RNA comprising secretory groups and methods of use thereof

Abstract

Disclosed are methods and compositions related to a unique combination of two or more RNA sequences, the RNA sequences include, but are not limited to, microRNAs, mRNAs, long-chain non-coding RNAs, y-RNAs, pi-RNAs, and other non-coding RNAs capable of altering immune function in a subject, packaged in naturally generated mesenchymal stem / stromal cell extracellular vesicles (EV), synthetic EV (also known as liposomes or lipid nanoparticles), or combinations thereof.

Description

[0001] This PCT application claims priority to and the benefit of U.S. Provisional Patent Application No. 63 / 324,910, filed on March 29, 2022, which is incorporated herein by reference in its entirety.

[0002] I. Reference sequence list

[0003] Pursuant to 37 C.FR §1.52(e)(5), the Sequence Listing filed on March 29, 2023 is hereby incorporated by reference in the form of an .XML file titled “11071-013US1.XML” created on March 29, 2023, and having a file size of 2914 bytes.

[0004] II. Background Art

[0005] Mesenchymal stem cells / stromal cells (MSCs) alter the body's immune response primarily by secreting a combination of soluble factors, extracellular matrix, and extracellular vesicles (EVs). EVs contain proteins and RNA molecules that regulate pro-inflammatory and anti-inflammatory signaling pathways of immune cells (neutrophils, monocytes, macrophages, dendritic cells, B cells, T cells, natural killer (NK) cells, etc.). Bacterial and viral pathogens have evolved strategies to manipulate natural immune responses to their advantage. For example, bacteria and viruses are able to induce interleukin 10 (IL-10), a major anti-inflammatory cytokine that causes immunosuppression, enabling pathogens to increase their infection efficiency and replication rate. In other cases, patients may have genetically related immune response defects that may reduce the efficacy of secreted factors and extracellular vesicles in naturally derived therapeutic agents. These defects may represent defects in immunomodulatory signaling molecules or their receptors. What is needed is a new composition that can offset microbial immune escape techniques and immune response defects.

[0006] III. Summary of the invention

[0007] Disclosed are methods and compositions related to unique combinations of two or more RNA sequences, including but not limited to microRNAs, mRNAs, long non-coding RNAs, y-RNAs, pi-RNAs and other non-coding RNAs that are capable of altering the immune function of a subject and are packaged in naturally occurring mesenchymal stem cell / stromal cell extracellular vesicles (EVs), synthetic EVs (also known as liposomes or lipid nanoparticles), or a combination thereof.

[0008] In one aspect, disclosed herein are compositions comprising one or more secretomes (such as, for example, liposomes, lipid nanoparticles, or mesenchymal stem cell (MSC)-derived exosomes or extracellular vesicles, or any combination thereof) and two or more ribonucleic acids (RNAs) (such as, for example, microRNA (miRNA), messenger RNA (mRNA), long non-coding RNA (lncRNA), y-RNA and / or pi-RNA).

[0009] Also disclosed herein is a composition of any of the foregoing aspects, wherein the two or more RNAs include at least one RNA selected from the group consisting of: RNY4, LOC441666, SNHG1, RNU11, LOC80154, LOC727751, LOC388152, GOLGA2P2Y, GOLGA2P3Y, SNHG12, RNU12, ASMTL-AS1, LOC284454 U2: RF00004.39, U2: RF00004.22, U2: RF00004.35, U2: RF00004.71, U2: RF00004.66 U2: RF00004.91, U2: RF00004.89, U2: RF00004.67, U1: RF00003.5, U1: RF00003.109, U1: RF00003.110, U1: RF00003. 8. U1: RF00003.3, U1: RF00003.6, U1: RF00003.38, U1: RF00003.20, U1: RF00003.24, U1: RF00003.73, U1: RF00003.1 1. U1: RF00003.27, U1: RF00003.40, U1: RF00003.107, U1: RF00003.62, U1: RF00003.45, U1: RF00003.116, U1: RF000 03.126, U1: RF00003.81, U1: RF00003.100, U1: RF00003.57, U1: RF00003.95, U1: RF00003.31, U1: RF00003.61, U1: RF 00003.25, U1: RF00003.90, U1: RF00003.46, U1: RF00003.123, U2: RF00004.42, U2: RF00004.61, U2: RF00004.51, U1 : RF00003.122, U1: RF00003.22, U1: RF00003.9, snoMBII-202: RF00324.2, let-7: RF00027.7, U2: RF00004.75, U1: R F00003.69, U2: RF00004.88, U12: RF00007.1, U7: RF00066.141, U1: RF00003.85, U7: RF00066.49, U2: RF00004.77, U 1: RF00003.113, U1: RF00003.112, U1: RF00003.70, U1: RF00003.83, U7: RF00066.89, U7: RF00066.124, U7: RF00066.75. U7:RF00066.77, U7:RF00066.118, U7:RF00066.103, U7:RF00066.79, U7:RF00066.200 and U7:RF00066.146.

[0010] In one aspect, disclosed herein is a composition of any of the preceding aspects, wherein the two or more RNAs include at least one miRNA selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7e-5p, hsa-let-7g-5p, hsa-let-7i, hsa-let-7i-5p, hsa-miR-100-5p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-106b-5p, hsa-mir-10b, hsa-miR-10b-5p, hsa-mir-10c-5p, hsa-miR-10d ... sa-mir-1246, hsa-miR-1246, hsa-miR-125a-5p, hsa-miR-125b-5p, hsa-miR-130a-3p, hsa-mir-130b, hsa-miR-130b-3p, hsa-miR-132-3p, hsa-miR- 136-5p, hsa-miR-138-5p, hsa-miR-139-5p, hsa-mir-140, hsa-miR-140-3p, hsa-miR-145-5p, hsa-mir-146a, hsa-miR-146a-5p, hsa-miR-148a-3p, h sa-miR-152-3p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-mir-16-1, hsa-mir-16-2, hsa-miR-16-5p, hsa-miR-17-5p, hsa-miR-181a-5p, hsa-miR-191 -5p, hsa-miR-193a-5p, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-199a-3p, hsa-miR-199a-5p, hsa-miR-199b-5p, hsa-miR-19a-3p, hsa-miR-19b -3p, hsa-miR-20a-5p, hsa-miR-203a, hsa-miR-203a-3p, hsa-miR-214-3p, hsa-mir-21, hsa-miR-21-3p, hsa-miR-21-5p, hsa-mir-221, hsa-miR-221 -3p, hsa-mir-222, hsa-miR-222-3p, hsa-miR-22-3p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-mir-24-1, hsa-mir-24-2, hsa-miR-24-3p, hsa-mir-25,hsa-miR-25-3p, hsa-miR-26a-5p, hsa-miR-27a-3p, hsa-mir-27b, hsa-miR-27b-3p, hsa-miR -29a-3p, hsa-miR-29c-3p, hsa-miR-30a-5p, hsa-miR-30a-5p, hsa-miR-30b-5p, hsa-miR-30c -5p, hsa-mir-30d, hsa-miR-30d-5p, hsa-mir-30e, hsa-miR-30e-5p, hsa-miR-31-3p, hsa-miR -31-5p, hsa-miR-320a, hsa-miR-342-3p, hsa-miR-345-5p, hsa-miR-34a-5p, hsa-miR-361-5p , hsa-miR-376a-3p, hsa-miR-376c-3p, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424-5p, h sa-miR-484, hsa-mir-486-1, hsa-mir-486-2, hsa-miR-486-5p, hsa-miR-570-3p, hsa-miR-57 4-3p, hsa-miR-663a, hsa-miR-874-3p, hsa-mir-92a-1, hsa-mir-92a-2, hsa-miR-92a-3p, hsa -miR-92b-3p, hsa-mir-93, hsa-miR-93-5p, hsa-miR-940, hsa-miR-99a-5p and hsa-miR-99b-5p. Preferably, disclosed herein is a composition of any of the aforementioned aspects, wherein the two or more RNAs include at least one miRNA selected from the group consisting of miR-92a-3p, let-7i-5p, miR-16-5p, miR-93-5p, miR-21-5p, miR-214-3p, miR-29c-3p, miR-34a-5p, mir-203a-3p, miR-27b-3p, miR-140-3p, miR-24-3p, miR-222-3p, miR-25-3p, miR-10b-5p, miR-221-3p, miR-17-5p, miR-30a-5p, and miR-30d-5p.

