Quality control product for gene detection, preparation method and application thereof

Abstract

The present application relates to the field of biotechnology, in particular to nucleic acid fragments, recombinant vectors, host cells and application for gene detection. The present application provides positive quality control for multi-gene detection; the positive quality control mainly comprises positive quality control plasmid and diluent, the target sequences of the positive quality control plasmid are connected by blocking sequences, which overcomes the problem that the quality control in the multi-gene detection kit is mixed with multiple plasmids and needs to be frozen for preservation. The test results show that the amplification effect of the positive quality control plasmid is good, the amplification efficiency is high, and the specificity is strong. Furthermore, the diluent is optimized, the stability of the quality control prepared by using the diluent on the basis of the positive quality control plasmid is better, the use is more convenient, and the quality control can be taken as needed without repeated freezing and thawing.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a quality control product for gene detection, a preparation method and application thereof. BACKGROUND

[0002] Gene detection generally refers to DNA detection, i.e. detecting DNA sequences at the genomic level. Gene detection can be used to reveal differences in human genomes or identify certain pathogens. For human genome detection, gene amplification detection can identify single base mutations, deletions, insertions and gene fusions of genes, etc., which are used to reveal differences in human genomes, identify genetic variations that may increase or decrease the risk of disease, and thus play an important role in understanding the health status and disease risk of individuals. In the field of medical health, gene detection can help understand whether there are genetic variations that can be passed on to offspring, and can help screen embryos with normal chromosomal structures to reduce the risk of genetic diseases. In addition, certain genetic mutations do not cause changes in human diseases, but can show differences in some drug use. Such differences can be manifested in three aspects: drug efficacy, dosage, and side effects. For pathogen detection, the type of pathogenic microorganism infection can be determined according to the gene detection results, such as bacterial, viral, parasitic, mycoplasma, chlamydia, streptococcal and other pathogenic microorganism infections.

[0003] The positive quality control product in the existing gene detection kit is basically a nucleic acid or plasmid containing a target sequence. Different manufacturers insert target sequences into plasmids according to the target sequences detected by their nucleic acid detection products, and generally obtain positive quality control products by mixing multiple plasmids. At present, the quality control products of most manufacturers are subsidiary products of the kit, and are stored at-20℃, which is consistent with the storage condition of the reagent, and is inconvenient to use. In addition, if multiple targets are detected, multiple plasmids are mixed, and the different plasmid concentrations cause different amplification efficiencies, so the mixing of multiple plasmids in the preparation process needs to be adjusted multiple times to ensure that the final amplification efficiency is consistent, which is time-consuming and laborious. Therefore, there is an urgent need to provide a gene detection positive quality control product with simple production method and use condition and stable storage. SUMMARY

[0004] Therefore, the present application aims to provide a quality control product for gene detection, a preparation method and application thereof.

[0005] The present application provides a nucleic acid fragment, which comprises multiple target sequences and a blocking sequence between the target sequences;

[0006] The blocking sequence is not less than 10 bp;

[0007] The blocking sequence comprises a repeated base sequence of not less than 5 bp;

[0008] The blocking sequence cannot be combined with the primer used for amplification of the target sequence.

[0009] The amplification primer includes an upstream amplification primer and a downstream amplification primer.

[0010] Further,

[0011] The repeated base sequence is located at any position of the 5' end, the 3' end or the middle of the blocking sequence.

[0012] The blocking sequence is 10-100 bp.

[0013] Further,

[0014] The plurality is two or more, and the two or more includes 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, etc.

[0015] The number of the blocking sequence is m, wherein m is an integer from 1 to 20; and the number of the blocking sequence is the number of the target sequence minus 1.

[0016] In the present application, the nucleic acid fragment can be linear or circular; it can be single-stranded or double-stranded, and the present application does not limit it; the nucleic acid fragment can be DNA or RNA, and the RNA can form the DNA by reverse transcription, and the present application does not limit it; in the specific embodiments of the present application, it is in the form of DNA.

[0017] In the present application, the blocking sequence used for different target sequences can be the same or different; in actual application, a plurality of target sequences can be connected by a plurality of blocking sequences; the plurality of blocking sequences can be the same or different, and the blocking sequence cannot be combined with the primer used for amplification of the target sequence; the combination includes specific combination and non-specific combination. Further, the term "combination" used in the present specification means that the single-stranded nucleic acid of the complementary strand forms a double-stranded nucleic acid. Combination occurs when the complementarity between the two nucleic acid strands is completely matched, or even when there is a part of mismatched bases.

[0018] Further, in the specific embodiments of the present application,

[0019] The nucleic acid fragment includes nucleic acid fragment A and / or nucleic acid fragment B.

[0020] The nucleic acid fragment A includes a blocking sequence with a nucleotide sequence as shown in SEQ ID NO: 7 and a target sequence with a nucleotide sequence as shown in SEQ ID NO: 1-SEQ ID NO: 6.

[0021] The nucleic acid fragment B comprises a blocking sequence with a nucleotide sequence as shown in SEQ ID NO: 27 and a target sequence with a nucleotide sequence as shown in SEQ ID NO: 24-SEQ ID NO: 26.

[0022] Further,

[0023] The nucleotide sequence of the nucleic acid fragment A comprises a target sequence with a nucleotide sequence as shown in SEQ ID NO: 1-SEQ ID NO: 6 connected in turn through a blocking sequence with a nucleotide sequence as shown in SEQ ID NO: 7.

[0024] The nucleotide sequence of the nucleic acid fragment B comprises a target sequence with a nucleotide sequence as shown in SEQ ID NO: 24-SEQ ID NO: 26 connected in turn through a blocking sequence with a nucleotide sequence as shown in SEQ ID NO: 27.

