Method for screening high-altitude adaptable cattle using SNP molecular markers, SNP molecular markers, kits, and applications
By screening the SNP molecular marker at position 98502322 of chromosome 11 of ordinary cattle and detecting C/T base mutations, the problem of hypoxia response of specialized cattle in high-altitude areas was solved, and efficient and accurate screening of high-altitude adaptable cattle and breeding-assisted selection were achieved.
Patent Information
- Application Number
- CN202411811455.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-10
- Publication Date
- 2025-09-23
- Estimated Expiration
- 2044-12-10
AI Technical Summary
Specialized beef (dairy) cattle breeds (lines) originate from low-altitude areas and are prone to hypoxia reactions when raised in high-altitude areas, resulting in incomplete growth and reproductive performance, affecting the stable development of the plateau cattle industry.
By screening the SNP molecular marker located at position 98502322 of chromosome 11 of ordinary cattle, detecting C/T base mutations, and using PCR amplification, SAP enzyme digestion and extension reaction to determine the genotype, cattle with good adaptability to high altitudes are screened out, and a kit is provided for assisted selection.
It achieves high-sensitivity and high-accuracy screening of high-altitude adaptable cattle. It is easy to operate and cost-effective. It can provide a reliable breeding reference for high-altitude breeding and significantly improve the high-altitude adaptability of cattle.
Smart Images

Figure CN119433049B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular markers, and in particular to a method for screening high-altitude adaptable cattle using SNP molecular markers, a SNP molecular marker, a kit and applications. Background Art
[0002] Specialized beef (dairy) cattle breeds (lines) boast fast growth, high-quality meat, and high milk production, making them popular crossbreeding sires for high-performance meat and milk production in high-altitude areas. However, because these breeds originate from lower altitudes, they are susceptible to altitude sickness, such as hypoxia, when raised at high altitudes. Therefore, blindly selecting specialized beef (dairy) cattle for high-altitude breeding can lead to suboptimal or even complete failure of their growth and reproductive performance, severely impacting the long-term, stable, and sustainable development of the conventional cattle and yak industries in the plateau. Summary of the Invention
[0003] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a method for screening high-altitude adaptable cattle using SNP molecular markers, a SNP molecular marker, a kit and applications.
[0004] The object of the present invention is achieved through the following technical solutions:
[0005] A SNP molecular marker for screening cattle for high-altitude adaptability, the sequence of the SNP molecular marker is shown in SEQ1.
[0006] The SNP molecular marker is located at position 98502322 on chromosome 11 of common cattle. There is a C / T base mutation at the position. The corresponding point of the position on the sequence SEQ1 is the 31st base from the 5' end. There is a C / T mutation at the position.
[0007] A method for screening cattle for high altitude adaptability using SNP molecular markers comprises the following steps:
[0008] The method comprises the following steps: using the genomic DNA to be tested as a template, performing PCR amplification using amplification primers, and obtaining a PCR product; digesting the PCR product with SAP enzyme, removing the remaining deoxyribonucleoside triphosphates and primers in the PCR product, and obtaining a digestion product; using the digestion product as a template, performing an extension reaction using extension primers, and obtaining an extension product; detecting the difference in molecular weight between the extension product and the non-extended primer, and determining the genotype; and based on the genotype of the SNP molecular marker, when the genotype of the SNP molecular marker is TT, the cattle are judged to have good high-altitude adaptability; when the genotype of the SNP molecular marker is CT, the cattle are judged to have medium high-altitude adaptability; and when the genotype of the SNP molecular marker is CC, the cattle are judged to have the worst high-altitude adaptability.
[0009] The high-altitude adaptability of cattle with TT genotype is significantly better than that of CT and CC types, and can be used as a genetic marker in the screening and breeding of ordinary cattle for high-altitude adaptability.
[0010] The amplification primers are divided into upstream primers and downstream primers. The sequence of the upstream primer is shown in SEQ2, the sequence of the downstream primer is shown in SEQ3, and the sequence of the extension primer is shown in SEQ4.