[0011] Also disclosed herein is a composition of any of the foregoing aspects, wherein the two or more RNAs include at least one mRNA selected from the group consisting of HBII-202, U26, U29, HBII-420, U30, U18A, U81, GSKIP, IFT88, PCDH11X, PCDH11Y, KIAA0226L, PDE11A, PHACTR1, TEX14, DCUN1D2, SIM1, FILIP1, FAM107B, CHADL, ZNF365, MNAT 1. CYSTM1, GAS7, HOXB7, ASTN2, LGR5, ZFHX3, MCM7, GRIK1, MAP2, LHFPL3, PTER, STAMBP, CCDC135, PAX9, RPL13, ABC A13, DAAM1, OPN1LW, OPN1MW2, CNOT6L, MTRNR2L10, SMC4, RPL4, PSAP, ASIC4, AHCYL1, RD3L, SIGLEC1, SYCE2 and NANS.

[0012] In one aspect, disclosed herein is a composition of any of the preceding aspects, wherein the two or more RNAs include at least one antisense mRNA selected from the group consisting of UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALP K11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6GALNAC51, ABCA41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1, and GAGE2D: copy 21.

[0013] Also disclosed herein is the composition of any of the aforementioned aspects, wherein the two or more RNAs include at least one lncRNA selected from the group consisting of LOC100129335-5, ZNF238, CADM2-7, SALL1-6, and VWA5A.

[0014] In one aspect, disclosed herein is the composition of any of the aforementioned aspects, wherein the two or more RNAs include at least one antisense lncRNA selected from the group consisting of ANKRD5-1, ZNF236-1, and ACP1.

[0015] Also disclosed herein is the composition of any of the aforementioned aspects, wherein the two or more RNAs include at least one y-RNA selected from the group consisting of RF00019.441, RF00019.451, RF00019.621, RF00019.646, and RF00019.413.

[0016] In one aspect, disclosed herein is the composition of any of the preceding aspects, wherein the two or more RNAs include at least one pi-RNA selected from the group consisting of: piR-33044, piR-33043, and piR-31703.

[0017] Also disclosed herein is a composition of any of the aforementioned aspects, wherein the two or more RNAs include at least one antisense RNA selected from the group consisting of EPHA1-AS1, FLJ45974, ANKRD30BP2, LINC00340, GRIK1-AS1, LOC440300, CSPG4P8, ADARB2-AS1, MLLT4-AS1, and HNRNPU-AS1.

[0018] In one aspect, disclosed herein is a composition of any of the preceding aspects, wherein the RNA includes modifications to reduce degradation (such as, for example, the addition of 2'-O-methyl, 2'-fluoro, or 2'-hydrogen groups).

[0019] Also disclosed herein is a method for regulating an immune response of a subject to inflammatory injury (including but not limited to increasing or reducing inflammation), the method comprising administering to the subject any of the compositions of any of the aforementioned aspects. For example, disclosed herein is a method for regulating an immune response, wherein the regulation increases inflammation, and wherein the two or more RNAs of the composition include at least one mRNA selected from the following: HBII-202, U26, U29, HBII-420, U30, U18A, U81, GSKIP, IFT88, PCDH11X, PCDH11Y, KIAA0226L, PDE11A, PHACTR1, TEX14, DCUN1D2, SIM1, FILIP1, FAM107B, CHADL, ZNF 365, MNAT1, CYSTM1, GAS7, HOXB7, ASTN2, LGR5, ZFHX3, MCM7, GRIK1, MAP2, LHFPL3, PTER, STAMBP, CCDC135, PAX9, RPL13 , ABCA13, DAAM1, OPN1LW, OPN1MW2, CNOT6L, MTRNR2L10, SMC4, RPL4, PSAP, ASIC4, AHCYL1, RD3L, SIGLEC1, SYCE2 and NANS. Also for example, disclosed herein is a method of modulating an immune response, wherein the modulation reduces inflammation, and wherein the two or more RNAs in the composition include at least one miRNA selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7e-5p, hsa-let-7g-5p, hsa-let-7i, hsa-let-7i-5p, hsa-miR-100-5p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-106b-5p, hsa-mir-10b-5p, hsa-mir-10c-5p, hsa-mir-10d-5p, hsa-mir-10d-5p, hsa-mir-10e-5p, hsa-mir-10f-5p, hsa-mir-10g-5p, hsa-mir-10h-5p, hsa-mir-10h-5p, hsa-mir-10h-5p, hsa-mir-10h-5p, hsa-mir-10h-5p, hsa-mir-10h-5p, hsa-mir-10h-5p, hsa- 246. hsa-miR-1246, hsa-miR-125a-5p, hsa-miR-125b-5p, hsa-miR-130a-3p, hs a-mir-130b, hsa-miR-130b-3p, hsa-miR-132-3p, hsa-miR-136-5p, hsa-miR-138 -5p, hsa-miR-139-5p, hsa-mir-140, hsa-miR-140-3p, hsa-miR-145-5p, hsa-mir-146a, hsa-miR-146a-5p, hsa-miR-148a-3p, hsa-miR-152-3p, hsa-miR-15a-5p,hsa-miR-15b-5p, hsa-miR-16-1, hsa-miR-16-2, hsa-miR-16-5p, hsa-miR-17-5p, hsa-miR-181a-5p, hsa-miR-191-5p, hsa-miR-193a-5p, and hsa-miR- 193b-3p、hsa-miR-197-3p、hsa-miR-199a-3p、hsa-miR-199a-5p、hsa-miR -199b-5p、hsa-miR-19a-3p、hsa-miR-19b-3p、hsa-miR-20a-5p、hsa-miR- 203a, hsa-miR-203a-3p, hsa-miR-214-3p, hsa-mir-21, hsa-miR-21-3p, hsa-miR-21-5p, hsa-mir-221, hsa-miR-221-3p, hsa-miR-222, hsa-miR-222-3p, hsa-miR-22-3p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-miR-24-1, hsa-miR-24-2, hsa-miR-24-3p, hsa-miR-25, hsa-miR-25-3p, and hsa-miR-26 a-5p、hsa-miR-27a-3p、hsa-mir-27b、hsa-miR-27b-3p、hsa-miR-29a-3p、 hsa-miR-29c-3p、hsa-miR-30a-5p、hsa-miR-30a-5p、hsa-miR-30b-5p、hs a-miR-30c-5p, hsa-miR-30d, hsa-miR-30d-5p, hsa-miR-30e, hsa-miR-30e-5p, hsa-miR-31-3p, hsa-miR-31-5p, hsa-miR-320a, hsa-miR-342-3p, hsa-miR-345-5p, hsa-miR-34a-5p, hsa-miR-361-5p, hsa-miR-376a-3p, hsa-miR-376c-3p, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424-5p, hsa -miR-484, hsa-miR-486-1, hsa-miR-486-2, hsa-miR-486-5p, hsa-miR-570-3p, hsa-miR-574-3p, hsa-miR-663a, hsa-miR-874-3p, hsa-miR-92a-1hsa-mir-92a-2, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-mir-93, hsa-miR-93-5p, hsa-miR-940, hsa-miR-99a-5p and hsa-miR-99b-5p. ,

[0020] In one aspect, disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing an autoimmune disease, an autoinflammatory disease, an inflammatory injury caused by physical injury, an inflammatory injury caused by microbial infection, or an inflammatory injury caused by cancer in a subject, comprising administering to the subject a composition of any of the foregoing aspects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments and, together with the description, explain the disclosed compositions and methods.

[0022] Figure 1 MSC extracellular vesicle preparations are shown and were shown by RNA sequencing and quantitative PCR to be present in Effects of synthetic miRNA in IL-1β concentration (n=3 wells of cells per condition). DETAILED DESCRIPTION

[0023] Before the compounds, compositions, articles, devices and / or methods of the present invention are disclosed and described, it should be understood that they are not limited to specific synthetic methods or specific recombinant biotechnology methods unless otherwise specified, or they are not limited to specific reagents unless otherwise specified, as these can of course vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting.

[0024] A. Definition

[0025] As used in the specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a pharmaceutical carrier" includes mixtures of two or more such carriers, and the like.