[0025] In the present application, the blocking sequence matched with the target sequence in the nucleic acid fragment A is shown in SEQ ID NO: 7, with a length of 67 bp, not combined with the amplification primer for the detection of the target sequence in the nucleic acid fragment A, and with 9 repeated thymine t at the 5' end;

[0026] In the present application, the target sequence in the nucleic acid fragment A is a gene fragment of different genotypes of CYP2C19, with high homology, for developing a blocking sequence suitable for a target sequence with high homology, in the specific embodiments of the present application, the different genotypes of CYP2C19 target sequences (the length of the above target sequence is 501 bp) are connected to make a positive quality control plasmid by using the blocking sequence with a nucleotide sequence as shown in SEQ ID NO: 7, and the detection is performed by using a primer set and a probe for the different genotypes of CYP2C19 target sequences, the test results show that the amplification efficiency of the positive quality control plasmid without adding the blocking sequence and adding other blocking sequences (SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, the lengths of the above blocking sequences are 62 bp, 61 bp, 13 bp, 13 bp respectively; the 3' end of the blocking sequence with a nucleotide sequence as shown in SEQ ID NO: 8 has 11 repeated guanine g, the middle of the blocking sequence with a nucleotide sequence as shown in SEQ ID NO: 9 has 12 repeated adenine a, the 5' end of the blocking sequence with a nucleotide sequence as shown in SEQ ID NO: 10 has 5 repeated thymine t, and the blocking sequence with a nucleotide sequence as shown in SEQ ID NO: 11 does not have repeated bases) has obvious difference in amplification efficiency for wild type and mutant, and the amplification curve appears again take-off phenomenon in the platform period, while the amplification curve is normal in the platform period after using the blocking sequence of the present application, with good amplification efficiency and strong specificity.

[0027] In the present application, the blocking sequence matched with the target sequence in the nucleic acid fragment B is shown as SEQ ID NO: 27, which is 62 bp in length, does not bind with the amplification primer for the detection of the target sequence in the nucleic acid fragment A, and has 9 repeated guanine g at the 3' end;

[0028] In the present application, the target sequence in the nucleic acid fragment B is a target sequence with high conservation and strong specificity of Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG) and Ureaplasma urealyticum (UU) (the length of the target sequence is between 100-200 bp), which has low homology and is used for the development of a blocking sequence suitable for a target sequence with low homology. In the specific embodiment of the present application, the blocking sequence with the nucleotide sequence shown as SEQ ID NO: 27 is used to make a positive quality control plasmid by concatenating different pathogen target sequences. The test results show that the detection result of the blocking sequence is more accurate, the amplification efficiency is good, and the specificity is strong.

[0029] The present application develops a nucleic acid fragment which can be used for gene detection. The nucleic acid fragment is recombined with the plasmid vector to form a recombinant vector, the recombinant vector is a positive quality control plasmid, the positive quality control plasmid comprises a target sequence with relatively high conservation and specificity and a blocking sequence for spacing the target sequence; the blocking sequence has low homology with the target sequence, and the blocking sequence cannot bind with the primer for amplification of the target sequence, thereby playing a role in blocking amplification; in the specific embodiment of the present application, the blocking sequence is optimized. The amplification effect of the positive quality control product without the blocking sequence is poor, the blocking sequence is short, and the blocking amplification effect is not obvious (such as the comparative plasmid 1 and the comparative plasmid 2), the sequence is too long, the synthesis cost is increased, and the plasmid can generally only accommodate foreign DNA of not more than 3 kb. For the detection of multiple target sequences, the introduction of a string of nucleotides on the non-homologous sequence further limits the length of the blocking sequence. After many attempts, it is found that the positive quality control product has the best amplification effect when the blocking sequence meets the following conditions at the same time: the length is 40-100 bp, and 5-30 repeated base sequences are contained at the 5' end.

[0030] The present application provides a recombinant vector comprising the nucleic acid fragment described in the present application;

[0031] In the specific embodiment of the present application, the target sequence and the blocking sequence are recombined with the vector to obtain a recombinant vector, which is used as a positive quality control plasmid in the present application; wherein the total length of the target sequence and the blocking sequence is less than 3 kb. If the total length of the target sequence and the blocking sequence is too large, it will lead to instability in the process of plasmid transformation, and there is a risk of loss of plasmid;

[0032] The recombinant vector of the present application refers to a recombinant nucleic acid vector, which is a recombinant DNA molecule comprising a desired coding sequence and suitable nucleic acid sequences or elements necessary for the expression of the operably linked coding gene in a specific host organism. It is known that prokaryotic cells use promoters, enhancers and terminators. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. In this specification, "plasmid" and "vector" can sometimes be used interchangeably because plasmids are currently the most commonly used form of vector. However, the present application is intended to include such other forms of expression vectors which function equivalently, which are known or become known in the art, including but not limited to: plasmids, phage particles, viral vectors and / or merely potential genomic inserts. In specific embodiments, the nucleic acid encoding the fusion protein provided by the present application can be constructed in various eukaryotic expression vectors.

[0033] In the present application, the source of the plasmid vector includes plants, animals, bacteria, fungi, bacteriophages, or viruses, which are not limited by the present application.

[0034] Further, the plasmid vector of the present application can be a cloning vector, an expression vector or other forms of vectors, which are not limited by the present application. In specific embodiments of the present application, the vector is a cloning vector, specifically a vector from bacteria, which is pUC57.

[0035] The present application provides a host cell transfected or transformed with the recombinant vector as described in the present application; the host cell is transformed or transfected with the recombinant vector constructed using recombinant DNA technology, so that the recombinant vector can have the ability to replicate in the host cell.

[0036] Further, the transformation method includes chemical transformation and electroporation; the transfection method includes calcium phosphate coprecipitation, artificial liposome method, viral transfection. The viral transfection includes adenovirus transfection, adeno-associated virus transfection, lentivirus transfection, etc.

[0037] The host cell provided by the present application is derived from plants, animals, bacteria, fungi, bacteriophages or viruses, which are not limited by the present application. In specific embodiments of the present application, the host cell is derived from bacteria, specifically Escherichia coli.

[0038] The present application provides a detection composition comprising at least one of i) to iii) and primers and probes for amplification of the target sequence in the nucleic acid fragment of the present application:

[0039] i) the nucleic acid fragment of the present application;

[0040] ii) the recombinant vector of the present application;

[0041] iii) the host cell of the present application.

[0042] The primers and probes for amplification of the target sequence comprise at least one of the following two groups:

[0043] Group 1: a wild-type upstream primer of the nucleotide sequence as shown in SEQ ID NO:X; a downstream primer of the nucleotide sequence as shown in SEQ ID NO:(X+2); a probe of the nucleotide sequence as shown in SEQ ID NO:(X+3); and a mutant upstream primer of the nucleotide sequence as shown in SEQ ID NO:(X+1); wherein X is 12, 16 and / or 20; and / or

[0044] Group 2: an upstream primer of the nucleotide sequence as shown in SEQ ID NO:N; a downstream primer of the nucleotide sequence as shown in SEQ ID NO:(N+1); and a probe of the nucleotide sequence as shown in SEQ ID NO:(N+2); wherein N is 28, 31 and / or 34.

