A method for evaluating the ability of gastric tissue to produce IL-1β
By detecting the transcription level of AQP9 in gastric tissue and predicting its ability to secrete IL-1β after infection or LPS stimulation, the problem of lack of simple and fast methods in the prior art to predict IL-1β is solved, and an accurate evaluation of the degree of inflammation of gastric tissue and the tumor microenvironment is achieved.
Patent Information
- Application Number
- CN202411609310.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-12
- Publication Date
- 2025-06-13
- Estimated Expiration
- 2044-11-12
AI Technical Summary
The prior art lacks simple and fast methods to predict the differences in the ability of gastric tissue to produce IL-1β, which affects the diagnosis and treatment of gastritis and gastric cancer.
By detecting the transcription level of AQP9 in gastric tissue, it predicts its ability to secrete IL-1β after infection or lipopolysaccharide LPS stimulation, and was detected by qRT-PCR and ELISA.
This method can accurately evaluate the IL-1β potential produced in gastric tissue and shorten the detection time. It is of great significance to early evaluation of the degree of inflammation of gastric tissue and the tumor microenvironment.
Smart Images

Figure CN119433005B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of medical biotechnology, and particularly relates to a method for evaluating the ability of gastric tissue to produce IL-1β. Background Art
[0002] Macrophages, as an important part of the non-specific and specific immunity in the body, participate in many physiological and pathological processes in the human body, and their functions include phagocytosis, antigen presentation, and immune regulation. In an infected or inflammatory environment, macrophages can secrete a large amount of inflammatory cytokines and participate in the regulation of the immune response signal network. In the lamina propria and submucosa of the gastric tissue, there are a certain amount of macrophages. Single-cell sequencing technology shows that macrophages in gastric tissue are rich in IL-1β signals and are the main producers. Gastric macrophages and the IL-1β they produce play an important role in the occurrence and development of gastritis and gastric cancer. Due to individual differences and the heterogeneity of the gastric microenvironment, macrophages in the gastric tissue of different individuals are heterogeneous; there is no simple and rapid method available for predicting the differences in the ability of gastric tissue to produce IL-1β.
[0003] There are various immunosuppressive cell populations in the tumor microenvironment, such as tumor-infiltrating macrophages (TAM) and tumor-associated neutrophils (TAN). These inhibitory cells promote tumor escape by preventing cytotoxic T cells from attacking tumors. The development of single-cell sequencing technology has greatly promoted the classification of cell subsets in the tumor microenvironment. For example, Xue R et al. analyzed TAN in liver cancer and found that CCL4+ TANs can recruit macrophages, and PD-L1+ TANs can inhibit T cells, confirming the pro-tumor effects of TANs and TAM. Melissa SF et al. deeply analyzed the composition of TAN in pancreatic tumors and first proposed that immature and mature neutrophils in peripheral blood can undergo irreversible epigenetic, transcriptional, and amino acid residue modifications after being recruited into the tumor microenvironment, thus forming a unique group of dcTRAIL-R1+ neutrophils, which can promote tumor angiogenesis and tumor growth. Nicoletta C et al. found an IL-1β+ TAM subset cell in pancreatic cancer, and its formation is regulated by the synergistic action of prostaglandin E2 (PGE2) and tumor necrosis factor (TNF), which is closely related to disease progression and poor patient prognosis. Blocking the activity of PGE2 or IL-1β can antagonize local inflammation inside and outside the tumor tissue and improve the treatment. These reports show that macrophages and IL-1β signals in the tumor microenvironment are important culprits of immunosuppression.
[0004] According to literature reports and previous experimental results, macrophages in gastric tissue dominate the production of IL-1β in the gastric tumor microenvironment. Through single-cell sequencing technology, multiple subsets of macrophages in gastric tissue have been analyzed. Our analysis results show that macrophages in gastric tissue with high expression of aquaporin AQP9 are rich in NLRP3-IL1B signals; this suggests that the content of AQP9-positive macrophages may represent the ability of gastric tissue to produce IL-1β; there is no relevant research report yet.