[0026] Ranges can be expressed herein as from "about" a particular value and / or to "about" another particular value. When such ranges are expressed, another embodiment includes from a particular value and / or to another particular value. Similarly, when the preposition "about" is used to express a value as an approximate value, it is understood that the particular value forms another embodiment. It should also be further understood that the endpoint of each of the ranges is significantly related to the other endpoint and is independent of the other endpoint. It should also be understood that many values ​​are disclosed herein, and in addition to the value itself, each value is also disclosed herein as "about" the particular value. For example, if the value "10" is disclosed, "about 10" is also disclosed. It should also be understood that when a value is disclosed, "less than or equal to" the value, "greater than or equal to" the value, and the possible range between the values ​​are also disclosed, as appropriately understood by those skilled in the art. For example, if the value "10" is disclosed, "less than or equal to 10" and "greater than or equal to 10" are also disclosed. It should also be understood that throughout the application, data is provided in a variety of different formats, and that these data represent endpoints and starting points, as well as ranges for any combination of data points. For example, if a specific data point "10" and a specific data point 15 are disclosed, it should be understood that greater than, greater than or equal to, less than, less than or equal to, and equal to 10 and 15, and between 10 and 15 are all considered disclosed. It should also be understood that every unit between two specific units is also disclosed. For example, if 10 and 15 are disclosed, then 11, 12, 13, and 14 are also disclosed.

[0027] In this specification and the claims that follow, reference will be made to certain terms which shall be defined to have the following meanings:

[0028] "Optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and that the description includes instances where said event or circumstance occurs and instances where it does not.

[0029] "Increase" can refer to any change that results in a greater amount of a symptom, disease, component, condition, or activity. An increase can be an increase in any single number, median, or mean statistically significant amount of a condition, symptom, activity, component. Thus, an increase can be a 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% increase, as long as the increase is statistically significant.

[0030] "Reduction" can refer to any change that causes less amount of symptom, disease, composition, patient's condition or activity.When the genetic output of the gene product with this material is less relative to the output of the gene product without this material, this material is also understood to reduce the genetic output of gene.For example, reducing can be the change of disease symptoms, so that symptoms are less than previously observed.Reduction can be the reduction of any single number, median or mean of the patient's condition, symptom, activity, composition in statistically significant amount.Therefore, as long as this reduction is statistically significant, reduction can be 1,2,3,4,5,6,7,8,9,10,15,20,25,30,35,40,45,50,55,60,65,70,75,80,85,90,95 or 100% reduction.

[0031] "Inhibit," "inhibiting," and "inhibition" refer to a decrease in an activity, response, condition, disease, or other biological parameter. This can include, but is not limited to, a complete elimination of an activity, response, condition, or disease. This can also include, for example, a 10% reduction in an activity, response, condition, or disease compared to a natural or control level. Thus, the reduction can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any reduction therebetween, compared to a natural or control level.

[0032] "Reduce" or other forms of the word, such as "reducing" or "reduction", refers to a decrease in an event or characteristic (e.g., tumor growth). It will be understood that this is usually related to some standard value or expected value, in other words, it is relative, but does not always require reference to a standard value or relative value. For example, "reduce tumor growth" means reducing the growth rate of a tumor relative to a standard or control.

[0033] "Prevent" or other forms of the word, such as "preventing" or "prevention", refers to stopping a particular event or characteristic, stabilizing or delaying the development or progression of a particular event or characteristic, or minimizing the chance of a particular event or characteristic occurring. Prevention does not need to be compared to a control because it is usually more absolute than, for example, reduction. As used herein, something can be reduced but not prevented, but something that is reduced can also be prevented. Likewise, something can be prevented but not reduced, but something that is prevented can also be reduced. It should be understood that where reduction or prevention is used, unless otherwise expressly stated, the use of the other word is also expressly disclosed.

[0034] The term "subject" refers to any individual that is the target of administration or treatment. The subject can be a vertebrate, such as a mammal. In one aspect, the subject can be a human, a non-human primate, a cow, a horse, a pig, a dog, or a cat. The subject can also be a guinea pig, a rat, a hamster, a rabbit, a mouse, or a mole. Thus, the subject can be a human or a veterinary patient. The term "patient" refers to a subject that is being treated by a clinician (e.g., a surgeon).

[0035] The term "therapeutically effective" means that the amount of the composition used is sufficient to improve one or more causes or symptoms of the disease or disorder. Such improvement only requires reduction or modification, not necessarily elimination.

[0036] The term "treatment" refers to the medical management of a patient with the intent to cure, ameliorate, stabilize or prevent a disease, pathological condition or disorder. The term includes active treatment, i.e., treatment specifically directed toward amelioration of the disease, pathological condition or disorder, as well as causal treatment, i.e., treatment directed toward eliminating the cause of the relevant disease, pathological condition or disorder. In addition, the term includes palliative treatment, i.e., treatment designed to relieve symptoms rather than cure the disease, pathological condition or disorder; preventive treatment, i.e., treatment directed toward minimizing or partially or completely inhibiting the development of the relevant disease, pathological condition or disorder; and supportive treatment, i.e., treatment used to supplement another specific therapy directed toward amelioration of the relevant disease, pathological condition or disorder.

[0037] "Biocompatible" generally means that the material and any of its metabolites or degradation products are generally nontoxic to the recipient and do not cause significant adverse reactions in the subject.

[0038] "Comprising" is intended to indicate that compositions, methods, etc. include the elements listed, but do not exclude other elements. When "consisting essentially of" is used to define compositions and methods, it should be meant to include the elements listed, but exclude other elements that have any necessary significance to the combination. Therefore, a composition consisting essentially of the elements defined herein does not exclude trace contaminants and pharmaceutically acceptable carriers such as phosphate buffered saline, preservatives, etc. from separation and purification methods. "Consisting of" should be meant to exclude other ingredients beyond trace elements and substantial method steps for applying the compositions provided and / or required in the present disclosure. Embodiments defined by each of these transitional terms are within the scope of the present disclosure.

[0039] A "control" is an alternative subject or sample used in an experiment for comparison purposes. A control can be "positive" or "negative."

[0040] The "effective amount" of a medicament refers to a sufficient amount of the medicament to provide the desired effect. The "effective" amount of the medicament varies from subject to subject, depending on many factors, such as the age and general condition of the subject, specific one or more medicaments, etc. Therefore, it is not always possible to specify a quantitative "effective amount". However, a person of ordinary skill in the art can use routine experiments to determine the appropriate "effective amount" in any subject case. In addition, as used herein, unless otherwise explicitly stated, the "effective amount" of a medicament can also refer to the amount covering the therapeutically effective amount and the preventive effective amount. The "effective amount" of the medicament required to achieve the therapeutic effect may vary due to factors such as the age, sex, and weight of the subject. The dosage regimen can be adjusted to provide the best therapeutic response. For example, several divided doses can be administered daily, or the dosage can be reduced proportionally according to the urgency of the treatment situation.

[0041] A "pharmaceutically acceptable" component may refer to a component that is not a biological or other undesirable component, i.e., the component may be incorporated into a pharmaceutical preparation provided by the present disclosure and administered to a subject as described herein without causing significant undesirable biological effects or interacting in a harmful manner with any of the other components in the preparation containing the component. When used for administration to humans, the term generally means that the component has met the required standards for toxicology and manufacturing testing, or it is included in the Inactive Ingredient Guide established by the U.S. Food and Drug Administration.

[0042] A "pharmaceutically acceptable carrier" (sometimes referred to as a "vehicle") refers to a carrier or excipient that can be used to prepare a generally safe and non-toxic pharmaceutical or therapeutic composition, and includes carriers for veterinary and / or human pharmaceutical or therapeutic use. The term "vehicle" or "pharmaceutically acceptable carrier" may include, but is not limited to, phosphate buffered saline, water, emulsions (such as oil / water or water / oil emulsions), and / or various types of wetting agents. As used herein, the term "vehicle" includes, but is not limited to, any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations and as further described herein.

[0043] For example, the "pharmacological activity" (or simply "activity") in a "pharmacologically active" derivative or analog may refer to a derivative or analog (e.g., salts, esters, amides, conjugates, metabolites, isomers, fragments, etc.) that has the same type and degree of pharmacological activity as the parent compound.

