Method for evaluating IL-1beta generation capability of stomach tissue

Abstract

The invention relates to the technical field of medical biology, in particular to a method for evaluating the IL-1beta generation capacity of stomach tissue. According to the evaluation method, the capability of generating IL-1beta in a gastric tissue microenvironment is evaluated by using the transcriptional level of Aquaporin (AQP9). According to experimental results, the level of the IL-1beta potential generated in the stomach tissue can be accurately evaluated, the evaluation method shortens the detection time, and the evaluation method is of great significance to early evaluation of the inflammation degree under pathological and physiological conditions.

Description

Technical Field

[0001] The present invention relates to the field of pharmaceutical biotechnology, and in particular to a method for evaluating the ability of gastric tissue to produce IL-1β. Background Art

[0002] As an important component of nonspecific and specific immunity in the body, macrophages participate in many physiological and pathological processes in the human body. Their functions include phagocytosis, antigen presentation and immune regulation. In an infected or inflammatory environment, macrophages can secrete a large number of inflammatory cytokines and participate in the regulation of the immune response signal network. There are a certain number of macrophages in the lamina propria and submucosal layer of the gastric tissue. Single-cell sequencing technology shows that macrophages in gastric tissue are rich in IL-1β signals and are the main producers. Gastric macrophages and the IL-1β they produce play an important role in the occurrence and development of gastritis and gastric cancer. Due to individual differences and differences in the gastric microenvironment, there is heterogeneity in macrophages in gastric tissues of different individuals; there is no simple and quick method to predict the differences in the ability of gastric tissue to produce IL-1β.

[0003] There are a variety of immunosuppressive cell populations in the tumor microenvironment, such as tumor-infiltrating macrophages (TAMs) and tumor-associated neutrophils (TANs). These suppressive cells promote tumor escape by preventing cytotoxic T cells from attacking tumors. The development of single-cell sequencing technology has greatly promoted the division of cell subpopulations in the tumor microenvironment. For example, Xue R et al. analyzed TANs in liver cancer and found that CCL4+ TANs can recruit macrophages and PD-L1+ TANs can inhibit T cells, confirming the tumor-promoting effects of TANs and TAMs. Melissa SF et al. deeply analyzed the composition of TANs in pancreatic tumors and proposed for the first time that immature and mature neutrophils in peripheral blood can undergo irreversible epigenetic, transcriptional and amino acid residue modifications after being recruited into the tumor microenvironment, thereby forming a unique group of dcTRAIL-R1+ neutrophils, which can promote angiogenesis and tumor growth in tumors. Nicoletta C et al. discovered IL-1β+TAM subpopulation cells in pancreatic cancer, whose formation is regulated by the synergistic effects of prostaglandin E2 (PGE2) and tumor necrosis factor (TNF), and is closely related to disease progression and poor patient prognosis. Blocking PGE2 or IL-1β activity can antagonize local inflammation inside and outside tumor tissues and improve treatment. These reports show that macrophages and IL-1β signals in the tumor microenvironment are important culprits of immunosuppression.

[0004] According to literature reports and previous experimental results, macrophages in gastric tissue dominate the production of IL-1β in the gastric tumor microenvironment. Single-cell sequencing technology has shown that there are multiple subpopulations of macrophages in gastric tissue. Our analysis results show that gastric tissue macrophages with high expression of the water channel protein AQP9 are rich in NLRP3-IL1B signals; this suggests that the content of AQP9-positive macrophages may represent the ability of gastric tissue to produce IL-1β; related research has not yet been reported.