[0045] wherein the primers and probes for amplification of the target sequence in the nucleic acid fragment A are as shown in Group 1; and the primers and probes for amplification of the target sequence in the nucleic acid fragment B are as shown in Group 2.

[0046] The present application provides a reagent combination comprising at least one of the nucleic acid fragment, the recombinant vector, the host cell and / or the detection composition of the present application and a diluent.

[0047] The diluent comprises 0.8-1.2 M Taps, 1.0-3.0 g / L preservative, 0.35-0.4 g / L EDTA·2Na and / or 1.5-2.5 g / L trehalose.

[0048] Further, the preservative comprises at least one of P300, P950 and / or NaN3.

[0049] Still further,

[0050] The diluent comprises 0.8-1.2 M Taps, 1.5 g / L P950, 1 g / L NaN3, 0.375 g / L EDTA·2Na and 2 g / L trehalose.

[0051] The diluent in the reagent combination is optimized in the application, and the test results show that, in specific embodiments of the application, the solvent of the diluent is 1M Taps buffer, and the solute of the diluent includes 1.5g / L P950, 0.375g / L EDTA·2Na and 2g / L trehalose, the detection result stability is best, and the storage duration has the least influence on the detection effect.

[0052] The application provides a method for multi-gene detection, which detects a sample by using at least one of I) to V) as follows:

[0053] I) the nucleic acid fragment of the application;

[0054] II) the recombinant vector of the application;

[0055] III) the host cell of the application;

[0056] IV) the detection composition of the application;

[0057] V) the reagent combination of the application.

[0058] Further, the PCR procedure for detecting the sample is as follows: 95℃ for 2 minutes, 1 cycle; 95℃ for 10 seconds, 60℃ for 35 seconds, 45 cycles.

[0059] The application provides a positive quality control plasmid for CYP2C19 gene typing detection, which comprises a vector skeleton and a nucleic acid fragment.

[0060] The nucleic acid fragment comprises a target sequence and a blocking sequence between the target sequences.

[0061] The nucleotide sequence of the blocking sequence is shown as SEQ ID NO: 7.

[0062] The nucleotide sequence of the target sequence is shown as SEQ ID NO: 1 to SEQ ID NO: 6.

[0063] Further, in the application, the nucleic acid fragment comprises:

[0064] The target sequences with the nucleotide sequences shown as SEQ ID NO: 1 to SEQ ID NO: 6 are connected in sequence through the blocking sequence with the nucleotide sequence shown as SEQ ID NO: 7.

[0065] Further, in the application, the nucleic acid fragment comprises:

[0066] The vector skeleton is pUC57.

[0067] The application provides a detection composition for CYP2C19 genotyping, which comprises a positive quality control plasmid for CYP2C19 genotyping detection and a primer set and a probe with a nucleic acid fragment of the positive quality control plasmid for CYP2C19 genotyping detection as a target; the primer set and the probe with the nucleic acid fragment as a target comprise: a wild-type upstream primer with a nucleotide sequence as shown in SEQ ID NO: X; a downstream primer with a nucleotide sequence as shown in SEQ ID NO: (X+2), a probe with a nucleotide sequence as shown in SEQ ID NO: (X+3) and a mutant upstream primer with a nucleotide sequence as shown in SEQ ID NO: (X+1); wherein X is 12, 16 and / or 20.

[0068] The application provides a positive quality control plasmid for CT, NG and UU gene detection, which comprises a vector skeleton and a nucleic acid fragment.

[0069] The nucleic acid fragment comprises a target sequence and a blocking sequence between the target sequence.

[0070] The nucleotide sequence of the blocking sequence is shown as SEQ ID NO: 27.

[0071] The nucleotide sequence of the target sequence is shown as SEQ ID NO: 24-SEQ ID NO: 26.

[0072] Further, in the application, the positive quality control fragment comprises:

[0073] The target sequence with the nucleotide sequence as shown in SEQ ID NO: 24-SEQ ID NO: 26 is connected in series through the blocking sequence with the nucleotide sequence as shown in SEQ ID NO: 27.

[0074] The application provides a detection composition for CT, NG and UU gene detection, which comprises a positive quality control plasmid for CT, NG and UU gene detection and a primer set and a probe with a nucleic acid fragment of the positive quality control plasmid for CT, NG and UU gene detection as a target; the primer set and the probe with the nucleic acid fragment as a target comprise: an upstream primer with a nucleotide sequence as shown in SEQ ID NO: N, a downstream primer with a nucleotide sequence as shown in SEQ ID NO: (N+1) and a probe with a nucleotide sequence as shown in SEQ ID NO: (N+2); wherein N is 28, 31 and / or 34.

[0075] Further,

[0076] The 5' end of each probe is coupled with a fluorescent group, and the 3' end is coupled with a fluorescent quenching group.

[0077] The fluorescent group is selected from any one of FAM, HEX, VIC, ROX or CY-5;

[0078] The fluorescent quenching group is selected from any one of BHQ1, MGB or BHQ2.

[0079] The fluorescent group coupled to the 5' end of each probe is different, and the fluorescent quenching group coupled to the 3' end of each probe is different.

[0080] The present application provides a reagent combination comprising:

[0081] The positive quality control plasmid and the diluent according to the present application; or

[0082] The detection composition and the diluent according to the present application.

[0083] Further,

[0084] The diluent comprises 0.8-1.2 M Taps, 1.0-3.0 g / L preservative, 0.35-0.4 g / L EDTA·2Na and / or 1.5-2.5 g / L trehalose.

[0085] The preservative comprises at least one of P300, P950 and / or 10% NaN3.

[0086] Further, 0.8-1.2 M Taps, 1.5 g / L P950, 1 g / L NaN3, 0.375 g / L EDTA·2Na and 2 g / L trehalose.

[0087] The present application provides a method for multi-gene detection, which is to detect a sample by using at least one of I) to IV) as follows:

[0088] I) the positive quality control fragment according to the present application;

[0089] II) the positive quality control plasmid according to the present application;

[0090] III) the detection composition according to the present application;

[0091] IV) the reagent combination according to the present application.

[0092] The PCR program for detecting the sample further comprises 95℃ for 2 minutes, 1 cycle; 95℃ for 10 seconds, 60℃ for 35 seconds, 45 cycles.

[0093] The present application provides a method for CYP2C19 genotyping detection, which is to detect by using the positive quality control plasmid for CYP2C19 genotyping detection, and / or the detection composition for CYP2C19 genotyping, and / or the reagent combination according to the present application.