[0044] "Therapeutic agent" refers to any composition having a beneficial biological effect. Beneficial biological effects include therapeutic effects (e.g., treating a disorder or other undesirable physiological condition) and preventive effects (e.g., preventing a disorder or other undesirable physiological condition (e.g., non-immunogenic cancer)). The term also encompasses pharmaceutically acceptable pharmacologically active derivatives of the beneficial agents specifically mentioned herein, including but not limited to salts, esters, amides, prodrugs, active metabolites, isomers, fragments, analogs, and the like. When the term "therapeutic agent" is used, or when a specific agent is specifically identified, it should be understood that the term includes the agent itself as well as pharmaceutically acceptable pharmacologically active salts, esters, amides, prodrugs, conjugates, active metabolites, isomers, fragments, analogs, and the like.

[0045] A "therapeutically effective amount" or "therapeutically effective dose" of a composition (e.g., a composition comprising a medicament) refers to an amount that effectively achieves a desired therapeutic outcome. In some embodiments, the desired therapeutic outcome is to control type I diabetes. In some embodiments, the desired therapeutic outcome is to control obesity. The therapeutically effective amount of a given therapeutic agent will typically vary according to factors such as the type and severity of the disorder or disease being treated and the age, sex, and weight of the subject. The term can also refer to the amount of the therapeutic agent or the delivery rate (e.g., amount that varies over time) of the therapeutic agent that effectively promotes a desired therapeutic effect (such as, pain relief). The precise desired therapeutic effect will vary according to the disorder to be treated, the tolerance of the subject, the medicament to be administered and / or the medicament preparation (e.g., the efficacy of the therapeutic agent, the concentration of the medicament in the preparation, etc.), and various other factors understood by those of ordinary skill in the art. In some cases, a desired biological or medical response is achieved after multiple doses of the composition are administered to the subject over a period of days, weeks, or years.

[0046] Throughout this application, reference is made to various publications. The disclosures of these publications are hereby incorporated by reference into this application in order to more fully describe the current state of the art to which this application belongs. The disclosed references are also individually and specifically incorporated herein by reference, and the materials contained therein are discussed in the sentences citing the references.

[0047] B. Composition

[0048] Components for preparing the disclosed compositions and the compositions themselves used in the methods disclosed herein are disclosed. These and other materials are disclosed herein, and it should be understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed, although specific references to each various individual and collective combinations and arrangements of these compounds may not be explicitly disclosed, each case is specifically contemplated and described herein. For example, if a specific composition comprising one or more secretomes and two or more ribonucleic acids (RNAs) is disclosed and discussed, and a variety of modifications that can be made to a number of molecules including compositions comprising one or more secretomes and two or more ribonucleic acids (RNAs) are discussed, then specifically contemplated are each and every combination and arrangement of compositions comprising one or more secretomes and two or more ribonucleic acids (RNAs) and possible modifications, unless otherwise explicitly stated. Thus, if examples of a class of molecules A, B, and C and a class of molecules D, E, and F and a combination molecule AD are disclosed, then each is considered individually and collectively even if each is not listed individually, meaning that the combinations AE, AF, BD, BE, BF, CD, CE, and CF are considered disclosed. Likewise, any subset or combination of these is also disclosed. Thus, for example, a subgroup of AE, BF, and CE would be considered disclosed. This concept applies to all aspects of this application, including, but not limited to, steps in methods of making and using the disclosed compositions. Thus, if various additional steps can be performed, it should be understood that each of these additional steps can be performed using any specific embodiment or combination of embodiments of the disclosed methods.

[0049] Mesenchymal stem / stromal cells (MSCs) modify the body's immune response primarily through the secretion of a combination of soluble factors, extracellular matrix, and extracellular vesicles (EVs). EVs contain proteins and RNA molecules that modulate pro- and anti-inflammatory signaling pathways in immune cells (neutrophils, monocytes, macrophages, dendritic cells, B cells, T cells, natural killer (NK) cells, etc.). Bacterial and viral pathogens have evolved strategies to manipulate the natural immune response to their advantage. For example, bacteria and viruses are able to induce interleukin 10 (IL-10), a major anti-inflammatory cytokine that leads to immunosuppression, allowing pathogens to increase their infection efficiency and replication rate. In this instance, we suggest that supplementation of non-engineered EV therapeutics of natural origin at the appropriate time, as well as engineered synthetic miRNAs, RNAi, or proteins targeting molecules such as IL-10 (which enable persistent infection), could result in a more favorable solution to hyper- or hypo-immune disease states.

[0050] In other cases, patients may have genetically related immune response defects that may reduce the efficacy of secreted factors and extracellular vesicles in naturally derived therapeutics. These defects may represent defects in immune regulatory signaling molecules or their receptors. Using IL-10 as an example again, when IL-10 is inhibited, individuals with autoimmune propensity produce autoimmune responses after microbial challenge (Gazzinelli et al.). To counteract this, we propose that additional supplementation with appropriately engineered IL-10 regulatory RNA or protein will drive a stronger immune response effect than naturally derived therapeutics alone. This treatment strategy may simultaneously allow for full compensation of genetically dysregulated immune function in patients with autoimmune propensity.

[0051] In the above cases, the use and / or delivery of therapeutic EVs / secreted factors along with other engineered molecules to patients allows for precisely tailored immunotherapy that cannot be achieved by delivering the individual components alone. Thus, by adding synthetic biomolecules to naturally derived EV / secreted factor-based therapies, customized, tuned effects can be achieved, thereby improving efficacy in a wider patient population.

[0052] In one aspect, disclosed herein are compositions comprising one or more secretomes (such as, for example, liposomes, lipid nanoparticles, or mesenchymal stem cell (MSC)-derived exosomes or extracellular vesicles, or any combination thereof) and two or more ribonucleic acids (RNAs) (such as, for example, microRNA (miRNA), messenger RNA (mRNA), long non-coding RNA (lncRNA), y-RNA and / or pi-RNA).

[0053] As described throughout, the compositions disclosed herein can utilize liposomes, lipid nanoparticles, and exosomes and / or extracellular vesicles derived from mesenchymal stem cells (MSCs), or any combination thereof. Although existing autologous and allogeneic MSCs are contained in bone marrow concentrates or adipose-derived stromal vascular fractions (SVFs), or various postpartum products from the umbilical cord, placenta, or amniotic membrane, expanded MSC cultures are currently being used to treat wounds, orthopedic pathologies, and spinal pathologies; existing treatments do not contain a large amount of the MSC secretome (including, but not limited to, growth factors, cytokines, chemokines, exosomes, extracellular vesicles, and / or extracts).

[0054] MSC is a multipotent cell that can be differentiated into multiple cell types, and the cell type includes myocyte, chondrocyte, adipocyte and osteoblast. Generally, these cells can be found in the following: placenta, cord blood, adipose tissue, bone marrow or amniotic fluid, including perivascular tissue. As used herein, "MSC" refers to non-terminal differentiated cells, including but not limited to multipotent stem cells, multipotent stromal cells, stromal vascular cells, pericytes, vascular pericytes, stromal cells, multipotent cells, multipotent cells, adipose-derived fibroblast-like cells, adipose-derived stromal vascular fraction, adipose-derived MSC, bone marrow-derived fibroblast-like cells, bone marrow-derived stromal vascular fraction, bone marrow-derived MSC, tissue-derived fibroblast-like cells, adult stem cells, adult stromal cells, keratinocytes and / or melanocytes.

[0055] It has long been recognized that MSC, in addition to its differentiation potential, also has the immunomodulatory ability to cause the expression of many different cytokines and growth factors. As used herein, "MSC preparation" or "MSC secretome composition" refers to a composition comprising a cell-free extract of MSC growth factors, MSC exosomes, extracellular vesicles or MSC or a MSC lysate obtained from human MSC, fibroblast-like cells and non-human animal MSC (including but not limited to MSC from horses, cattle, pigs, sheep, non-human primates, dogs, cats, rabbits, rats and mice). In an embodiment, MSC can be derived from a patient (autologous) to whom the composition will be applied or from another individual (allogeneic). MSC can be cultured and expanded to collect conditioned medium or increase the cell number of lysate or freshly used before being incorporated into the composition of the present disclosure.