[0005] AQP molecules are a type of cell membrane protein that mediates the rapid transmembrane transport of water molecules. They can be expressed in a variety of organisms such as animals and plants, and play an important role in maintaining the balance of water inside and outside cells. In mammals, a total of 13 AQP protein molecules have been found, which are mainly distributed in epithelial cells and endothelial cells that are closely related to the absorption and secretion of body fluids. Among them, AQP4 is the most abundant and widely distributed in brain tissue. It is highly expressed mainly in astrocytes and participates in the occurrence and development of cerebral edema. AQP3 and AQP8 proteins are highly expressed in the absorptive epithelial cells of the gastrointestinal tract and play a regulatory role in water absorption. AQP9 is abundant in brain tissue and is mainly distributed on the neuronal cell membrane. In addition to being able to transport water molecules, it also plays an important role in transporting small molecules such as glycerol, lactic acid, and ketone bodies. AQP9 is mainly expressed on macrophages in gastric tissue and is almost not expressed in other types of cells. Relevant data show that clinical detection of IL-1β content in gastric tissue mainly includes immunohistochemistry and fluorescent probes, which are cumbersome to operate, have low timeliness, and lack predictive function. Developing a method that can predict and evaluate the ability of gastric tissue to produce IL-1β will be of great significance for clinical testing, diagnosis and treatment of the degree of gastric tissue inflammation and infection and tumor microenvironment evaluation. Summary of the invention

[0006] The present invention provides a method for evaluating the ability of gastric tissue to produce IL-1β. The method predicts the ability of gastric tissue to secrete IL-1β after being stimulated by signals such as infection based on the difference in the transcription content of AQP9. According to the experimental results, the potential of IL-1β produced in gastric tissue is accurately evaluated. The method shortens the detection time, is of great significance for the early evaluation of the degree of inflammation under pathological and physiological conditions, and solves the problems existing in the prior art.

[0007] The present invention provides the following technical solutions:

[0008] This evaluation method evaluates the ability to produce IL-1β in the gastric tissue microenvironment based on the transcription level of AQP9.

[0009] Furthermore, the evaluation method stimulates gastric tissue specimens with lipopolysaccharide, detects the transcription level of AQP9 at the mRNA level and detects the IL-1β content produced by gastric tissue, thereby obtaining the correlation between the AQP9 transcription level in infected gastric tissue and the IL-1β function of gastric tissue.

[0010] Furthermore, according to the above evaluation method, a high AQP9 transcription level in gastric tissue indicates a strong ability to produce IL-1β in response to infection or lipopolysaccharide (LPS) stimulation; a low AQP9 transcription level in gastric tissue indicates a weak ability to produce IL-1β in response to infection or LPS stimulation.

[0011] Furthermore, the above evaluation method detects the expression of AQP9 and IL-1β by qRT-PCR in gastric tissue specimens.

[0012] Furthermore, the above evaluation method is confirmed by detecting IL-1β produced by gastric tissue using ELISA method.

[0013] Furthermore, the above evaluation method evaluates the production of inflammatory signal molecule IL-1β in gastric tissue by changes in AQP9 transcription levels, and is expected to assist in the treatment of inflammatory diseases in gastric tissue, including chronic inflammation, atrophic gastritis, gastric cancer, etc.

[0014] Furthermore, the method for evaluating the ability of gastric tissue to produce IL-1β is characterized by comprising the following steps:

[0015] (1) Mononuclear cells and gastric tissue samples isolated from human peripheral blood were selected as research objects. The mononuclear cells and gastric tissue samples were divided into two groups. One group was used to detect the transcription level of AQP9 and IL-1β, and the other group was used to detect the content level of AQP9 and IL-1β after LPS stimulation and establishment of the stimulation system.

[0016] (2) By comparing the obtained AQP9 transcription level data with the IL-1β content, the results of evaluating the ability of AQP9 transcription content to predict the production of IL-1β in gastric tissue stimulated by LPS were obtained; high AQP9 transcription levels in gastric tissue indicate a strong ability to produce IL-1β in response to infection or lipopolysaccharide (LPS) stimulation; low AQP9 transcription levels in gastric tissue indicate a weak ability to produce IL-1β in response to infection or LPS stimulation.