[0094] The application provides a method for CT, NG and UU gene detection, which is detection by using the positive quality control plasmid for CT, NG and UU gene detection, and / or a detection composition for CT, NG and UU gene detection, and / or a reagent combination.

[0095] The reagent combination of the application is a detection quality control product, which is used for quality control in gene detection. However, the quality control products currently used in clinical laboratories are basically auxiliary products of nucleic acid detection products on the market, and have many unstable factors such as poor stability and large batch variation. In addition, the quality control products of various manufacturers need to be stored at-20 DEG C, which is inconvenient to use, and repeated freezing and thawing has a great influence on the detection results. Furthermore, it is found in the design and verification process of the plasmid that directly inserting multiple target gene sequences into the same plasmid will cause different amplification efficiencies of the target genes, and multiple target gene joint amplification products appear in the late amplification period. The specific reason is that the upstream primer of the first target gene and the downstream primer of the second target gene jointly act to concatenate and amplify a long sequence, causing no plateau in amplification or the amplification curve to jump again in the late amplification plateau period. If multiple plasmids are designed according to the target sequences to be amplified, there will be the problem of inconsistent amplification efficiency after mixing, and it is time-consuming and laborious to adjust the concentrations of different plasmids, finally making the amplification efficiency consistent in the adaptive reaction system. Therefore, the application develops an improved plasmid design method through repeated attempts, which can be used for quality control of multi-target gene detection and has a wide application prospect in the field of biological detection. In the application, a positive quality control plasmid with multiple target pathogen sequences is developed for the detection of multiple pathogenic bacteria.

[0096] The application provides a positive quality control product for multi-gene detection. The positive quality control product mainly comprises a recombinant plasmid (a positive quality control plasmid) and a diluent. The target sequences of the recombinant plasmid are concatenated by a blocking sequence, which overcomes the problems that the quality control product in a multi-gene detection kit is a mixture of multiple plasmids and needs to be frozen. The test results show that the positive quality control plasmid has good amplification effect, high amplification efficiency and strong specificity. In addition, the diluent is optimized in the application. The quality control product prepared by using the diluent on the basis of the positive quality control plasmid has better stability and is more convenient to use, and can be taken as needed without repeated freezing and thawing. BRIEF DESCRIPTION OF DRAWINGS

[0097] Figure 1 Amplification curve of positive quality control product 1*2 site;

[0098] Figure 2 Amplification curve of positive quality control product 2*2 site;

[0099] Figure 3Positive control 3*2 site amplification curve;

[0100] Figure 4 Positive control 4*2 site amplification curve;

[0101] Figure 5 Comparison control 1*2 site amplification curve;

[0102] Figure 6 Comparison control 2*2 site amplification curve. DETAILED DESCRIPTION

[0103] The application provides a quality control product for gene detection, a preparation method and application thereof, and those skilled in the art can refer to the content herein, and appropriately improve process parameters to realize. It is particularly pointed out that all similar replacements and changes are obvious to those skilled in the art, and they are all regarded as included in the application. The method and application of the application have been described by the preferred embodiments, and the related personnel can obviously change or appropriately change and combine the method and application herein without departing from the content, spirit and scope of the application, to realize and apply the technical solution of the application.

[0104] The application provides an improved plasmid design method to solve the problems in the prior art. A plurality of target gene sequences can be inserted into the plasmid, and the length of the target gene sequence is more than 150 base sequences. The application further provides a blocking sequence, which is introduced between the target gene sequences inserted into the plasmid. The sequence has the following characteristics: 1. The length is 10-100 bp; 2. The blocking sequence cannot be combined with primers used for amplification of the target sequence; and 3. The 5' end of the sequence needs to contain no less than 5 repetitive base sequences, and the longest repetitive base sequence is no more than 30. If the repetitive sequence is too long, it is difficult to synthesize by using the existing nucleic acid synthesis process, and the verification stage after synthesis is likely to cause low sequencing signal and sequencing failure.

[0105] In the amplification process, the two target gene sequences cannot be amplified in series due to the presence of the blocking sequence, so that the specificity is increased and the amplification efficiency is improved.

[0106] The application provides a quality control product of a genetic detection reagent and a preparation method thereof. The quality control product comprises a plasmid containing a target gene sequence and a diluent. The quality control product plasmid contains the target gene sequence. The diluent is composed of a preservative, EDTA 2Na, trehalose and Taps. The quality control product provided by the application has good stability, can be stably stored for 14 days under heat acceleration at 37 DEG C, and can be stably stored for at least 14 months in an environment of 2-8 DEG C, and the stability is obviously better than that of existing products. The quality control product designed by the method has consistency with actual sample sequences, can be used as a standard quality control product, has strong universality, and has the advantages of low cost, high stability, convenience in storage and transportation, and the like, is suitable for large-scale production of industrial level, is convenient for application and promotion, and has important value and application prospect.

[0107] Cyclic DNA synthesis: Determine the target sequence, first use PCR method or chemical synthesis method to obtain linear DNA template, purify the template, and use specific endonuclease to produce a cut at a specific position of the template DNA, which is usually located at the replication origin. After the cut, the DNA strand is divided into two, one is a fixed strand with a 5' phosphate end, and the other is a free strand with a 3' hydroxyl end. The replication initiation protein (such as RepA) binds to the 5' phosphate end at the cut, and attracts the helicase to unwind the DNA double strand. At the same time, the DNA polymerase starts to synthesize a new DNA strand with the 3' hydroxyl end of the free strand as the primer and the unbroken strand as the template. As the DNA polymerase continues to synthesize, the new strand continuously elongates and rolls around the fixed strand, forming a circular structure. When the new strand is synthesized to a certain length, it will rejoin with the 5' phosphate end of the fixed strand at the replication origin, forming a complete circular DNA molecule. Finally, the synthesized circular DNA is purified by gel electrophoresis, centrifugation and other methods.