[0056] MSC secretome compositions (including but not limited to compositions comprising MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) may comprise from about 0.00001 to about 20 wt.%, such as from about 0.01 to about 10 wt.% of mesenchymal stem cell (MSC) extracts, MSC exosomes or MSC growth factor preparations. The MSC preparation may comprise MSC conditioned medium or MSC lysates from MSCs expanded in cell culture. In some embodiments, the composition may further comprise from about 0.01 to about 10 wt.% of a cell-free medium conditioned by the growth of MSC or MSC lineage cells, wherein the cells are cultured under normal hyperoxic culture conditions or under artificial wound healing conditions.

[0057] As disclosed herein, MSCs used to produce the disclosed MSC additives (including growth factor secretome compositions frozen or powdered additives) can be selectively stimulated to produce MSC growth factors, secretomes, cytokines, chemokines, mesenchymal stem cell proteins, peptides, glycosaminoglycans, extracellular matrix (ECM), proteoglycans, secretomes, and exosomes. As used herein, MSC growth factors include, but are not limited to, prostaglandin E2 (PGE2), transforming growth factor β1 (TGF-β1), hepatocyte growth factor (HGF), stromal cell derived factor-1 (SDF-1), nitric oxide, indoleamine 2,3-dioxygenase, interleukin-4 (IL-4), IL-6, interleukin-10 (IL-10), IL-1 receptor antagonist and soluble TNF-α receptor, insulin-like growth factor, fibroblast growth factor (FGF) 1-23 (especially These are FGF1 and FGF2), bone morphogenetic proteins (BMP) 1-15, epidermal growth factor (EGF), transforming growth factor-α (TGF-α) macrophage stimulating protein (MSP), platelet-derived growth factor (PLGF), vascular endothelial growth factor (VEGF), macrophage colony stimulating factor (M-CSF), insulin, granulocyte colony stimulating factor (G-CSF), granulocyte macrophage colony stimulating factor (GM-CSF), and hormones including estrogen and thyroid hormone.

[0058] In one aspect, an MSC preparation (such as, for example, an MSC secretome composition) includes MSC growth factors, MSC exosomes and / or a cell extract of MSC or an MSC lysate obtained from MSC cultured under standard hyperoxic culture conditions (e.g., 21% oxygen) or MSC cultured under artificial wound healing conditions (such as, for example, 0.1% to about 5% oxygen in the presence of inflammatory cytokines, angiogenic factors, and reduced glucose).

[0059] As disclosed herein, artificial wound healing conditions simulate growth conditions in real wounds, where reduced nutrient supply and reduced waste removal are typically caused by disruption of local blood circulation. This creates a hostile environment for cells until new blood vessels are generated and blood circulation is restored. Thus, artificial wound healing conditions for culturing MSCs can include one or more of the following growth conditions: reduced glucose availability, reduced oxygen tension, reduced pH, and increased temperature.

[0060] On the one hand, glucose availability can be reduced relative to a normal control. The glucose of the modified culture medium that reduces glucose but does not damage the cells can be reduced by 0 to 50%, and more preferably the glucose is reduced by about 5% to 40%. For example, MSC artificial wound healing culture conditions can include glucose reduction of about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 10 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49% or 50%, such as a glucose reduction of about 5% to about 15%, about 10% to about 20%, about 15% to about 25%, about 20% to about 30%, or about 25% to about 35%.

[0061] In one aspect, oxygen tension can be reduced to the oxygen level of hypoxic conditions. Normal atmospheric oxygen is about 21%, and any reduction is considered hypoxia. Therefore, in one aspect, MSCs can be cultured at 0.0% to 20.9% oxygen, from about 0.1% to about 0.5% oxygen, from about 0.1% to about 2.0%, from about 0.1% to about 5.0% oxygen, from about 0.5% to 5.0%, from about 1.0% to about 10% oxygen, from about 5.0% to about 10.0% oxygen; and cultured at about 10.0% to about 15.0% under artificial wound healing conditions. Preferably, during MSC wound healing culture conditions, the oxygen tension is between about 0.5% and 20.5%, such as, for example, 0%, 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.7%, 1.9%, 2.0%, 2.1%, 2.2%, 2. 3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3.0%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, 4.0%, 4.1%, 4.2%, 4.3%, 4.4%, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, 5.0%, 5.1%, 5.2%, 5.3%, 5.4%, 5.5%, 5. 6%, 5.7%, 5.8%, 5.9%, 6.0%, 6.1%, 6.2%, 6.3%, 6.4%, 6.5%, 6.6%, 6.7%, 6.8%, 6.9%, 7.0%, 7.1%, 7.2%, 7.3%, 7.4%, 7.5%, 7.6%, 7.7%, 7.8%, 7.9%, 8.0%, 8.1%, 8.2%, 8.3%, 8.4%, 8.5%, 8.6%, 8.7%, 8.8%, 8. %, 18%, 18.5%, 19%, 19.5%, 20%, or 20.5% oxygen.

[0062] Under artificial wound healing conditions, pH may also decrease. Physiological pH is maintained very strictly, usually very close to neutral pH=7.2±0.2 (7.0–7.4). However, in a wound, an acidic environment may have pH=6.2±0.2 (i.e., pH is from 6.0 to about 6.4). Therefore, under artificial wound healing culture conditions, pH may be from about 6.0 to about 7.4, for example, from 6.0 to about 6.4, from about 6.2 to about 6.4, from about 6.2 to about 6.6, from about 6.4 to about 6.6, from about 6.4 to about 6.8, or from about 6.6 to about 7.0, such as 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3 or 7.4.

[0063] Under artificial wound healing culture conditions, the temperature of the culture environment can be increased to simulate the temperature rise of the wound site. The physiological steady-state temperature is maintained at 37 ° C (98.6 ° F). Slight increase or reduction will cause significant changes in cell metabolism. By increasing the temperature from higher than 37 ° C to any temperature up to about 40 ° C (104 ° F), a "heat" environment can be produced. Therefore, in one aspect, the artificial wound healing culture conditions of MSC can include from about 35 ° C to about 39 ° C, from about 35 ° C to about 36 ° C, from about 36 ° C to about 37 ° C, from about 37 ° C to about 38 ° C, from about 38 ° C to about 39 ° C, from about 39 ° C to about 40 ° C. In one aspect, the temperature of the artificial wound healing culture can be 35.0°C, 35.1°C, 35.2°C, 35.3°C, 36.4°C, 35.5°C, 35.6°C, 35.7°C, 35.8°C, 35.9°C, 36.0°C, 36.1°C, 36.2°C, 36.3°C, 36.4°C, 36.5°C, 36.6°C, 36.7°C, 36.8°C, 36.9°C, 37.0°C, 37.1°C, 37.2°C, 37.3°C , 37.4°C, 37.5°C, 37.6°C, 37.7°C, 37.8°C, 37.9°C, 38.0°C, 38.1°C, 38.2°C, 38.3°C, 38.4°C, 38.5°C, 38.6°C, 38.7°C, 38.8°C, 38.9°C, 39.0°C, 39.1°C, 39.2°C, 39.3°C, 39.4°C, 39.5°C, 39.6°C, 39.7°C, 39.8°C, 39.9°C or 40.0°C.

[0064] The combined environment of reduced nutrition and metabolites (artificial wound healing) can trigger cultured cells to produce wound healing and anti-inflammatory ECM proteins and growth factors and extracellular vesicles, which can guide tissue healing, which can be in the form of new ECM proteins, such as collagen and glycosaminoglycans (GAGs) and growth factors and cytokines. Therefore, it can be understood and envisioned herein that by adjusting cell growth conditions, such as cell confluence, culture medium supplements, nutritional supplements, oxygen levels, length of culture time under those conditions, number of cell passages, or a combination of those conditions, MSCs can be stimulated to selectively secrete desired anti-inflammatory proteins, peptides, cytokines, chemokines, glycosaminoglycans, extracellular matrix (ECM), proteoglycans, exosomes, and secretomes.