[0017] Furthermore, the above step (2) calculates the relative transcription levels of AQP9 and IL-1β -△Ct , and compared and analyzed the AQP9 transcription level data and the changes in IL-1β content.

[0018] Furthermore, the final concentration of LPS used for stimulation in step (1) was 1.5 pg / mL; the mononuclear cells were macrophages, and the cell concentration was 1.0×10 6 Pieces / mL.

[0019] Furthermore, the stimulation time in step (1) is 24 hours.

[0020] Furthermore, the specific operation of step (1) is as follows:

[0021] The obtained ex vivo gastric tissue samples were divided into two parts, one part was immediately ground, RNA was extracted, reverse transcribed and qRT-PCR experiments were performed to calculate the relative transcription levels of AQP9 and IL-1β (β-actin was used as an internal reference);

[0022] Another part of the ex vivo gastric tissue samples was stimulated with LPS at the same time to establish a stimulation system: 0.5 ml of regular 1640 culture medium was added to a 24-well plate, the tissue was placed therein, and LPS was added; the culture was continued at 37°C and 5% CO2 for 24 hours;

[0023] Isolated peripheral blood mononuclear cells were used as a control to observe whether there was gastric tissue specificity.

[0024] Furthermore, after RNA extraction from in vitro gastric tissue samples, reverse transcription was performed to synthesize cDNA using the extracted RNA as a template according to the measured RNA concentration, and primers for AQP9 and IL-1β molecules were designed to perform real-time fluorescence quantitative PCR reactions. Based on the obtained Ct values, 2 -△Ct , and obtain the relative transcription amount of the target gene; obtain the expression levels of AQP9 and IL-1β.

[0025] Furthermore, the molecular primer sequences of AQP9, IL-1β and internal reference β-actin are as follows:

[0026] AQP9-F:AACAACTTCTGGTGGATT(SEQ NO1)

[0027] AQP9-R:AATGACAAGAACATAGATGAG(SEQ NO2)

[0028] IL1B-F:ATGATGGCTTATTACAGTGGCAA(SEQ NO3)

[0029] IL1B-R:GTCGGAGATTCGTAGCTGGA(SEQ NO4)

[0030] β-actin-F: CTGGAACGGTGAAGGTGACA (SEQ NO5)

[0031] β-actin-R: AAGGGACTTCCTGTAACAATGCA (SEQ NO6).

[0032] Furthermore, the peripheral blood mononuclear cell stimulation treatment operation is as follows: the mononuclear cell concentration in the culture well is 1.0×10 6 / mL, add LPS and continue to culture at 37℃, 5% CO2 for 24 hours.

[0033] Furthermore, the relative transcription levels of AQP9 and IL-1β were calculated. -△Ct Then, GraphPad Prism 10.0 software was used for statistical analysis.

[0034] Furthermore, after the aforementioned stimulation system was established, the cell suspension was collected 24 hours after the stimulation, the supernatant was obtained by centrifugation, and the IL-1β content in the culture supernatant was detected by ELISA.

[0035] Furthermore, the specific operation of ELISA method for detecting the IL-1β content in the culture supernatant was performed according to the instructions of the ELISA kit of Thermo Fisher Scientific Inc.

[0036] Beneficial effects of the present invention:

[0037] 1. The evaluation method of the present invention uses the changes in the transcription level of AQP9 in gastric tissue to evaluate the potential of gastric tissue to produce the inflammatory cytokine IL-1β (Interleukin) based on its level, and can further predict the level of inflammation in gastric tissue after being stimulated by LPS and the like at an early stage, which is of great significance for evaluating the inflammatory environment and degree of damage of gastric tissue.