[0011] A kit for screening high-altitude adaptable cattle contains amplification primers and extension primers. The amplification primers include upstream primers and downstream primers. The sequence of the upstream primer is shown in SEQ2, the sequence of the downstream primer is shown in SEQ3; the sequence of the extension primer is shown in SEQ4.
[0012] The above kit also includes dNTPs, Taq DNA polymerase, Mg 2+ , PCR reaction buffer, SAP enzyme and SNP molecular marker standard positive template.
[0013] The present invention also provides an application of a kit in screening high-altitude adaptable cattle, specifically in molecular marker-assisted selection of high-altitude adaptability of common cattle, where high-altitude adaptability mainly refers to the degree of hypoxia response.
[0014] The beneficial effects of the present invention are:
[0015] This method uses Sequenom SNP technology to detect base mutations at position 98502322 on chromosome 11 in common cattle, and screens cattle with strong high-altitude adaptability through genotyping. This method boasts high sensitivity, good accuracy, and a cost-effective approach. It can simultaneously test hundreds to thousands of samples, is easy to use, and produces reliable results. It can provide a reference for the continued breeding and molecular marker-assisted selection of common cattle raised at high altitudes. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] Figure 1 is the mass spectrometry detection result of the extension product; DETAILED DESCRIPTION
[0017] The following will clearly and completely describe the technical solutions of the present invention in conjunction with the embodiments. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work shall fall within the scope of protection of the present invention.
[0018] Example 1
[0019] This embodiment provides a kit for screening cattle for high altitude adaptability, comprising:
[0020] (1) Screening of SNP molecular markers for high-altitude adaptability in cattle. The SNP molecular marker is located at position 98502322 on chromosome 11 of common cattle, and there is a C / T base mutation at the site. The nucleotide sequence of the SNP molecular marker is shown in SEQ 1; the nucleotide sequence shown in SEQ 1 has a C / T mutation at the 31st base from the 5' end. The SNP molecular marker is based on the international reference genome ARS-UCD1.3 version of common cattle. The specific SNP molecular markers are shown below, and the mutation sites are marked (black bold):
[0021] CTGTGGCATG GAAGTGATGG AAAATGTGGTCAGTAACGAG GTAAGACCTG GAGTGGGAAAAAGGGATGGT GCCCCCTCCA GGTGCCTCCT GGATCTTCCA GGCAGAGAGG CTTTGGGGAGAGCGGGTGTGGTGCTAGTAG GAA
[0022] Based on the genotype of the SNP molecular marker, when the genotype of the SNP molecular marker is TT, the cattle are judged to have good adaptability to high altitudes; when the genotype of the SNP molecular marker is CT, the cattle are judged to have medium adaptability to high altitudes; and when the genotype of the SNP molecular marker is CC, the cattle are judged to have the worst adaptability to high altitudes.
[0023] (2) A detection primer set for SNP molecular markers, used for implementing SNP molecular marker screening for high-altitude adaptable cattle, including PCR amplification primers and extension primers.
[0024] The PCR amplification primers include an upstream primer (F) and a downstream primer (R). The nucleotide sequence of the upstream primer is shown in SEQ 2, and the nucleotide sequence of the downstream primer is shown in SEQ 3.
[0025] SEQ 2: ACGTTGGATG CTGTGGCATG GAAGTGATGG
[0026] SEQ 3: ACGTTGGATG TTCCTACTAG CACCACACCC
[0027] The nucleotide sequence of the extension primer is shown in SEQ 4.
[0028] SEQ 4: TGATGG AAAA TGTGGT
[0029] (3) Also includes dNTPs, Taq DNA polymerase, Mg 2+ , PCR reaction buffer, SAP enzyme.
[0030] The above-mentioned kit for screening cattle with high-altitude adaptability can be used in auxiliary selection of common cattle with high-altitude adaptability.