[0065] In one aspect, it is understood and contemplated herein that growth conditions such as temperature, oxygen tension, pH, glucose saturation, confluence, and growth surface can affect gene expression and protein production by cells grown in culture, which can result in the production of different growth factors and cytokines. For example, growth surface stiffness (Young's modulus) affects gene expression and protein production by cells grown thereon. Adipocytes and chondrocytes are generally maintained on softer, more elastic growth surfaces (~10 kPa–12 kPa), while osteocytes grow better on hard surfaces (~10 6 –12 6 kPa). By adjusting the surface hardness, the secretome of cells and their communication signals (growth factors, exosomes, cytokines and chemokines) can be affected.

[0066] In one aspect, the secretome composition (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) may further include a protective coating (such as, for example, cryoprotectant oligosaccharides and protein solutions) to reduce degradation of the growth factors. It is understood and contemplated herein that the protective coating may be engineered as a polymer. "Polymer" refers to a relatively high molecular weight organic compound, natural or synthetic, whose structure may be represented by repeating small unit monomers. Non-limiting examples of polymers include polyethylene, rubber, cellulose. Synthetic polymers are generally formed by addition or condensation polymerization of monomers. The term "copolymer" refers to a polymer formed by two or more different repeating units (monomer residues). By way of example and not limitation, the copolymer may be an alternating copolymer, a random copolymer, a block copolymer, or a graft copolymer. It is also contemplated that, in certain aspects, the individual blocks of a block copolymer may themselves comprise a copolymer. The term "polymer" encompasses all forms of polymers, including but not limited to natural polymers, synthetic polymers, homopolymers, heteropolymers or copolymers, addition polymers, and the like. In one aspect, the gel matrix can include copolymers, block copolymers, diblock copolymers, and / or triblock copolymers.

[0067] In one aspect, the protective coating may include a biocompatible polymer. In one aspect, the biocompatible polymer may be cross-linked. Biocompatible polymers used herein include, but are not limited to, polysaccharides; hydrophilic polypeptides; polyamino acids such as poly-L-glutamic acid (PGS), γ-polyglutamic acid, poly-L-aspartic acid, poly-L-serine, or poly-L-lysine; polyalkylene glycols and polyalkylene oxides such as polyethylene glycol (PEG), polypropylene glycol (PPG), and polyethylene oxide (PEO); poly(oxyethylated polyols); polyenols; polyvinyl pyrrolidone); poly(hydroxyalkyl methacrylamide); poly(hydroxyalkyl methacrylate); polysaccharides; poly(hydroxy acids); poly(vinyl alcohol), polyhydroxy acids such as poly(lactic acid), polyglycolic acid, and polylactic-glycolic acid copolymers; polyhydroxyalkanoic acids Esters such as poly 3-hydroxybutyrate or poly 4-hydroxybutyrate; polycaprolactone; poly(orthoesters); polyanhydrides; poly(phosphazenes); polylactide-caprolactone copolymers; polycarbonates such as tyrosine polycarbonate; polyamides (including synthetic and natural polyamides), polypeptides and poly(amino acids); polyesteramides; polyesters; poly(p-dioxanone); poly(alkylene alkylates); hydrophobic polyethers; polyurethanes; polyetheresters; polyacetals; polycyanoacrylates; polyacrylates; polymethyl methacrylate; polysiloxanes; poly(oxyethylene) / poly(oxypropylene) copolymers; polyketals; polyphosphates; polyhydroxyvalerates; polyalkylene oxalates; polyalkylene succinates; poly(maleic acid) and copolymers thereof.Biocompatible polymers can also include polyamides, polycarbonates, polyalkylenes, polyalkylene glycols, polyalkylene oxides, polyalkylene terephthalates, polyvinyl alcohol (PVA), methacrylate PVA (m-PVA), polyvinyl ethers, polyvinyl esters, polyvinyl halides, polyvinyl pyrrolidone, polyglycolides, polysiloxanes, polyurethanes and copolymers thereof, alkyl celluloses, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, nitrocelluloses, polymers of acrylates and methacrylates, methyl cellulose, ethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methyl cellulose, hydroxybutyl methyl cellulose, cellulose acetate, cellulose propionate, cellulose acetate butyrate, cellulose acetate phthalate, carboxyethyl cellulose, cellulose triacetate, cellulose sulfate sodium salt, poly(methyl methacrylate), poly(ethyl methacrylate), poly(butyl methacrylate), poly(isobutyl methacrylate), poly(hexyl methacrylate), poly(isodecyl methacrylate), poly(

[0013] The biodegradable polymers include polyesters, poly(orthoesters), polyvinylamines, poly(caprolactones), poly(hydroxybutyrates), poly(hydroxyvalerates), polyanhydrides, poly(acrylic acids), polyglycolides, poly(urethanes), polycarbonates, polyphosphates, polyphosphazenes, derivatives thereof, linear and branched copolymers and block copolymers thereof, and mixtures thereof.

[0068] In some embodiments, the protective coating comprises carbohydrate structures of monosaccharides and carbohydrate polymers (such as disaccharides or polysaccharides, including but not limited to non-reducing polysaccharides or disaccharides and any combination thereof). Examples of carbohydrates that can be used in the protective coating include glucose, aldoses (D-allose, D-altrose, D-mannose, etc.), pyranose glucose, pentahydroxyhexanal, α-D-pyranose glucopyranosyl-D-glucose, α-D-pyranose glucopyranosyl-dihydrate, polymers of β-D-pyranose glucopyranosyl units, β-D-fructofuranosyl α-D-pyranose glucoside (anhydrous / dihydrate), β-D-galactopyranosyl-D-glucose, α-D-pyranose glucopyranosyl-dihydrate, polymers of β-D-pyranose glucopyranosyl units, β-D-fructofuranosyl α-D-pyranose glucoside (anhydrous / dihydrate), β-D-galactopyranosyl-D-glucose, α-D-pyranose glucopyranosyl- Glucosyl-α-D-pyranoglucopyranoside (anhydrous / dihydrate), galactose, pentoses (ribose, xylose, lyxose), dextrose, dodecahydrate, fructose, sucrose, lactose, maltose, trehalose, agarose, D-galactosyl-β-(1-4)-anhydro-L-galactosyl, cellulose, polymers of β-D-pyranoglucopyranosyl units and starch, as well as polyhydroxy alcohols, polyols, sugar alcohols, erythritol, glycol, glycerol, xylitol and sorbitol.

[0069] In some embodiments, the protective coating contains a biocompatible and / or biodegradable polyester or polyanhydride, such as poly(lactic acid), poly(glycolic acid), and poly(lactic-co-glycolic acid). The particles may include one or more of the following polyesters: homopolymers comprising glycolic acid units (referred to herein as "PGA"), and lactic acid units (such as poly-L-lactic acid, poly-D-lactic acid, poly-D,L-lactic acid, poly-L-lactide, poly-D-lactide, and poly-D,L-lactide 5, collectively referred to herein as "PLA"), and caprolactone units (such as poly(e-caprolactone)), collectively referred to herein as "PCL"); and copolymers comprising lactic acid and glycolic acid units, such as various forms of poly(lactic-co-glycolic acid) and poly(lactide-co-glycolide), characterized by a ratio of lactic acid:glycolic acid, collectively referred to herein as "PLGA"; and polyacrylates and their derivatives. Exemplary polymers also include copolymers of polyethylene glycol (PEG) and the above polyesters, such as various forms of PLGA-PEG or PLA-PEG copolymers, collectively referred to herein as "PEGylated polymers". In certain embodiments, the PEG region can be covalently associated with the polymer via a cleavable linker to produce a "PEGylated polymer". In one aspect, the polymer comprises at least 60%, 65%, 70%, 75%, 80%, 85%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% acetal side groups.

[0070] The triblock copolymers disclosed herein include the following core polymers: for example, polyethylene glycol (PEG), polyvinyl acetate, polyvinyl alcohol, polyvinyl pyrrolidone (PVP), polyethylene oxide (PEO), polyvinyl pyrrolidone-vinyl acetate copolymer, polymethacrylate, polyoxyethylene alkyl ether, polyoxyethylene castor oil, polycaprolactam, polylactic acid, polyglycolic acid, poly(lactic acid-glycolic acid), polylactic acid-glycolic acid copolymer (PLGA), cellulose derivatives such as hydroxymethyl cellulose, hydroxypropyl cellulose, etc.