[0038] 2. The evaluation method of the present invention is easy to operate, reliable and forward-looking. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 The qRT-PCR method of the present invention is used to detect the transcription level of AQP9 gene in isolated gastric tissue;

[0040] Figure 2 The qRT-PCR method of the present invention is used to detect the transcription level of IL1B gene in isolated gastric tissue;

[0041] Figure 3 The ELISA method of the present invention is used to detect the IL-1β content produced in gastric tissue after LPS stimulation for 24 hours;

[0042] Figure 4 The correlation between the transcription level of AQP9 in the isolated gastric tissue of the present invention and the content of IL-1β produced by the gastric tissue after 24 hours of LPS stimulation;

[0043] Figure 5 The qRT-PCR method of the present invention is used to detect the transcription level of AQP9 gene in peripheral mononuclear cells;

[0044] Figure 6 The qRT-PCR method of the present invention is used to detect the transcription level of the IL1B gene in peripheral mononuclear cells;

[0045] Figure 7 The ELISA method of the present invention is used to detect the IL-1β content produced by peripheral blood mononuclear cells after LPS stimulation for 24 hours;

[0046] Figure 8 The present invention is the correlation between the transcription level of AQP9 in peripheral blood mononuclear cells and the content of IL-1β produced after LPS stimulation for 24 hours. DETAILED DESCRIPTION

[0047] In order to clearly illustrate the technical features of the present invention, the present invention is described in detail below through specific implementation methods in conjunction with the accompanying drawings.

[0048] In the following examples, if no specific conditions are specified, all the methods used in the present invention are conventional methods unless otherwise specified; the raw materials and devices used are conventional commercial products unless otherwise specified.

[0049] 1. Materials and Methods

[0050] 1.1 Main reagents and manufacturers

[0051]

[0052] 1.2 Human peripheral blood mononuclear cells were collected from healthy volunteers, and gastric tissues were collected from clinical ex vivo samples (approved by the ethics committee of this unit). RPMI 1640 medium was used for cell and tissue culture in a 37°C incubator; cells with good growth and cell survival rate >95% were used for experiments.

[0053] 1.3 Methods

[0054] 1.3.1 RNA extraction and concentration determination

[0055] ① Peripheral blood mononuclear cell samples: collect the peripheral blood mononuclear cell suspension in an EP tube, centrifuge at 1000g for 5 minutes, discard the supernatant and collect the cells; add 1mL Trizol and mix well. Ex vivo gastric tissue samples: add magnetic beads, gastric tissue and 500μL Trizol to the EP tube and grind at -20℃ for 2 minutes, collect the tissue suspension in a 1.5ml EP tube, and add 500μL Trizol and mix well.

[0056] ② Add chloroform at a volume of 200ul chloroform / ml Trizol, shake vigorously for 15s, leave at room temperature for 10-15min, and centrifuge at 12000g, 4℃ for 15min.

[0057] ③ Centrifuge at 12000rpm, 4℃ for 15min. The sample will be divided into three layers after centrifugation. Transfer the top layer to a new Eppendorf tube.

[0058] ④ Add an equal volume of isopropanol, mix thoroughly, and centrifuge at 12000g, 4℃ for 10min.

[0059] ⑤Discard the supernatant, wash the precipitate once with 75% ethanol solution, and centrifuge at 12000g, 4℃ for 5min.

[0060] ⑥Discard the supernatant and let it stand for about 10 minutes to allow the residual ethanol to fully evaporate. Dissolve the precipitate with an appropriate amount of DEPC water, then use an ultra-micro spectrophotometer to analyze the purity and concentration of the obtained RNA, and store it at -80℃ for subsequent experiments.

[0061] ⑦ According to the measured RNA concentration, reverse transcription is performed using the extracted RNA as a template.

[0062] 1.3.2 Reverse transcription

[0063] (1) According to the following system, calculate the required volume of sample and RNAse-Free Water based on the loading amount of 1.5 μg RNA per sample, so that the total system is 20 μL.