[0108] The test materials used in the application are ordinary commercially available products and can be purchased in the market. The application is further described below in combination with examples:

[0109] Example 1 Positive quality control for CYP2C19 gene detection reagent

[0110] The positive quality control for CYP2C19 gene typing detection is a plasmid containing CYP2C19*2 wild type sequence, CYP2C19*2 mutant sequence, CYP2C19*3 wild type sequence, CYP2C19*3 mutant sequence, CYP2C19*17 wild type sequence, CYP2C19*17 mutant sequence and blocking sequence. The plasmid vector uses a commonly used mature standard vector, and the application uses a plasmid vector pUC57. The target sequence is as follows:

[0111] CYP2C19*2 wild type sequence:

[0112] GATTATCATCTTTGATTCTCTTGTCAGAATTTCCTTTCTCAAATCTTGTA T AATCAGAGAATTACTACACATGTACAATAAAAATTTCCCCATCAAGATAT

[0113] ACAAATATATTTATTATATTATTTAGTTTAAATTACAACCAGAGCTTGGCAT AT TGTA TCTATACCTTTATTAAATGCTTTTAATT T AAT A AAT TATTGT TTTCT

[0114] CTTAGATATGCAATAATTTCCCAC TATCATTGATTATTTCCC GGG AACC CATAAC AAAT TACTTAAAAACCTTGCTTTTATGGAAAGTGATATTTTGG

[0115] AGAAAGTAAAGAACA CCAAGAATCGATGGACATCAACAACCCTC GGGACTTTATTGATTGCTTCCTGATCAAATGGAGAAGGTAAATGT T

[0116] AACAAAAGCTTAGTTATGTGACTGCTTGC GTATTGTGATTCATTGACTAGTTTTGT GTTTACTACGGATGTTTAACAGGTCAAGGAGTAATGCTTGAGAAG (SEQ ID NO: 1);

[0117] CYP2C19*2 mutant sequence:

[0118] GATTATCATCTTTGATTCTCTTGTCAGAATTTCCTTTCTCAAATCTTGTA T AATCAGAGAATTACTACACATGTACAATAAAAATTTCCCCATCAAGATAT

[0119] ACAAATATATTTATTATATTATTTAGTTTAAATTACAACCAGAGCTTGGCAT AT TGTA TCTATACCTTTATTAAATGCTTTTAATT T AAT A AAT TATTGT TTTCT

[0120] Cttagatatgcaataattttcccactatcattgattatttcccaggaacccataacaaattacttaaaaaccttgcttttatggaaagtgatattttgg

[0121] Agaaagtaaaagaacaccaagaatcgatggacatcaacaaccctcgggactttattgattgcttcctgatcaaaatggagaaggtaaaatgtt

[0122] Aacaaaagcttagttatgtgactgcttgcgtatttgtgattcattgactagttttgtgtttactacggatgtttaacaggtcaaggagtaatgcttgagaag (SEQ ID NO: 2);

[0123] CYP2C19*3 wild type sequence:

[0124] Acttaaaatttctaaactattattatctgttaacaaatatgaagtgttttatatctaatgtttactcatattttaaaattgtttccaatcatttagcttcaccc

[0125] Tgtgatcccactttcatcctgggctgtgctccctgcaatgtgatctgctccattattttccagaaacgtttcgattataaagatcagcaatttcttaa

[0126] Cttgatggaaaaattgaatgaaaacatcaggattgtaagcaccccctggatccaggtaaggccaagttttttgcttcctgagaaaccacttaca

[0127] Gtctttttttctgggaaatccaaaattctatattgaccaagccctgaagtacatttttgaatactacagtcttgcctagacagccatggggtgaata

[0128] tctggaaaagatggcaaagttctttattttatgcacaggaaatgaatatcccaatatagatcaggcttctaagcccattagctccctgatcagtgttttttccactaa (SEQ ID NO: 3);

[0129] CYP2C19*3 mutant sequence:

[0130] acttaaaatttctaaactattattatctgttaacaaatatgaagtgttttatatctaatgtttactcatattttaaaattgtttccaatcatttagcttcaccc

[0131] tgtgatcccactttcatcctgggctgtgctccctgcaatgtgatctgctccattattttccagaaacgtttcgattataaagatcagcaatttcttaa

[0132] cttgatggaaaaattgaatgaaaacatcaggattgtaagcaccccctgaatccaggtaaggccaagttttttgcttcctgagaaaccacttaca

[0133] gtctttttttctgggaaatccaaaattctatattgaccaagccctgaagtacatttttgaatactacagtcttgcctagacagccatggggtgaata

[0134] tctggaaaagatggcaaagttctttattttatgcacaggaaatgaatatcccaatatagatcaggcttctaagcccattagctccctgatcagtgttttttccactaa (SEQ ID NO: 4);

[0135] CYP2C19*17 wild-type sequence:

[0136] tcagttacactgagcgtttcccctctgcagtgatggagaagggagaactcttattttttctcatgagcatctctggggctgttttccttagataaat

[0137] aagtggttctatttaatgtgaagcctgttttatgaacaggatgaatgtggtatatattcagaataactaatgtttggaagttgttttgttttgctaaaa

[0138] caaagttttagcaaacgattttttttttcaaatttgtgtcttctgttctcaaagcatctctgatgtaagagataatgcgccacgatgggcatcagaag

[0139] acctcagctcaaatcccagttctgccagctatgagctgtgtggcaccaacaggtgtcctgttctcccagggtctcccttttcccatttgaaatata

[0140] aaaaataacaattcctgccttcacgtgtttttttagggggttaaatggtaaaggtgtttatatctgctaaggtaatttacttgatatatgtttggttattgaagatatatg (SEQ ID NO: 5);

[0141] CYP2C19*17 mutant sequence:

[0142] tcagttacactgagcgtttcccctctgcagtgatggagaagggagaactcttattttttctcatgagcatctctggggctgttttccttagataaat

[0143] aagtggttctatttaatgtgaagcctgttttatgaacaggatgaatgtggtatatattcagaataactaatgtttggaagttgttttgttttgctaaaa

[0144] caaagttttagcaaacgattttttttttcaaatttgtgtcttctgttctcaaagtatctctgatgtaagagataatgcgccacgatgggcatcagaag

[0145] acctcagctcaaatcccagttctgccagctatgagctgtgtggcaccaacaggtgtcctgttctcccagggtctcccttttcccatttgaaatata

[0146] aaaaataacaattcctgccttcacgtgtttttttagggggttaaatggtaaaggtgtttatatctgctaaggtaatttacttgatatatgtttggttattgaagatatatg (SEQ ID NO: 6);

[0147] The positive control plasmid is a plasmid containing CYP2C19*2 wild type - blocking sequence - CYP2C19*2 mutant - blocking sequence - CYP2C19*3 wild type - blocking sequence - CYP2C19*3 mutant - blocking sequence - CYP2C19*17 wild type - blocking sequence - CYP2C19*17 mutant sequence;