[0005] AQP molecules are a class of cell membrane proteins that mediate the rapid transmembrane transport of water molecules. They can be expressed in various organisms such as animals and plants and play an important role in maintaining the water balance inside and outside cells. In mammals, a total of 13 AQP protein molecules have been discovered, mainly distributed in epithelial cells and endothelial cells that are closely related to body fluid absorption and secretion. Among them, AQP4 is the most abundant and widely distributed in the brain tissue, mainly highly expressed in astrocytes and involved in the occurrence and development of brain edema. AQP3 and AQP8 proteins are highly expressed in the absorptive epithelial cells of the gastrointestinal tract and play a regulatory role in water absorption. AQP9 is abundant in the brain tissue and is mainly distributed on the neuron cell membrane. In addition to transporting water molecules, it also plays an important role in transporting small molecule substances such as glycerol, lactic acid, and ketone bodies. AQP9 is mainly expressed on macrophages in gastric tissue and is hardly expressed in other types of cells. Relevant data show that clinically, the detection of the content of IL-1β in gastric tissue mainly uses methods such as immunohistochemistry and fluorescent probes, which are cumbersome to operate, have low timeliness, and do not have a predictive function; developing a method with the ability to predict and evaluate the ability of gastric tissue to produce IL-1β will be of great significance for the clinical test diagnosis and treatment of the degree of gastric tissue inflammation and infection and the evaluation of the tumor microenvironment. Summary of the Invention
[0006] The present invention provides a method for evaluating the ability of gastric tissue to produce IL-1β. This method predicts the ability of gastric tissue to secrete IL-1β after being stimulated by signals such as infection based on the transcriptional content difference of AQP9, and accurately evaluates the potential level of IL-1β produced in gastric tissue according to the experimental results. This method shortens the detection time and is of great significance for early evaluation of the degree of inflammation under pathophysiological conditions, solving the problems existing in the prior art.
[0007] The present invention provides the following technical solutions:
[0008] This evaluation method evaluates the ability to generate IL-1β in the gastric tissue microenvironment based on the transcriptional level of AQP9.
[0009] Furthermore, in the evaluation method, lipopolysaccharide is used to stimulate gastric tissue specimens, and the transcriptional level of AQP9 is detected at the mRNA level, and the content of IL-1β produced by the gastric tissue is detected, so as to obtain the correlation between the transcriptional level of AQP9 and the function of IL-1β production in the infected gastric tissue.
[0010] Furthermore, in the above evaluation method, a high transcriptional level of AQP9 in the gastric tissue indicates a strong ability to produce IL-1β in response to infection or lipopolysaccharide (LPS) stimulation; a low transcriptional level of AQP9 in the gastric tissue indicates a weak ability to produce IL-1β in response to infection or LPS stimulation.
[0011] Furthermore, in the above evaluation method, qRT-PCR is used to detect the expressions of AQP9 and IL-1β in gastric tissue specimens.
[0012] Furthermore, in the above evaluation method, ELISA is used to detect and confirm the IL-1β produced by the gastric tissue.
[0013] Furthermore, in the above evaluation method, the change in the transcriptional level of AQP9 is used to evaluate the production level of the inflammatory signal molecule IL-1β in the gastric tissue, and thus it is expected to assist in the treatment of the occurrence of inflammatory diseases in the gastric tissue, including chronic inflammation, atrophic gastritis, gastric cancer, etc.
[0014] Furthermore, the evaluation method for the ability of the gastric tissue to produce IL-1β is characterized by including the following operating steps:
[0015] (1) Select mononuclear cells isolated from human peripheral blood and gastric tissue samples as the research objects. Both the mononuclear cells and the gastric tissue samples are divided into two equal parts. One part is used to detect the transcriptional levels of AQP9 and IL-1β, and the other part is used to detect the content levels of AQP9 and IL-1β after LPS stimulation and the establishment of a stimulation system.