[0064] Reverse transcription reaction system

[0065]

[0066] (2) After the sample is added, centrifuge it instantly and place it in a PCR instrument. Perform the reaction according to the program of 25℃30min, 42℃30min, and 85℃5min. After the reaction, the cDNA sample is obtained and directly used for real-time fluorescence quantitative PCR. If it is not used for the experiment temporarily, it can be stored in a -20℃ refrigerator.

[0067] 1.3.3 Real-time fluorescence quantitative PCR

[0068] (1) Primers:

[0069]

[0070] (2) According to the following reaction system, add the following components into eight tubes, with a total system of 20 μL; after adding the samples, centrifuge them instantly and place them in a fluorescent quantitative PCR instrument for reaction.

[0071] qRT-PCR reaction system

[0072]

[0073] 1.3.4 Calculate △Ct target gene = Ct (target gene) - Ct (target gene of the same sample); 2 -△Ct = relative expression level. GraphPad Prism 10.0 software was used for statistical analysis.

[0074] 1.3.5 Stimulation system

[0075] S1, take 1.0×10 6 Peripheral mononuclear cells were plated in culture wells, and after the cells were stabilized for 2-4 hours, LPS stimulation was given and culture was continued for 24 hours. Gastric tissue was placed in the culture wells and LPS stimulation was given for 24 hours.

[0076] S2. After 24 hours, collect the mononuclear cell culture medium and gastric tissue culture medium into Eppendorf tubes, centrifuge at 1000 g for 5 minutes in a low-temperature centrifuge, and transfer the supernatant into new Eppendorf tubes.

[0077] S3, using ELISA cell detection factors, according to the instructions in the ELISA kit of Thermo Fisher Scientific, the specific steps are as follows:

[0078] (1) Prepare coating solution by diluting the capture antibody in coating buffer and coat the plate with 100 μL of coating solution per well. Cover the plate and incubate overnight (12–18 hours) at 2–8°C.

[0079] (2) Aspirate the liquid from each well and add 200 μL of washing buffer to each well for washing once. After washing, invert the plate and tap gently on absorbent paper to remove any residual liquid.

[0080] (3) Add 200 μL of blocking buffer to each well and block for 1 h at room temperature.

[0081] (4) Aspirate, invert the plate, and tap gently on absorbent paper to remove any residual liquid.

[0082] (5) Prepare standard and sample dilutions in blocking buffer.

[0083] (6) Add 100 μL of standards and samples to the designated wells and shake gently (~500 rpm) for 1 hour at room temperature.

[0084] (7) Aspirate the liquid from each well and add 200 μL of washing buffer to each well and wash 5 times. After washing, invert the plate and tap gently on absorbent paper to remove residual liquid.

[0085] (8) Prepare detection antibody solution by diluting detection antibody in blocking buffer.

[0086] (9) Add 100 μL of detection antibody solution to each well and shake gently (~500 rpm) at room temperature for 2 hours.

[0087] (10) Aspirate the liquid from each well and add 200 μL of washing buffer to each well and wash five times. After washing, invert the plate and tap gently on absorbent paper to remove any residual liquid.

[0088] (11) Dilute the blocking buffer at a ratio of 1:5000 to prepare the streptavidin-horseradish peroxidase working solution.

[0089] (12) Add 100 μL of streptavidin-horseradish peroxidase working solution to each well and shake gently (~500 rpm) at room temperature for 30 minutes.

[0090] (13) Aspirate the liquid in each well and add >200 μL of washing buffer to each well and wash five times. After washing, invert the plate and tap gently on absorbent paper to remove any residual liquid.

[0091] (14) Add 100 μL of TMB substrate solution to each well and incubate the plate at room temperature for 30 minutes.

[0092] (15) Add 100 μL of stop solution to each well and measure the absorbance at 450 nm within 30 min.

[0093] (16) Results were calculated using log-log or 4-parameter curve fitting.