[0148] Experimental group blocking sequence 1: tttttttttctgatacgaatggcttcaaaattttataaacataccaattcatgaatagtagtaaccg (SEQ ID NO: 7);

[0149] Experimental group blocking sequence 2: cgaatggcttcaaaattttataaacataccaattcatgaatagtagtaaccggggggggggg (SEQ ID NO: 8);

[0150] Experimental group blocking sequence 3: cgaatggcttcaaaattttataaaaaaaaaaaacataccaattcatgaatagtagtaaccg (SEQ ID NO: 9);

[0151] Experimental group blocking sequence 4: tttttctgat (SEQ ID NO: 10);

[0152] Comparative example blocking sequence 1: atgcgactgacta (SEQ ID NO: 11);

[0153] The experimental group plasmid 1 is a plasmid containing CYP2C19*2 wild type-experimental group blocking sequence 1-CYP2C19*2 mutant type-experimental group blocking sequence 1-CYP2C19*3 wild type-experimental group blocking sequence 1-CYP2C19*3 mutant type-experimental group blocking sequence 1-CYP2C19*17 wild type-experimental group blocking sequence 1-CYP2C19*17 mutant type sequence;

[0154] The experimental group plasmid 2 is a plasmid containing CYP2C19*2 wild type-experimental group blocking sequence 2-CYP2C19*2 mutant type-experimental group blocking sequence 2-CYP2C19*3 wild type-experimental group blocking sequence 2-CYP2C19*3 mutant type-experimental group blocking sequence 2-CYP2C19*17 wild type-experimental group blocking sequence 2-CYP2C19*17 mutant type sequence;

[0155] The experimental group plasmid 3 is a plasmid containing CYP2C19*2 wild type-experimental group blocking sequence 3-CYP2C19*2 mutant type-experimental group blocking sequence 3-CYP2C19*3 wild type-experimental group blocking sequence 3-CYP2C19*3 mutant type-experimental group blocking sequence 3-CYP2C19*17 wild type-experimental group blocking sequence 3-CYP2C19*17 mutant type sequence;

[0156] The experimental group plasmid 4 is a plasmid containing CYP2C19*2 wild type-experimental group blocking sequence 4-CYP2C19*2 mutant type-experimental group blocking sequence 4-CYP2C19*3 wild type-experimental group blocking sequence 4-CYP2C19*3 mutant type-experimental group blocking sequence 4-CYP2C19*17 wild type-experimental group blocking sequence 4-CYP2C19*17 mutant type sequence;

[0157] The comparative example plasmid 1 is a plasmid containing CYP2C19*2 wild type-comparative example blocking sequence 1-CYP2C19*2 mutant type-comparative example blocking sequence 1-CYP2C19*3 wild type-comparative example blocking sequence 1-CYP2C19*3 mutant type-comparative example blocking sequence 1-CYP2C19*17 wild type-comparative example blocking sequence 1-CYP2C19*17 mutant type sequence;

[0158] The comparative example plasmid 2 is a plasmid containing CYP2C19*2 wild type-CYP2C19*2 mutant type-CYP2C19*3 wild type-CYP2C19*3 mutant type-CYP2C19*17 wild type-CYP2C19*17 mutant type sequence;

[0159] The primers and probes for detecting CYP2C19*2 (abbreviated as *2), CYP2C19*3 (abbreviated as *3), and CYP2C19*17 (abbreviated as *17) are as follows:

[0160] *2 wild type upstream primer: actatcattgattatttcacg (SEQ ID NO: 12); *2 mutant type upstream primer: ccactatcattgattatttcaca (SEQ ID NO: 13); *2 downstream primer: caataaagtcccgagggtt (SEQ ID NO: 14); *2 probe: FAM-aaccttgcttttatggaaagtgatattttgga-BQ1 (SEQ ID NO: 15);

[0161] *3 wild type upstream primer: catcaggattgtaagcacccccttg (SEQ ID NO: 16); *3 mutant type upstream primer: catcaggattgtaagcaccccctta (SEQ ID NO: 17); *3 downstream primer: gtcaatatagaattttggatttc (SEQ ID NO: 18); *3 probe: HEX-aggtaaggccaagttttttgcttcctgagac-BQ1 (SEQ ID NO: 19);

[0162] *17 wild type upstream primer: atttgtgtcttctgttctcaaatc (SEQ ID NO: 20); *17 mutant type upstream primer: aatttgtgtcttctgttctcaaatt (SEQ ID NO: 21); *17 downstream primer: gaccctggggaacaggac (SEQ ID NO: 22); *17 probe: ROX-acctcagctcaatcccagttctgccagcta-BQ2 (SEQ ID NO: 23);

[0163] The reaction solution formula 1 is shown in Table 1:

[0164] Table 1. Reaction solution formula

[0165] Wild-type reaction system Mutant reaction system Initial concentration Amount μL PCR buffer PCR buffer 10× 8 MgCl2 MgCl2 25 mM 5 dNTPs dNTPs 25 mM 0.8 *2 Wild-type upstream primer *2 Mutant upstream primer 100 μM 0.1 *2 Downstream primer *2 Downstream primer 100 μM 0.1 *2 Probe *2 Probe 100 μM 0.08 *3 Wild-type upstream primer *3 Mutant upstream primer 100 μM 0.1 *3 Downstream primer *3 Downstream primer 100 μM 0.1 *3 Probe *3 Probe 100 μM 0.08 *17 Wild-type upstream primer *17 Mutant upstream primer 100 μM 0.1 *17 Downstream primer *17 Downstream primer 100 μM 0.1 *17 Probe *17 Probe 100 μM 0.08 Taq enzyme Taq enzyme / 1.5 [H2O] H2O / 3.86

[0166] The detection steps are as follows:

[0167] The positive quality control plasmid is diluted using the diluent provided by the present application after synthesis and the copy number thereof is calibrated by digital PCR (the plasmid copy number is calibrated by digital PCR to ensure that different plasmids are diluted to the same concentration, and compared with the nucleic acid sample, so that the comparison of the CT value is more intuitive, and the plasmid detection results can also be compared without comparison with the nucleic acid concentration, and the several plasmids are diluted by the same multiple, and the plasmid detection results are compared), and the CYP2C19*2 heterozygous nucleic acid sample, the CYP2C19*3 heterozygous nucleic acid sample, and the CYP2C19*17 heterozygous nucleic acid sample are prepared, the CYP2C19*2 heterozygous nucleic acid sample with a known concentration is used for digital PCR calibration, the correspondence between the nucleic acid sample copies and the concentration (ng / μL) is obtained, and the three types of nucleic acid samples are diluted to 10 ng / μL, and the positive plasmid is diluted to the copy number corresponding to the CYP2C19*2 heterozygous nucleic acid 10 ng / μL, as a positive quality control.