[0016] (2) Through comparative analysis of the obtained AQP9 transcriptional level data and the content of IL-1β, the result of evaluating the ability of the AQP9 transcriptional content to predict the production of IL-1β in LPS-stimulated gastric tissue is obtained. A high transcriptional level of AQP9 in the gastric tissue indicates a strong ability to produce IL-1β in response to infection or lipopolysaccharide (LPS) stimulation; a low transcriptional level of AQP9 in the gastric tissue indicates a weak ability to produce IL-1β in response to infection or LPS stimulation.
[0017] Furthermore, in step (2) above, the relative transcriptional levels of AQP9 and IL-1β are calculated -△Ct , and the change in the AQP9 transcriptional level data and the content of IL-1β are compared and analyzed.
[0018] Further, the final concentration of LPS for stimulation in step (1) is 1.5 pg / mL; the mononuclear cells are macrophages, and the cell concentration is 1.0×10 6 cells / mL.
[0019] Further, the stimulation time in step (1) is 24 h.
[0020] Further, the specific operation of step (1) is as follows:
[0021] Divide the obtained ex vivo gastric tissue sample into two parts. Immediately grind one part, extract RNA, perform reverse transcription, and qRT-PCR experiments, and calculate the relative transcription levels of AQP9 and IL-1β (using β-actin as the internal reference);
[0022] Stimulate the other part of the ex vivo gastric tissue sample with LPS simultaneously to establish a stimulation system: Add 0.5 ml of conventional RPMI 1640 medium to a 24-well plate, place the tissue in it, and add LPS; continue to culture at 37 °C under 5% CO 2 for 24 hours;
[0023] Use the isolated peripheral blood mononuclear cells as a control to observe whether there is gastric tissue specificity.
[0024] Further, after RNA extraction from the ex vivo gastric tissue sample, according to the measured RNA concentration, use the extracted RNA as a template for reverse transcription to synthesize cDNA, design molecular primers for AQP9 and IL-1β, perform real-time fluorescence quantitative PCR reaction, and calculate 2 -△Ct to obtain the relative transcription amount of the target gene; obtain the expression contents of AQP9 and IL-1β.
[0025] Further, the molecular primer sequences of AQP9, IL-1β, and the internal reference β-actin are as follows:
[0026] AQP9-F: AACAACTTCTGGTGGATT (SEQ NO1)
[0027] AQP9-R: AATGACAAGAACATAGATGAG (SEQ NO2)
[0028] IL1B-F: ATGATGGCTTATTACAGTGGCAA (SEQ NO3)
[0029] IL1B-R: GTCGGAGATTCGTAGCTGGA (SEQ NO4)
[0030] β-actin-F: CTGGAACGGTGAAGGTGACA (SEQ NO5)
[0031] β-actin-R: AAGGGACTTCCTGTAACAATGCA (SEQ NO6).
[0032] Further, the operation of stimulating and treating peripheral blood mononuclear cells is as follows: the concentration of mononuclear cells in the culture well is 1.0×10 6 cells / mL, and LPS is added; continue to culture at 37°C under 5% CO 2 conditions for 24 hours.
[0033] Further, after calculating the relative transcription levels of AQP9 and IL-1β2 -△Ct then, statistical analysis is performed using GraphPad Prism 10.0 software.
[0034] Further, after the aforementioned stimulation system is established, the cell suspension 24 hours after the stimulation occurs is collected, centrifuged to obtain the supernatant, and the content of IL-1β in the culture supernatant is detected by ELISA method.
[0035] Further, the specific operation of detecting the content of IL-1β in the culture supernatant by ELISA method is carried out according to the instructions in the ELISA kit of Thermo Fisher Scientific Co., Ltd.
[0036] Advantages of the present invention:
[0037] 1. The evaluation method of the present invention uses the change in the transcription level of AQP9 in gastric tissue to evaluate the potential of gastric tissue to produce the inflammatory cytokine IL-1β (Interleukin) according to its level, and thus can predict the level of inflammation that occurs in gastric tissue after being stimulated by LPS, etc. at an early stage, which is of great significance for evaluating the inflammatory environment and damage degree of gastric tissue.