[0031] Example 2
[0032] This example provides a method for screening cattle for high-altitude adaptability using SNP molecular markers, and the specific steps are as follows:
[0033] 1. Extract genomic DNA from the common cattle to be tested, and perform subsequent testing using the kit provided in Example 1;
[0034] (1) Sample collection
[0035] Thirty Liangshan cattle were sourced from Leibo County, Liangshan Prefecture (elevation 1000 m), 30 southern Sichuan mountain yellow cattle were sourced from Yunlian County, Yibin City (elevation 1000 m), 30 Kongshan cattle were sourced from Tongjiang County, Bazhong City (elevation 1000 m), 30 Simmental cattle were sourced from Hongya County, Meishan City (elevation 1000 m), 20 Ganzi Tibetan cattle were sourced from Jiulong County, Ganzi Prefecture (elevation 1000 m), and 11 Zhangmu cattle were sourced from Nyalam County, Shigatse City (elevation 1000 m). Five milliliters of blood was collected from the tail root of adult cattle, anticoagulated with EDTA, and stored at -20°C until further use. A total of 151 samples were prepared for testing.
[0036] (2) DNA extraction
[0037] Genomic DNA was extracted from blood samples using a pre-made kit. OD values were measured using a NanoDrop 2000 instrument and analyzed by 1.25% agarose gel electrophoresis. DNA that passed quality control was transferred to a 96-well plate and stored at -20°C until ready for use.
[0038] 2. Using the genomic DNA of the common cattle to be tested as a template, use the PCR amplification primers in the primer set to perform a PCR amplification reaction to obtain a PCR product.
[0039] The PCR amplification reaction design is as follows:
[0040] (1) The PCR amplification reaction system was 10 μL, including 1 μL of 30 ng / μL genomic DNA, 1.0 μL of 10× PCR reaction buffer, 0.20 μL of 10 mM dNTPs, 0.5 μL each of 20 pmol upstream primer F and downstream primer R, 0.20 μL of 2 U / μL Taq DNA polymerase, and 6.6 μL of deionized water;
[0041] (2) The PCR amplification reaction procedure was as follows: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 45 s, annealing at 59°C for 45 s, and extension at 72°C for 60 s, for 30 cycles; and holding at 72°C for 5 min.
[0042] 3. Use SAP enzyme to digest the PCR product to remove the remaining deoxyribonucleoside triphosphates (dNTPs) and primers in the PCR product to obtain the digestion product.
[0043] The design of SAP enzymatic digestion reaction is as follows:
[0044] (1) The reaction system of SAP reaction was 7 μL, 10× SAP Buffer 0.17 μL, 1 U / μL SAP Enzyme 0.30 μL, deionized water 1.53 μL, and PCR product 5 μL.
[0045] (2) The reaction procedure of SAP reaction was: 37℃ for 20 min; 85℃ for 5 min.
[0046] 4. Using the digestion product as a template, perform an extension reaction using the single-base extension primer in the primer set to obtain an extension product.
[0047] The extension reaction design is as follows:
[0048] (1) The reaction system for the extension reaction was 9 μL, including 0.2 μL of iplex Buffer Plus, 0.2 μL of iplex Termination mix, 0.94 μL of 0.625-1.25 μmol / L primer mix, 0.041 μL of iplex Enzyme, 0.619 μL of deionized water, and 7 μL of SAP+PCR reaction.
[0049] (2) The reaction program of the extension reaction was: 94°C for 30 s; 94°C for 5 s, (52°C for 5 s, 80°C for 5 s, 5 cycles), 40 cycles; 72°C for 3 min.
[0050] The mass spectrometry results of the extension products are as follows Figure 1 As shown in the figure, all 151 samples were successfully typed, with a typing success rate of 100%, indicating that the Sequenom SNP technology has a high typing accuracy.
[0051] 5. The above products are detected by matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) to detect the molecular weight difference between the extended product and the unextended primer, and the base at that point is determined, thereby determining the genotype, which is CC, CT or TT.
[0052] The distribution frequencies of different genotypes and alleles in all common cattle are shown in Table 1.
[0053] Table 1 Genotype and allele frequencies of polymorphic sites of the bovine endoglin gene
[0054] genotype Frequency Genotype frequency Allele Allele frequency Hardy-Weinberg equilibrium P value CC 107 0.709 C 0.748 CT 12 0.079 T 0.252 P<0.01 TT 32 0.212
[0055] Sequenom SNP typing of blood DNA samples from 151 cattle revealed three genotypes at the C4682T locus in the endoglin gene: wild homozygous CC, heterozygous CT, and mutant homozygous TT. The frequencies of the three genotypes were 0.709 for CC, 0.079 for CT, and 0.212 for TT. The Hardy-Weinberg equilibrium test indicated that this locus did not reach Hardy-Weinberg equilibrium (P < 0.05), suggesting that this mutation could be targeted for further breeding.