[0071] Examples of diblock copolymers that can be used in the protective coating disclosed herein include polymers such as, for example, polyethylene glycol (PEG), polyvinyl acetate, polyvinyl alcohol (PVA), polyvinyl pyrrolidone (PVP), polyethylene oxide (PEO), polyvinyl pyrrolidone-vinyl acetate copolymer, polymethacrylate, polyoxyethylene alkyl ether, polyoxyethylene castor oil, polycaprolactam, polylactic acid, polyglycolic acid, poly(lactic acid-glycolic acid), polylactic acid-glycolic acid copolymer (PLGA).

[0072] In one aspect, the protective coating comprises (i.e., encapsulated, the encapsulated composition may further comprise lecithin or hydrolyzed lecithin as a carrier or as an encapsulating material. As used herein, lecithin and / or hydrolyzed lecithin coatings include coatings comprising phosphatidylcholine, phosphatidylinositol, phosphatidylethanolamine, phosphatidylserine, and phosphatidic acid. The source of lecithin may be plant or animal.

[0073] In one aspect, any of the polymers, monosaccharides, disaccharides or polysaccharides used to form a protective coating by placing the MSC additive in the encapsulation solution can be in a suitable concentration to form a protective coating. For example, the polymer, monosaccharide, disaccharide or polysaccharide can be in any concentration between 0.01 mM and 10.0 M concentration, such as from about 0.01 M to about 0.1 M, from about 0.1 mM to about 1.0 M, from about 1.0 M to about 10.0 M. Exemplary concentrations include 0.01 mM, 0.02 mM, 0.03 mM, 0.04 mM, 0.05 mM, 0.06 mM, 0.07 mM, 0.08 mM, 0.09 mM, 0.1 mM, 0.2 mM, 0.3 mM, 0.4 mM, 0.4 mM, 0.6 mM, 0.7 mM, 0.8 mM, 0.9 mM, 1 mM, 2 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, 100 mM, 110 mM, M, 120mM, 130mM, 140mM, 150mM, 160mM, 170mM, 180mM, 190mM, 200mM, 225mM, 250mM, 275mM, 300mM, 325mM, 350mM, 375mM, 400mM, 450m M, 500mM, 600mM, 700mM, 800mM, 900mM, 1M, 1.1M, 1.2M, 1.3M, 1.4M, 1.5M, 1.6M, 1.7M, 1.8M, 1.9M, 2M, 3M, 4M, 5M, 6M, 7M, 8M, 9M, 10M.

[0074] The disclosed compositions achieve most of their inflammation-modulating abilities by including two or more ribonucleic acid molecules (e.g., microRNA (miRNA), messenger RNA (mRNA), long noncoding RNA (lncRNA), y-RNA, and / or pi-RNA). Examples of RNA that can be used in the disclosed compositions include, but are not limited to, hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7e-5p, hsa-let-7g-5p, hsa-let-7i, hsa-let-7i-5p, hsa-miR-100-5p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-106b-5p, hsa-mir-10b, hsa-miR-10b-5p, hsa-mir-10c-5p, hsa-miR-10d ... a-mir-1246, hsa-miR-1246, hsa-miR-125a-5p, hsa-miR-125b-5p, hsa-miR-130a-3p, hsa-mir-130b, hsa-miR-130b-3p, hsa-miR-13 2-3p, hsa-miR-136-5p, hsa-miR-138-5p, hsa-miR-139-5p, hsa-mir-140, hsa-miR-140-3p, hsa-miR-145-5p, hsa-mir-146a, hsa-miR -146a-5p, hsa-miR-148a-3p, hsa-miR-152-3p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-mir-16-1, hsa-mir-16-2, hsa-miR-16-5p, h sa-miR-17-5p, hsa-miR-181a-5p, hsa-miR-191-5p, hsa-miR-193a-5p, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-199a-3p, hsa-m iR-199a-5p, hsa-miR-199b-5p, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-20a-5p, hsa-miR-203a, hsa-miR-203a-3p, hsa-miR-21 4-3p, hsa-mir-21, hsa-miR-21-3p, hsa-miR-21-5p, hsa-mir-221, hsa-miR-221-3p, hsa-mir-222, hsa-miR-222-3p, hsa-miR-22-3p,hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-miR-24-1, hsa-miR-24-2, hsa-miR-24-3p, hsa-miR-25, hsa-miR-25-3p, hsa-miR-26a-5p, hsa-miR-27a-3p, hsa-miR-27b, hsa-miR-27b-3p, hsa-miR-29a-3p, hsa-miR-29c-3p, hsa-miR-30a-5p, hsa-miR-30a-5p, hsa-miR-30b-5p, hsa-miR-30c-5p, hsa-miR- 30d、hsa-miR-30d-5p、hsa-mir-30e、hsa-miR-30e-5p、hsa-miR-31-3p、hs a-miR-31-5p、hsa-miR-320a、hsa-miR-342-3p、hsa-miR-345-5p、hsa-miR- 34a-5p, hsa-miR-361-5p, hsa-miR-376a-3p, hsa-miR-376c-3p, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424-5p, hsa-miR-484, hsa-miR-486-1 hsa-mir-486-2, hsa-miR-486-5p, hsa-miR-570-3p, hsa-miR-574-3p, hsa-miR-663a, hsa-miR-874-3p, hsa-mir-92a-1, hsa-mir-92a-2, hsa-miR-92 a-3p、hsa-miR-92b-3p、hsa-mir-93、hsa-miR-93-5p、hsa-miR-940、hsa-m iR-99a-5p、hsa-miR-99b-5p、HBII-202、U26、U29、HBII-420、U30、U18A、U81 、GSKIP、IFT88、PCDH11X、PCDH11Y、KIAA0226L、PDE11A、PHACTR1、TEX14、DC UN1D2、SIM1、FILIP1、FAM107B、CHADL、ZNF365、MNAT1、CYSTM1、GAS7、HOXB7、 ASTN2、LGR5、ZFHX3、MCM7、GRIK1、MAP2、LHFPL3、PTER、STAMBP、CCDC135、PAX 9、RPL13、ABCA13、DAAM1、OPN1LW、OPN1MW2、CNOT6L、MTRNR2L10、SMC4、RPL4、PSAP, ASIC4, AHCYL1, RD3L, SIGLEC1, SYCE2, NANS, LOC100129335-5, ZNF238, CADM2-7, SALL1-6, VWA5A, RF 00019.441, RF00019.451, RF00019.621, RF00019.646, RF00019.413, piR-33044, piR-33043, piR-31703, RNY4, LOC441666, SNHG1, RNU11, LOC80154, LOC727751, LOC388152, GOLGA2P2Y, GOLGA2P3Y, SNHG12, RNU12 , ASMTL-AS1, LOC284454U2: RF00004.39, U2: RF00004.22, U2: RF00004.35, U2: RF00004.71, U2: RF00004.66 U2: RF00004.91, U2: RF00004.89, U2: RF00004.67, U1: RF00003.5, U1: RF00003.109, U1: RF00003 .110, U1: RF00003.8, U1: RF00003.3, U1: RF00003.6, U1: RF00003.38, U1: RF00003.20, U1: RF0000 3.24, U1: RF00003.73, U1: RF00003.11, U1: RF00003.27, U1: RF00003.40, U1: RF00003.107, U1: R F00003.62, U1: RF00003.45, U1: RF00003.116, U1: RF00003.126, U1: RF00003.81, U1: RF00003.10 0. U1: RF00003.57, U1: RF00003.95, U1: RF00003.31, U1: RF00003.61, U1: RF00003.25, U1: RF000 03.90, U1: RF00003.46, U1: RF00003.123, U2: RF00004.42, U2: RF00004.61, U2: RF00004.51, U1: R F00003.122, U1: RF00003.22, U1: RF00003.9, snoMBII-202: RF00324.2, let-7: RF00027.7, U2: R F00004.75, U1: RF00003.69, U2: RF00004.88, U12: RF00007.1, U7: RF00066.141, U1: RF00003.85,In some aspects, at least one of the two or more RNAs may comprise an antisense RNA. Examples of antisense RNAs that can be used in the disclosed compositions include, but are not limited to, UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6GALC51, ABCA41, and ALPK11. 1, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1, GAGE2D: copy 21, ANKRD5-1, ZNF236-1, ACP1, EPHA1-AS1, FLJ45974, ANKRD30BP2, LINC00340, GRIK1-AS1, LOC440300, CSPG4P8, ADARB2-AS1, MLLT4-AS1, and / or HNRNPU-AS1. Thus, in one aspect, disclosed herein is a composition comprising one or more secretomes and two or more RNAs, wherein the two or more RNAs include at least one miRNA selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7e-5p, hsa-let-7g-5p, hsa-let-7i, hsa-let-7i-5p, hsa-miR-100-5p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-106b-5p, hsa-mir-10b, hsa-miR-10b-5p, hsa-mir-1246, hsa-miR-1246,hsa-miR-125a-5p、hsa-miR-125b-5p、hsa-miR-130a-3p、hsa-mir-130b、h sa-miR-130b-3p、hsa-miR-132-3p、hsa-miR-136-5p、hsa-miR-138-5p、hs a-miR-139-5p, hsa-miR-140, hsa-miR-140-3p, hsa-miR-145-5p, hsa-miR-146a, hsa-miR-146a-5p, hsa-miR-148a-3p, hsa-miR-152-3p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-miR-16-1, hsa-miR-16-2, hsa-miR-16-5p, hsa-miR-17-5p, hsa-miR-181a-5p, hsa-miR-191-5p, hsa-miR-193a-5p, hsa -miR-193b-3p、hsa-miR-197-3p、hsa-miR-199a-3p、hsa-miR-199a-5p、hs a-miR-199b-5p、hsa-miR-19a-3p、hsa-miR-19b-3p、hsa-miR-20a-5p、hsa- miR-203a, hsa-miR-203a-3p, hsa-miR-214-3p, hsa-mir-21, hsa-miR-21-3p, hsa-miR-21-5p, hsa-mir-221, hsa-miR-221-3p, hsa-miR-222, hsa-miR-222-3p, hsa-miR-22-3p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-mir-24-1, hsa-mir-24-2, hsa-miR-24-3p, hsa-mir-25, hsa-miR-25-3p, and hsa-miR -26a-5p、hsa-miR-27a-3p、hsa-mir-27b、hsa-miR-27b-3p、hsa-miR-29a- 3p、hsa-miR-29c-3p、hsa-miR-30a-5p、hsa-miR-30a-5p、hsa-miR-30b-5p、 hsa-miR-30c-5p、hsa-mir-30d、hsa-miR-30d-5p、hsa-mir-30e、hsa-miR- 30e-5p、hsa-miR-31-3p、hsa-miR-31-5p、hsa-miR-320a、hsa-miR-342-3p、hsa-miR-345-5p, hsa-miR-34a-5p, hsa-miR-361-5p, hsa-miR-376a-3p, hsa-miR-376c-3p, hsa-miR-423-3 p, hsa-miR-423-5p, hsa-miR-424-5p, hsa-miR-484, hsa-mir-486-1, hsa-mir-486-2, hsa-miR-486-5p, hsa -miR-570-3p, hsa-miR-574-3p, hsa-miR-663a, hsa-miR-874-3p, hsa-mir-92a-1, hsa-mir-92a-2, hsa-miR -92a-3p, hsa-miR-92b-3p, hsa-mir-93, hsa-miR-93-5p, hsa-miR-940, hsa-miR-99a-5p and hsa-miR-99b-5p. Preferably, disclosed herein is a composition, wherein the two or more RNAs include at least one miRNA selected from the group consisting of miR-92a-3p, let-7i-5p, miR-16-5p, miR-93-5p, miR-21-5p, miR-214-3p, miR-29c-3p, miR-34a-5p, mir-203a-3p, miR-27b-3p, miR-140-3p, miR-24-3p, miR-222-3p, miR-25-3p, miR-10b-5p, miR-221-3p, miR-17-5p, miR-30a-5p, and miR-30d-5p.