[0038] 2. The evaluation method of the present invention is simple to operate, reliable, and prospective. Description of the Drawings
[0039] Figure 1 This is for the detection of the transcription level of AQP9 gene in ex vivo gastric tissue by the qRT-PCR method of the present invention;
[0040] Figure 2 This is for the detection of the transcription level of IL1B gene in ex vivo gastric tissue by the qRT-PCR method of the present invention;
[0041] Figure 3 This is for the detection of the content of IL-1β produced by gastric tissue after 24 hours of LPS stimulation by the ELISA method of the present invention;
[0042] Figure 4 This is for the correlation between the transcription level of AQP9 in ex vivo gastric tissue and the content of IL-1β produced by gastric tissue after 24 hours of LPS stimulation of the present invention;
[0043] Figure 5 This invention is about detecting the transcriptional level of AQP9 gene in peripheral mononuclear cells by qRT-PCR method;
[0044] Figure 6 This invention is about detecting the transcriptional level of IL1B gene in peripheral mononuclear cells by qRT-PCR method;
[0045] Figure 7 This invention is about detecting the content of IL-1β produced by peripheral blood mononuclear cells after 24 hours of LPS stimulation by ELISA method;
[0046] Figure 8 This invention is about the correlation between the transcriptional level of AQP9 in peripheral blood mononuclear cells and the content of IL-1β produced after 24 hours of LPS stimulation. Detailed implementation manners
[0047] To clearly illustrate the technical features of this solution, the present invention will be elaborated in detail below through specific implementation manners in combination with the attached drawings.
[0048] For those not specified in the following examples, all are carried out according to conventional conditions or the conditions recommended by the manufacturer. The methods used in the present invention are all conventional methods without special regulations; the raw materials and devices used are all conventional commercially available products without special regulations.
[0049] I. Materials and methods
[0050] 1.1 Main experimental reagents and manufacturers
[0051]
[0052] 1.2 Human peripheral blood mononuclear cells were collected from healthy volunteers, and gastric tissues were collected from clinical in vitro samples (approved by the ethics committee of our unit). Both cell and tissue cultures were carried out using RPMI 1640 medium and cultured in an incubator at 37°C; cells with good growth and a cell survival rate > 95% were used for the experiment.
[0053] 1.3 Methods
[0054] 1.3.1 RNA extraction and concentration determination
[0055] ① For peripheral blood mononuclear cell samples: Collect the peripheral blood mononuclear cell suspension in an Ep tube, centrifuge at 1000g for 5 min, discard the supernatant and collect the cells; add 1 mL of Trizol and mix well. For in vitro gastric tissue samples: Add magnetic beads, gastric tissue, and 500 μL of Trizol to an EP tube, grind at -20°C for 2 min, collect the tissue suspension in a 1.5 ml EP tube, and add 500 μL of Trizol and mix well.
[0056] ② Add chloroform at a volume of 200 μl chloroform / ml Trizol, shake vigorously for 15 s, leave at room temperature for 10 - 15 min, centrifuge at 12,000 g at 4 °C for 15 min.
[0057] ③ Centrifuge at 12,000 rpm at 4 °C for 15 min. After centrifugation, it is divided into three layers. Transfer the top layer to a new Ep tube.
[0058] ④ Add an equal volume of isopropanol, mix well, and centrifuge at 12,000 g at 4 °C for 10 min.
[0059] ⑤ Discard the supernatant, wash the precipitate once with 75% ethanol solution, and centrifuge at 12,000 g at 4 °C for 5 min.
[0060] ⑥ Discard the supernatant, let it stand for about 10 min to allow the residual ethanol to evaporate completely. Dissolve the precipitate with an appropriate amount of DEPC water, and then analyze the purity and concentration of the obtained RNA using a ultra - micro spectrophotometer. Store at - 80 °C for subsequent experiments.
[0061] ⑦ According to the measured RNA concentration, perform reverse transcription using the extracted RNA as a template.