[0168] The comparative plasmid 2 (comparative quality control 2) is a plasmid containing the wild type and mutant sequence combination of three sites of CYP2C19, and does not contain a blocking sequence; the experimental group plasmid 1 (positive quality control 1) is a plasmid inserted with the experimental group blocking sequence 1; the experimental group plasmid 2 (positive quality control 2) is a plasmid inserted with the experimental group blocking sequence 2; the experimental group plasmid 3 (positive quality control 3) is a plasmid inserted with the experimental group blocking sequence 3; the experimental group plasmid 4 (positive quality control 4) is a plasmid inserted with the experimental group blocking sequence 4; and the comparative plasmid 1 (comparative quality control 1) is a plasmid inserted with the comparative blocking sequence 1. The specific dilution method is the same as above, and the dilution is used as quality control 1-5.

[0169] The amplification reagent is prepared using the above reaction system, and the wild type reaction tube: wild type upstream primer, downstream primer, probe, mutant reaction tube: mutant upstream primer, downstream primer, probe. According to the reagent 20 μL and the nucleic acid sample 10 μL, the PCR reaction tube is added, then the PCR tube cover is carefully covered, and the centrifugation is quickly centrifuged for a few seconds. The PCR reaction tube is placed in a real-time PCR instrument. The real-time PCR reaction is carried out on the G IVD nucleic acid amplification instrument. The PCR reaction is carried out according to the following procedure: the first stage 95℃ 2 minutes, 1 cycle; the second stage 95℃ 10 seconds, 60℃ 35 seconds, 45 cycles. 3 G IVD nucleic acid amplification instrument. The PCR reaction is carried out according to the following procedure: the first stage 95℃ 2 minutes, 1 cycle; the second stage 95℃ 10 seconds, 60℃ 35 seconds, 45 cycles.

[0170] The detection results are shown in Table 2 and Figures 1 to 6, W-M is the value of Ct(W)-Ct(M). The results show that the plasmids without inserted blocking sequence (comparative quality control 2) and the plasmids inserted with the blocking sequence 1 (comparative quality control 1), the wild type and mutant amplification efficiency difference is obvious, the amplification curve appears again in the platform period. The amplification results of the plasmids added with the blocking sequences 1-4 (positive quality controls 1-4) are close to the nucleic acid sample, and the platform amplification curve is normal, which shows that the amplification efficiency of the quality control of the application is good, and the specificity is strong.

[0171] Table 2. Comparison of detection results of nucleic acid samples and different positive quality controls

[0172]

[0173] Example 2 Stability verification of quality control prepared by different diluents

[0174] The stability of six kinds of diluent quality controls was examined, and the specific composition is shown in Table 3. The diluents were prepared according to the diluent formula in Table 3, and were diluted according to the positive plasmid concentration in Example 1 to obtain Comparative Examples 1-6. The only difference between Comparative Examples 1-6 and the quality control of Example 1 is the diluent formula, and the other components and conditions are the same. The above quality controls were placed at 37℃ for 3 days, 7 days and 14 days for accelerated verification, and the Ct values of 0 days were compared (the difference of the Ct values of 0 days is recorded as k) to screen the formula with the smallest Ct value change. The data is shown in Table 4.

[0175] Table 3. Formula of different quality control diluents

[0176]

[0177] Table 4. Quality control prepared by different diluents for 37℃ accelerated verification

[0178]

[0179]

[0180] The results show that the quality control prepared by the diluent configuration provided in Example 1 has a significantly smaller change in the Ct values of the three targets compared with 0 days after 37℃ acceleration for 14 days, which indicates that the quality control prepared by the diluent configuration provided in the application has the highest thermal acceleration stability.

[0181] Example 3 Real-time stability verification of positive quality control

[0182] The prepared CYP2C19 positive quality control of Example 1 is placed in an environment of 2-8℃ for real-time stability test. Starting from day 0, the positive quality control is tested at 0, 2, 4, 6, 9, 12, 14 months, respectively, and 3 positive quality controls are taken at each time point. The results show that the prepared quality control can be stored at 2-8℃ for at least 14 months, which is convenient for storage and avoids the influence of repeated freezing and thawing on the quality control results during use.

[0183] Table 5. Real-time stability of positive quality control

[0184]

[0185]

[0186] Example 4 Positive quality control for CT / NG / UU gene detection reagent

[0187] The positive quality control for the multiplex detection reagent of Chlamydia trachomatis (CT), Neisseria gonorrhoeae (NG) and Ureaplasma urealyticum (UU) is a plasmid containing the CT / NG / UU conserved region sequence and the blocking sequence, and the plasmid vector uses the standard vector pUC57, and the target sequence is as follows:

[0188] CT target sequence:

[0189] attagtatttgccgctttgagttctgcttcctccttgcaagctctgcctgtggggaatcctgctgaaccaagccttatgatcgacggaattctgtg

[0190] ggaaggtttcggcggagatccttgcgatccttgcgccacttggtgtgacgctatcagcatgcgtgttggttactacggagactttgttttcgac cg(SEQ ID NO:24);

[0191] NG target sequence:

[0192] gcctatgcctgcttgggcggcaatcaacagggaaaacggcggcgcacaccttgcctatgcgctttccgcgcctgtgctgacggcggaata

[0193] cggtgggagacaaaaagccctgcgctatcttgctgcacttgaagcagcatataaggcgaaattgcgcggtgatgtgggctttgtatcgctga (SEQ ID NO: 25);

[0194] UU target sequence:

[0195] tgtggtcttaagattcacgaagactgaggggcaacaggaaacgctattgacttagcattaacagttgctgaaaaaactgatgtagctgttgcta

[0196] tccatacagatacattaaacgaagcaggatttgttgaacatacaattgctgcaatgaaaggacgtacaatccacgcttaccatacagaaggt (SEQ ID NO: 26);

[0197] Block sequence: atgcctagactgatcttgcccttattaacacattcctaaagctttagtagactggggggggg (SEQ ID NO: 27);