[0056] Example 3
[0057] Based on Example 2, a correlation analysis was performed, as shown below:
[0058] (1) Association analysis method
[0059] Statistical analysis was performed using R4.3.3. The chi-square test and Fisher's exact probability method were used for comparison between groups. The odds ratio (OR) and its 95% confidence interval ( CI ), P < 0.05 was considered statistically significant.
[0060] (2) Correlation analysis results
[0061] The specific results are shown in Table 2. The analysis showed that the genotypes of the endoglin gene C4682T site (CC / TC / TT) were distributed in common cattle living at high and low altitudes. The correlation was calculated by unconditional logistic regression. Individuals with the TT genotype had a significantly increased adaptability to high altitude (OR = 0.206, 95% CI = 0.03-0.17). CI =0.119-0.338, P<0.01). The statistical results intuitively reflect that the adaptability of ordinary cattle with the TT genotype to high altitude is significantly better than that of the CC and CT genotypes. This genotype can be used as a genetic marker in the screening and breeding of high-altitude adaptable cattle.
[0062] Table 2 Association analysis between the polymorphism of the C4682T site of the cattle endoglin gene and the high-altitude adaptability of common cattle
[0063]
[0064] The foregoing description is merely a preferred embodiment of the present invention. It should be understood that the present invention is not limited to the form disclosed herein and should not be construed as excluding other embodiments. Rather, the present invention can be used in various other combinations, modifications, and environments and can be modified within the scope of the concept described herein through the above teachings or techniques or knowledge in the relevant field. Modifications and variations made by those skilled in the art that do not depart from the spirit and scope of the present invention are intended to be protected by the appended claims.
Claims
1. A method for screening cattle for high-altitude adaptability using SNP molecular markers, characterized by: The following steps are involved: Using the genomic DNA to be tested as a template, PCR amplification is performed using amplification primers to obtain PCR products; digesting the PCR product with SAP enzyme to remove the remaining deoxyribonucleoside triphosphates and primers in the PCR product to obtain a digestion product; Using the digestion product as a template, an extension primer is used to perform an extension reaction to obtain an extension product; The molecular weight difference between the extended product and the unextended primer is detected to determine the genotype. Based on the genotype of the SNP molecular marker, when the genotype of the SNP molecular marker is TT, the cattle are judged to have good adaptability to high altitude. The sequence of the SNP molecular marker is shown in SEQ1, and the corresponding point of the SNP molecular marker on the sequence SEQ1 is that there is a C / T mutation at the 31st base from the 5' end.
2. The method for screening cattle for high altitude adaptability using SNP molecular markers according to claim 1, characterized in that: The amplification primers are divided into an upstream primer and a downstream primer. The sequence of the upstream primer is shown in SEQ2, and the sequence of the downstream primer is shown in SEQ3.
3. The method for screening cattle for high altitude adaptability using SNP molecular markers according to claim 1, characterized in that: The sequence of the extension primer is shown in SEQ 4.
4. Use of the method for screening high-altitude-adaptable cattle using SNP molecular markers according to any one of claims 1 to 3 in screening high-altitude-adaptable cattle for preparing a kit for screening high-altitude-adaptable cattle, characterized in that: It contains amplification primers and extension primers, wherein the amplification primers include an upstream primer and a downstream primer, the sequence of the upstream primer is shown in SEQ2, the sequence of the downstream primer is shown in SEQ3; the sequence of the extension primer is shown in SEQ4.
5. The application according to claim 4, characterized in that: The kit also includes dNTPs, Taq DNA polymerase, Mg 2 + , PCR reaction buffer, SAP enzyme and SNP molecular marker standard positive template.
Citation Information
Patent Citations
Method for screening bovine high-altitude hypoxic adaptation gene ALDOC and functional molecular marker and application thereof
AU2021100816A4
Method for screening cattle high altitude hypoxia adaptation molecular markers and application thereof
CN109994153A