTGGTCTTGTCTAAACCAGCTATTGAACACTTCTCTTG。

[0037] (2) Construction of HrGA2ox overexpression vector

[0038] Using the HrGA2ox gene sequence as a template, the restriction site and homology arm were added to the HrGA2ox gene sequence by PCR. The primers are shown in Table 2:

[0039] Table 2 Homologous recombination primer sequences

[0040]

[0041] by Nco Ⅰ and Bgl Ⅱ restriction endonuclease site, linearize the pCAMBIA3301 vector, and the result is as follows Figure 2 As shown in A. At the same time, the linearized vector obtained above was connected with the target fragment using a seamless cloning kit to construct a recombinant plasmid pCAMBIA3301-HrGA2ox.

[0042] The recombinant plasmid was transformed into E. coli competent cells DH5α for amplification and colony PCR. The results were as follows: Figure 2 As shown in B, the overexpression pCAMBIA3301-HrGA2ox vector was obtained.

[0043] (3) Obtaining HrGA2ox transgenic plants

[0044] The pCAMBIA3301-HrGA2ox plasmid was transformed into Agrobacterium using the freeze-thaw method.

[0045] The bacteria were suspended in MS liquid medium containing 50 g / L sucrose, 1 ml 1000×VB5, 90 μL 1MNaOH, and 10 μL 6-BA. Before transformation, 200 μL / L Silwet L-77 was added to completely immerse the inflorescence of the plants grown for 45 days in the infection solution.

[0046] During the infection process, all the flower buds of the plants were immersed in the Agrobacterium resuspension for 7 minutes, and the Agrobacterium resuspension was shaken to ensure that the Arabidopsis was fully infected. After the infection was completed, the plants were taken out, placed flat on a clean tray, covered with a film, and the Arabidopsis was cultured in the dark for 24 hours.

[0047] The plants were cultured upright for 30 days, and when the pods changed from green to yellow, the seeds were judged to be mature and the T0 generation seeds were harvested.

[0048] The T0 transgenic plants were screened with 150 ng / ml Basta herbicide, and the transgenic plants were verified by PCR using the plant genome as a template to confirm the acquisition of transgenic plants. After the seeds matured, T1 seeds were collected. The T2 transgenic plants were screened using the same method as above, and transgenic plants with high gene expression were screened by qRT-PCR. The results are shown in Figure 3 As shown, qRT-PCR primers are shown in Table 3:

[0049] Table 3 qRT-PCR primer sequences

[0050]

[0051] (4) Overexpression of the HrGA2ox gene sequence reduces plant height and leaf size

[0052] After the seeds of the high-expressing plants matured, the T2 generation seeds were harvested, and the T3 generation plants were obtained after the T2 generation seeds were planted. The obtained T3 generation homozygous seeds were planted in a mixed soil with a mass ratio of nutrient soil: vermiculite of 3:7, and cultured in the dark for 3 days to germinate. Basta herbicide was used to screen them at the stage of 2 to 3 true leaves to obtain transgenic plants OE-HrGA2ox with high expression of HrGA2ox.

[0053] The OE-HrGA2ox plants with high expression of HrGA2ox were placed in an artificial climate chamber and cultured at 22°C, 16 hours of light and 8 hours of darkness. Figure 4 As shown, the height of the two high-expressing transgenic plants, OE-HrGA2ox-1 and OE-HrGA2ox-2, was significantly reduced, showing a gibberellin deficiency phenotype.

[0054] At the same time, a portion of the selected OE-HrGA2ox plants with high expression of HrGA2ox were selected for interference with exogenous gibberellin. After bolting, 1 ml of 1 mM gibberellin was sprayed on the front and back sides of the leaves. The results were as follows: Figure 4 As shown, the gibberellin deficiency phenotype of the two plants OE-HrGA2ox-1+GA and OE-HrGA2ox-2+GA was restored after exogenous gibberellin interference.

[0055] (5) HrGA2ox regulates the reduction of endogenous gibberellins in Arabidopsis

[0056] 0.2 g of rosette leaves of Arabidopsis wild-type plants and T3 generation HrGA2ox transgenic plants 10 days after bolting were ground into powder with liquid nitrogen and then added with 1.8 ml PBS buffer to grind into a homogenate. Centrifuge at 7000 rpm for 20 minutes at 4°C and take the supernatant for determination of gibberellin content.

[0057] The results are as follows Figure 5 As shown, the gibberellin content in plants overexpressing the HrGA2ox gene was significantly reduced.

[0058] The present invention regulates the reduction of endogenous gibberellin content in Arabidopsis thaliana by overexpressing the HrGA2ox gene, and obtains dwarf plants.

[0059] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that the two endpoints of each numerical range and any numerical value between the two endpoints can be selected. In order to avoid redundancy, the present invention describes a preferred embodiment.

[0060] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0061] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A seabuckthorn HrGA2ox gene for reducing plant gibberellin content and plant height, characterized in that: The plant is Arabidopsis thaliana, and the nucleotide sequence of the HrGA2ox gene is shown in SEQ ID NO.

1.

2. A recombinant expression vector, characterized in that: The method comprises the seabuckthorn HrGA2ox gene as claimed in claim 1.

3. The recombinant expression vector according to claim 2, characterized in that The seabuckthorn HrGA2ox gene is inserted between the NcoⅠ and BglⅡ sites of the pCAMBIA3301 overexpression vector plasmid to obtain the seabuckthorn HrGA2ox gene.

4. A recombinant engineered bacterium comprising the recombinant expression vector according to claim 3.

5. The recombinant engineered bacterium according to claim 4, characterized in that The recombinant expression vector is transferred into Agrobacterium competent cell EHA105 to obtain the result.

6. Use of the HrGA2ox gene of seabuckthorn according to claim 1 in reducing the gibberellin content and plant height of plants, characterized in that: The plant is Arabidopsis thaliana.

7. Use of the recombinant expression vector according to any one of claims 2 to 3 in reducing plant gibberellin content and plant height, characterized in that: The plant is Arabidopsis thaliana.

8. The use according to claim 7, characterized in that: The recombinant expression vector is transformed into cells of target plants to over-express the HrGA2ox gene to reduce the gibberellin content and plant height of the plant.

9. The use according to claim 8, characterized in that: The transformation was carried out using the inflorescence infection method.

10. Use of the recombinant engineered bacteria according to any one of claims 4 to 5 in reducing plant gibberellin content and plant height, characterized in that: The plant is Arabidopsis thaliana.

Images