[0198] The positive plasmid is a plasmid containing the CT target sequence - the block sequence - the NG target sequence - the block sequence - the UU target sequence;

[0199] The primers and probes for detecting Chlamydia trachomatis, Neisseria gonorrhoeae and Ureaplasma urealyticum (CT / NG / UU) are as follows:

[0200] CT upstream primer: ggaatcctgctgaacca (SEQ ID NO: 28); CT downstream primer: gtaaccaacacgcatgct (SEQ ID NO: 29); CT probe: FAM-gatcgacggaattctgtgggaaggtttcggc-BQ1 (SEQ ID NO: 30);

[0201] NG upstream primer: gcgctttccgcgcctgtgc (SEQ ID NO: 31); NG downstream primer: cgcaatttcgccttatatgct (SEQ ID NO: 32); NG probe: HEX-gcggaatacggtgggagacaaaaagccct-BQ1 (SEQ ID NO: 33);

[0202] UU upstream primer: cttagcattaacagttgctga (SEQ ID NO: 34); UU downstream primer: gtggattgtacgtcctttcat (SEQ ID NO: 35); UU probe: ROX-gatgtagctgttgctatccatacagataca-BQ2 (SEQ ID NO: 36);

[0203] 1. CT, NG, UU gene detection reagent quality control product verification: the positive quality is diluted using the diluent provided by the application and calibrated by digital PCR to determine the copy number, and diluted to 10 7 copies / ml as a weak positive quality control. The amplification reagent is prepared using the reaction system (reaction solution formula 2) in Table 6. The reagent 20 μL and the nucleic acid sample 10 μL are added to the PCR reaction tube, and the real-time PCR reaction is performed on the Ye na qTOWER 3 G IVD nucleic acid amplification instrument, and the PCR reaction program is as follows: first stage, 95℃ for 2 minutes, 1 cycle; second stage, 95℃ for 10 seconds, 60℃ for 35 seconds, 45 cycles. The detection results are shown in Table 7, and the weak positive quality control can be accurately detected.

[0204] Table 6. Reaction solution formula 2

[0205] Reaction system Concentration Amount μL PCR buffer 10× 8 MgCl2 25 mM 5 dNTPs 25 mM 0.8 CT upstream primer 100 μM 0.1 CT downstream primer 100 μM 0.1 CT probe 100 μM 0.08 NG upstream primer 100 μM 0.1 NG downstream primer 100 μM 0.1 NG probe 100 μM 0.08 UU upstream primer 100 μM 0.1 UU downstream primer 100 μM 0.1 UU probe 100 μM 0.08 Taq enzyme Taq enzyme / 1.5 H2O / 3.86

[0206] Table 7. CT, NG, UU gene detection reagent quality control product verification

[0207]

[0208] 2. Real-time stability verification of CT / NG / UU quality control products

[0209] Table 8. Stability verification of CT / NG / UU gene detection reagent quality control products

[0210]

[0211]

[0212] The prepared CT, NG, and UU positive quality control products of Example 4 are placed in a 2-8℃ environment for real-time stability evaluation. Starting from the 0th day, 0, 2, 4, 6, 9, 12, and 14 months are evaluated respectively, and 3 positive quality control products are taken at each time point. The results show that the quality control products prepared by the application can be stored stably at least for 14 months under the condition of 2-8℃ environment, which is convenient to store and avoids the influence of repeated freezing and thawing on the quality control results during use.

[0213] The quality control product design method and the diluent prepared quality control product provided by the application have simple storage conditions, strong applicability, and can be applied to quality control of different sample gene detection reagents according to different sequence design plasmids. The product designed by the method has low cost, good stability, is convenient to store and transport, has simple production conditions, can be applied to large-scale industrial production, and is convenient to popularize.

[0214] The above is only the preferred embodiment of the application, and it should be pointed out that, for ordinary skilled persons in the art, some improvements and refinements can be made without departing from the principles of the application, and these improvements and refinements should also be considered as the protection scope of the application.

Claims

1. A nucleic acid fragment, characterized in that, The target sequence represented by the nucleotide sequence of SEQ ID NO: 1 ~ SEQ ID NO: 6 is sequentially composed of the blocking sequence represented by the nucleotide sequence of SEQ ID NO:

7.

2. A recombinant vector, characterized in that, The nucleic acid fragment of claim 1.

3. A host cell characterized in that, Transfecting and / or transforming the recombinant vector of claim 2.

4. A test composition characterized in that, The reagent combination of any one of claims 5 ~ 7 and the primer and the probe for amplifying the target sequence: i) the nucleic acid fragment of claim 1; ii) the recombinant vector of claim 2; iii) the host cell of claim 3; The primer and the probe are: an upstream primer 1, an upstream primer 2, a downstream primer and a probe; The upstream primer 1 is: a primer represented by the nucleotide sequence of SEQ ID NO: 12, SEQ ID NO: 16 and / or SEQ ID NO: 20; The upstream primer 2 is: a primer represented by the nucleotide sequence of SEQ ID NO: 13, SEQ ID NO: 17 and / or SEQ ID NO: 21; The downstream primer is: a primer represented by the nucleotide sequence of SEQ ID NO: 14, SEQ ID NO: 18 and / or SEQ ID NO: 22; The probe is: a probe represented by the nucleotide sequence of SEQ ID NO: 15, SEQ ID NO: 19 and / or SEQ ID NO:

23.

5. A reagent combination, characterized by The reagent combination of any one of claims 5 ~ 7 and the primer and the probe for amplifying the target sequence:

6. The combination of agents according to claim 5, characterized in that, The diluent includes: 0.8 ~ 1.2M of Taps, 1.0 ~ 3.0g / L of a preservative, 0.35 ~ 0.4g / L of EDTA·2Na and / or 1.5 ~ 2.5g / L of trehalose.

7. The combination of agents according to claim 6, characterized in that, The preservative includes at least one of P300, P950 and / or NaN3.

8. A method for detecting multiple genes, characterized in that, The method for detecting multiple genes is a method for non-disease treatment and diagnosis purposes; The method is a method for detecting a target sequence related to a CYP2C19 gene in a sample using at least one of the following I) ~ V): I) the nucleic acid fragment of claim 1; II) the recombinant vector of claim 2; III) the host cell of claim 3; IV) the detection composition of claim 4; V) the reagent combination of any one of claims 5 ~ 7; The nucleotide sequence of the target sequence is represented by SEQ ID NO: 1 ~ SEQ ID NO: 6.

Images