[0094] 2. Results

[0095] 2.1 The obtained gastric tissue was ground and RNA was extracted, and reverse transcribed to generate cDNA. The transcription levels of AQP9 and IL-1β in gastric tissue were detected by qRT-PCR, and the relative expression levels were calculated. Figure 1 , Figure 2 As shown, the results showed that compared with the internal reference β-act in gene, the transcription levels of AQP9 and IL1B were lower, while the transcription content of AQP9 was higher than that of IL-1β, indicating that the sensitivity requirement for detecting AQP9 transcription content is lower than that of IL1B transcription detection.

[0096] 2.2 After LPS stimulation of gastric tissue for 24 h, the supernatant was collected and then the expression level of IL-1β was detected by ELISA. Figure 3 The results showed that gastric tissue samples from different sources could produce different amounts of IL-1β after being stimulated by LPS. The levels of IL-1β were not correlated with the transcription level of IL1B, but were positively correlated with the transcription level of AQP9. Figure 4 shown.

[0097] 2.3 For peripheral blood mononuclear cells, RNA was extracted and reverse transcribed to generate cDNA. The transcription levels of AQP9 and IL-1β in peripheral blood mononuclear cells were detected by qRT-PCR, and the relative expression levels were calculated, such as Figure 5 , Figure 6 Compared with the internal reference β-actin gene, the transcription levels of AQP9 and IL1B were both low in peripheral blood, and the transcription level of AQP9 was lower than that of IL-1β, which was opposite to the results of gastric tissue, suggesting that the increase of AQP9 transcription level in gastric tissue may be due to the influence of gastric tissue microenvironment. ELISA detected the expression level of IL-1β, as shown in Figure 7 As shown in Figure 2, peripheral blood mononuclear cells from different sources can produce approximately the same amount of IL-1β after being stimulated by LPS, and there is no obvious difference between different individuals. At the same time, its content is not related to the transcription level of IL1B or the transcription level of AQP9, as shown in Figure 2. Figure 8 shown.

[0098] Discussion

[0099] IL-1β, as an important inflammatory factor and immunomodulator, acts as an amplifier of immune response and is mainly derived from innate immune cells, such as monocytes, macrophages and dendritic cells. Since the synthesis and secretion of IL-1β is a multi-cascade process, continuous IL-1β secretion leads to autoimmunity and induces the occurrence of autoinflammatory diseases. Therefore, effectively antagonizing the production of IL-1β in the stomach can reduce the aggravation of inflammation and tissue damage.

[0100] As an indispensable part of the innate immune system, macrophages have a long survival time and are the main participants in chronic inflammatory reactions. When macrophages infiltrating gastric tissue are stimulated by external factors, such as bacterial infection, they act on the pathogen recognition receptor (TLR) of macrophages, initiate the transcription and translation of the IL-1β gene and form a precursor protein (pro-IL-1β), activate the NLRP3 inflammasome in macrophages, and the activated NLRP3 inflammasome cleaves the Caspase-1 precursor to form activated Caspase-1, which in turn cleaves pre-IL-1β to form mature IL-1β molecules. As an effective pro-inflammatory cytokine, IL-1β can induce the release of inflammatory factors such as IL-6 and stimulate T cell activation, and can also promote the release of inflammatory mediators such as nitric oxide (NO) and prostaglandins (PG), leading to endothelial cell reactions, causing strong inflammatory reactions and tissue damage.

[0101] The evaluation method of the present invention is for clinically obtained ex vivo gastric tissue, and the transcription level of AQP9 is detected by qRT-PCR technology, which can predict the ability of gastric tissue to produce IL-1β after being stimulated by signals such as LPS, that is, gastric tissue with high transcription level of AQP9 has strong ability to produce IL-1β. A stimulation system is established with peripheral blood mononuclear cells and gastric tissue using LPS as a signal, and the production of IL-1β is detected by ELISA after 24 hours, and its level is positively correlated with the transcription level of AQP9 detected 24 hours ago. In short, a high transcription level of AQP9 in gastric tissue may mean that there are more AQP9-positive macrophages, and the ability to produce IL-1β is strong in response to infection or LPS stimulation; a low transcription level of AQP9 in gastric tissue may mean that there are fewer AQP9-positive macrophages, and the ability to produce IL-1β is weak in response to infection or LPS stimulation.