[0062] 1.3.2 Reverse Transcription
[0063] (1) According to the following system, calculate the volumes of the sample and RNAse - Free Water required based on a loading amount of 1.5 μg RNA per sample to make the total volume of the system 20 μL.
[0064] Reverse Transcription Reaction System
[0065]
[0066] (2) After loading the samples, centrifuge briefly, place in a PCR instrument, and perform the reaction according to the program of 25 °C for 30 min, 42 °C for 30 min, and 85 °C for 5 min. After the reaction, obtain cDNA samples, which can be directly used for real - time fluorescence quantitative PCR. If not used in the experiment temporarily, they can be stored in a - 20 °C refrigerator.
[0067] 1.3.3 Real - Time Fluorescence Quantitative PCR
[0068] (1) Primers:
[0069]
[0070] (2) According to the following reaction system, add the following components to an eight - tube strip, with a total volume of the system being 20 μL; after loading the samples, centrifuge briefly, and then place in a fluorescence quantitative PCR instrument for reaction.
[0071] qRT - PCR Reaction System
[0072]
[0073] 1.3.4 Calculate ΔCt of the target gene = Ct (target gene) - Ct (target gene of the same sample); 2 -△Ct = relative expression level. Statistical analysis was performed using GraphPad Prism 10.0 software.
[0074] 1.3.5 Stimulation system
[0075] S1. Take 1.0×10 6 Peripheral blood mononuclear cells and seed them into culture wells. After the cells are stable for 2 - 4 hours, stimulate them with LPS and continue culturing for 24 hours. Place gastric tissue into the culture wells and stimulate it with LPS for 24 hours.
[0076] S2. After 24 hours, collect the culture supernatants of mononuclear cells and gastric tissue into Ep tubes, centrifuge at 1000g for 5 minutes in a low - temperature centrifuge, and transfer the supernatants to new Ep tubes.
[0077] S3. Detect cytokines in cells using ELISA. Operate according to the instructions in the ELISA kit of Thermo Fisher Scientific Co., Ltd. The specific steps are as follows:
[0078] (1) Dilute the capture antibody with coating buffer to prepare the coating solution, and coat the well plate with 100 μL of the coating solution per well. Cover the well plate and incubate overnight (12 - 18 hours) at 2 - 8 °C.
[0079] (2) Aspirate the liquid in each well, add 200 μL of washing buffer to each well and wash once. After washing, invert the well plate and gently tap it on absorbent paper to remove the residual liquid.
[0080] (3) Add 200 μL of blocking buffer to each well and block for 1 h at room temperature.
[0081] (4) Aspirate, invert the well plate and gently tap it on absorbent paper to remove the residual liquid.
[0082] (5) Prepare the standard and sample dilutions in blocking buffer.
[0083] (6) Add 100 μL of the standard and samples to the designated wells. Incubate gently with continuous shaking (~500 rpm) for 1 hour at room temperature.
[0084] (7) Aspirate the liquid in each well, add 200 μL of washing buffer to each well and wash 5 times. After washing, invert the well plate and gently tap it on absorbent paper to remove the residual liquid.
[0085] (8) Prepare the detection antibody solution by diluting the detection antibody in the blocking buffer.
[0086] (9) Add 100 μL of the detection antibody solution to each well. Incubate gently with continuous shaking (~500 rpm) at room temperature for 2 hours.
[0087] (10) Aspirate the liquid in each well and add 200 μL of the wash buffer to each well for washing 5 times. After washing, invert the microplate and gently tap it on the absorbent paper to remove the residual liquid.
[0088] (11) Dilute streptavidin - horseradish peroxidase to prepare the working solution at a ratio of 1:5000 with the blocking buffer.
[0089] (12) Add 100 μL of the streptavidin - horseradish peroxidase working solution to each well. Incubate gently with continuous shaking (~500 rpm) at room temperature for 30 minutes.
[0090] (13) Aspirate the liquid in each well and add 200 μL of the wash buffer to each well for washing 5 times. After washing, invert the microplate and gently tap it on the absorbent paper to remove the residual liquid.