[0102] The above specific implementation manner cannot be used as a limitation on the protection scope of the present invention. For those skilled in the art, any substitution, improvement or change made to the implementation manner of the present invention falls within the protection scope of the present invention.

[0103] The matters not described in detail in the present invention are all known technologies to those skilled in the art.

Claims

1. A method for evaluating the ability of gastric tissue to produce IL-1β, characterized in that: This evaluation method evaluates the ability to produce IL-1β in the gastric tissue microenvironment based on the transcription level of AQP9.

2. The method for evaluating the ability of gastric tissue to produce IL-1β according to claim 1, characterized in that: The evaluation method stimulates gastric tissue specimens with lipopolysaccharide, detects the transcription level of AQP9 at the mRNA level and detects the IL-1β content produced by gastric tissue, thereby obtaining the correlation between the AQP9 transcription level in infected gastric tissue and the IL-1β function of gastric tissue.

3. The method for evaluating the ability of gastric tissue to produce IL-1β according to claim 1, characterized in that: The steps are as follows: (1) Mononuclear cells and gastric tissue samples isolated from human peripheral blood were selected as research objects. The mononuclear cells and gastric tissue samples were divided into two groups. One group was used to detect the transcription level of AQP9 and IL-1β, and the other group was used to detect the content level of AQP9 and IL-1β after LPS stimulation and establishment of the stimulation system. (2) By comparing the obtained AQP9 transcription level data with the IL-1β content, the results of evaluating the ability of AQP9 transcription content to predict the production of IL-1β in gastric tissue stimulated by LPS were obtained; high AQP9 transcription levels in gastric tissue indicate a strong ability to produce IL-1β in response to infection or lipopolysaccharide (LPS) stimulation; low AQP9 transcription levels in gastric tissue indicate a weak ability to produce IL-1β in response to infection or LPS stimulation.

4. The method for evaluating the ability of gastric tissue to produce IL-1β according to claim 3, characterized in that: Step (1) The final concentration of LPS used for stimulation was 1.5 pg / mL; the mononuclear cells were macrophages, and the cell concentration was 1.0×10 6 Pieces / mL.

5. The method for evaluating the ability of gastric tissue to produce IL-1β according to claim 3, characterized in that: The stimulation time in step (1) is 24 hours.

6. The method for evaluating the ability of gastric tissue to produce IL-1β according to claim 3, characterized in that: The specific operation of step (1) is as follows: The obtained ex vivo gastric tissue samples were divided into two parts, one part was immediately ground, RNA was extracted, reverse transcribed and qRT-PCR experiments were performed to calculate the relative transcription levels of AQP9 and IL-1β (β-actin was used as an internal reference); Another part of the ex vivo gastric tissue samples were stimulated with LPS at the same time to establish a stimulation system: conventional 1640 culture medium was added to a 24-well plate, the ex vivo gastric tissue was placed therein, and LPS was added; the culture was continued at 37°C and 5% CO2 for 24 hours; Isolated peripheral blood mononuclear cells were used as a control to observe whether there was gastric tissue specificity.

7. The method for evaluating the ability of gastric tissue to produce IL-1β according to claim 6, characterized in that: The stimulation treatment of peripheral blood mononuclear cells was as follows: the concentration of mononuclear cells in the culture well was 1.0×10 6 / mL, add LPS and continue to culture at 37℃, 5% CO2 for 24 hours.

8. The method for evaluating the ability of gastric tissue to produce IL-1β according to claim 3 or 6, characterized in that: Calculation of relative transcription levels of AQP9 and IL-1β -△Ct Then, GraphPad Prism 10.0 software was used for statistical analysis.

Images