[0091] (14) Add 100 μL of the TMB substrate solution to each well. Incubate the microplate at room temperature for 30 minutes.
[0092] (15) Add 100 μL of the stop solution to each well and measure the absorbance at 450 nm within 30 minutes.
[0093] (16) Calculate the results using logarithmic - logarithmic or four - parameter curve fitting.
[0094] 2. Results
[0095] 2.1 Grind the obtained gastric tissue, extract RNA, reverse - transcribe to generate cDNA, detect the transcriptional levels of AQP9 and IL - 1β in the gastric tissue by qRT - PCR method, and calculate the relative expression levels. Specifically, as Figure 1 、 Figure 2 shown, it was found that, compared with the internal reference β - actin gene, the transcriptional levels of AQP9 and IL1B were both lower, and the transcriptional content of AQP9 was higher than that of IL - 1β; indicating that the sensitivity requirement for detecting the transcriptional content of AQP9 is lower than that for IL1B transcription detection.
[0096] 2.2 After stimulating the gastric tissue with LPS for 24 hours, collect the supernatant, and then detect the expression level of IL - 1β by ELISA. As Figure 3 shown, the results showed that: Gastric tissue samples from different sources can produce different secretion amounts of IL - 1β after being stimulated with LPS, and its content is not related to the transcriptional level of IL1B, but positively correlated with the transcriptional level of AQP9. AsFigure 4 as shown
[0097] 2.3 For peripheral blood mononuclear cells, RNA was extracted and reverse transcribed into cDNA, and the transcriptional levels of AQP9 and IL-1β in peripheral blood mononuclear cells were detected by qRT-PCR, and the relative expression levels were calculated, as Figure 5 、 Figure 6 shown. Compared with the internal reference β-actin gene, the transcriptional levels of AQP9 and IL1B were both low in peripheral blood, and the transcriptional content of AQP9 was lower than that of IL-1β, which was contrary to the results in gastric tissue; suggesting that the increase in the transcriptional content of AQP9 in gastric tissue may be due to the influence of the gastric tissue microenvironment. The expression level of IL-1β was detected by ELISA, as Figure 7 shown. Peripheral blood mononuclear cells from different sources could produce approximately the same amount of secreted IL-1β after being stimulated by LPS, with no obvious difference among different individuals. At the same time, its content was not correlated with the transcriptional level of IL1B and was not correlated with the transcriptional level of AQP9, as Figure 8 shown.
[0098] II. Discussion
[0099] As an important inflammatory factor and immune regulatory factor, IL-1β acts as an amplifier of the immune response and is mainly derived from innate immune cells such as monocytes, macrophages, and dendritic cells. Since the synthesis and secretion of IL-1β is a multi-cascade process, persistent IL-1β secretion leads to autoimmunity and induces the occurrence of autoinflammatory diseases. Therefore, effectively antagonizing the production of IL-1β in the stomach can reduce inflammation and the exacerbation of tissue damage.
[0100] Macrophages, as an indispensable part of the innate immune system, have a long survival time and are the main participants in chronic inflammatory responses. Macrophages infiltrated in gastric tissue are stimulated by external stimuli such as bacterial infections, acting on the pathogen recognition receptor (TLR) of macrophages, initiating the transcriptional and translational processes of the IL-1β gene and forming the precursor protein (pro-IL-1β), activating the NLRP3 inflammasome in macrophages, and the activated NLRP3 inflammasome cleaves the precursor of Caspase-1 to form activated Caspase-1. Subsequently, the activated Caspase-1 cleaves pre-IL-1β to form mature IL-1β molecules. As an effective pro-inflammatory cytokine, IL-1β can not only induce the release of inflammatory factors such as IL-6 and stimulate T cell activation, but also promote the release of inflammatory mediators such as nitric oxide (NO) and prostaglandin (PG), leading to endothelial cell responses and causing strong inflammatory responses and tissue damage.
[0101] The evaluation method of the present invention is directed to ex vivo gastric tissues obtained clinically. By means of qRT-PCR technology, the transcriptional level of AQP9 is detected, which can predict the ability of gastric tissues to produce IL-1β after being subjected to stimulation signals such as LPS. That is, gastric tissues with a high transcriptional level of AQP9 have a strong ability to produce IL-1β. Using LPS as a signaling substance, a stimulation system is established with peripheral blood mononuclear cells and gastric tissues. After 24 hours, the production of IL-1β is detected by ELISA, and its level is positively correlated with the transcriptional level of AQP9 detected 24 hours before. In short, a high transcriptional level of AQP9 in gastric tissues may indicate a large number of AQP9-positive macrophages, and thus a strong ability to produce IL-1β in response to infection or LPS stimulation; a low transcriptional level of AQP9 in gastric tissues may indicate a small number of AQP9-positive macrophages, and thus a weak ability to produce IL-1β in response to infection or LPS stimulation.
[0102] The above specific embodiments cannot be used as a limitation on the protection scope of the present invention. For those skilled in the art of this technology, any alternative improvement or transformation made to the embodiments of the present invention falls within the protection scope of the present invention.
[0103] Those details not described in the present invention are all well-known technologies to those skilled in the art of this technology.
Claims
1. A method for evaluating the ability of gastric tissue to produce IL-1β, characterized in that: The evaluation method evaluates the ability to produce IL-1β in the gastric tissue microenvironment based on the transcription level of AQP9; the method includes the following steps: (1) Mononuclear cells isolated from human peripheral blood and gastric tissue samples were selected as research objects. The mononuclear cells and gastric tissue samples were divided into two parts. One was used to detect the transcription levels of AQP9 and IL-1β, and the other was used to detect the content level of IL-1β after LPS stimulation and establishment of the stimulation system. (2) By comparing the obtained AQP9 transcription level data with the IL-1β content, the results of evaluating the ability of AQP9 transcription content in predicting the production of IL-1β in gastric tissue stimulated by LPS were obtained; high AQP9 transcription levels in gastric tissue indicate a strong ability to produce IL-1β in response to infection or lipopolysaccharide (LPS) stimulation; low AQP9 transcription levels in gastric tissue indicate a weak ability to produce IL-1β in response to infection or LPS stimulation.
2. The method for evaluating the ability of gastric tissue to produce IL-1β according to claim 1, characterized in that: Step (1) The final concentration of LPS used for stimulation was 1.5 pg / mL; the mononuclear cells were macrophages, and the cell concentration was 1.0×10 6 Pieces / mL.
3. The method for evaluating the ability of gastric tissue to produce IL-1β according to claim 1, characterized in that: Step (1) The stimulation time is 24 hours.
4. The method for evaluating the ability of gastric tissue to produce IL-1β according to claim 1, characterized in that: The specific operations of step (1) are as follows: The obtained ex vivo gastric tissue samples were divided into two parts, one part was immediately ground, RNA was extracted, reverse transcribed and qRT-PCR experiments were performed to calculate the relative transcription levels of AQP9 and IL-1β, with β-actin as the internal reference; Another part of the ex vivo gastric tissue samples were stimulated with LPS at the same time to establish a stimulation system: conventional 1640 culture medium was added to a 24-well plate, the ex vivo gastric tissue was placed therein, and LPS was added; the culture was continued at 37°C and 5% CO2 for 24 hours; Isolated peripheral blood mononuclear cells were used as a control to observe whether there was gastric tissue specificity.
5. The method for evaluating the ability of gastric tissue to produce IL-1β according to claim 4, characterized in that: The stimulation treatment of peripheral blood mononuclear cells was as follows: the concentration of mononuclear cells in the culture well was 1.0×10 6 / mL, add LPS and continue to culture at 37℃, 5% CO2 for 24 hours.
6. The method for evaluating the ability of gastric tissue to produce IL-1β according to claim 4, characterized in that: Calculation of relative transcription levels of AQP9 and IL-1β -△Ct Then, GraphPad Prism 10.0 software was used for statistical analysis.