[0075] Also disclosed herein are compositions comprising one or more secretomes and two or more RNAs, wherein the two or more RNAs include at least one mRNA selected from the group consisting of HBII-202, U26, U29, HBII-420, U30, U18A, U81, GSKIP, IFT88, PCDH11X, PCDH11Y, KIAA0226L, PDE11A, PHACTR1, TEX14, DCUN1D2, SIM1, FILIP1, FAM107B, CHADL, ZNF3 65. MNAT1, CYSTM1, GAS7, HOXB7, ASTN2, LGR5, ZFHX3, MCM7, GRIK1, MAP2, LHFPL3, PTER, STAMBP, CCDC135, PAX9, RPL13 , ABCA13, DAAM1, OPN1LW, OPN1MW2, CNOT6L, MTRNR2L10, SMC4, RPL4, PSAP, ASIC4, AHCYL1, RD3L, SIGLEC1, SYCE2 and NANS.

[0076] In one aspect, disclosed herein are compositions comprising one or more secretomes and two or more RNAs, wherein the two or more RNAs include at least one antisense mRNA selected from the group consisting of UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, T OX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6GALNAC51, ABCA41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1 and GAGE2D: copy 21.

[0077] Also disclosed herein are compositions comprising one or more secretomes and two or more RNAs, wherein the two or more RNAs include at least one lncRNA selected from the group consisting of LOC100129335-5, ZNF238, CADM2-7, SALL1-6, and VWA5A.

[0078] In one aspect, disclosed herein is any of the aforementioned compositions, comprising one or more secretomes and two or more RNA pects, wherein the two or more RNAs include at least one antisense lncRNA selected from the group consisting of ANKRD5-1, ZNF236-1, and ACP1.

[0079] Also disclosed herein are compositions comprising one or more secretomes and two or more RNAs, wherein the two or more RNAs include at least one y-RNA selected from the group consisting of RF00019.441, RF00019.451, RF00019.621, RF00019.646, and RF00019.413.

[0080] In one aspect, disclosed herein are compositions comprising one or more secretomes and two or more RNAs, wherein the two or more RNAs include at least one pi-RNA selected from the group consisting of: piR-33044, piR-33043, and piR-31703.

[0081] The disclosed compositions can be delivered to target cells in a variety of ways. For example, the compositions can be delivered by electroporation, or by lipofection, or by calcium phosphate precipitation. The selected delivery mechanism will depend in part on the type of cells targeted and whether delivery occurs, for example, in vivo or in vitro.

[0082] As described throughout, in addition to MSC-derived exosomes or extracellular vesicles, the disclosed RNA can also be contained and delivered to a subject via lipids, such as lipid nanoparticles, or liposomes, such as cationic liposomes (e.g., DOTMA, DOPE, DC cholesterol) or anionic liposomes. If desired, the liposomes can further comprise proteins to facilitate targeting to specific cells. Administration of a composition comprising a compound and a cationic liposome can be administered into the blood that enters the target organ or inhaled into the respiratory tract to target cells of the respiratory tract. For liposomes, see, e.g., Brigham et al., Am. J. Resp. Cell. Mol. Biol. 1:95-100 (1989); Felgner et al., Proc. Natl. Acad. Sci USA 84:7413-7417 (1987); US Pat. No. 4,897,355. Additionally, the compound can be administered as a component of a microcapsule that can be targeted to a specific cell type, such as macrophages, or where diffusion of the compound or delivery of the compound from the microcapsule is designed for a specific rate or dose.

[0083] In the above-mentioned method including applying and taking up exogenous DNA into the cells of the object (i.e., gene transduction or transfection), the composition can be delivered to the cell by a variety of mechanisms. As an example, delivery can be carried out by liposomes using commercially available liposome preparations such as LIPOFECTIN, LIPOFECTAMINE (GIBCO-BRL, Inc., Gaithersburg, MD), SUPERFECT (Qiagen, Inc. Hilden, Germany) and TRANSFECTAM (Promega Biotec, Inc., Madison, WI), and other liposomes developed according to standard procedures in the art. In addition, the disclosed nucleic acid or vector can be delivered in vivo by electroporation (the technology can be obtained from Genetronics, Inc. (San Diego, CA)) and by sonoporation (SONOPORATION) machine (IImaRx Pharmaceutical Corp., Tucson, AZ) means.

[0084] The materials can be in solution, suspension (e.g., incorporated into microparticles, liposomes, or cells). They can be targeted to specific cell types via antibodies, receptors, or receptor ligands. The following references are examples of using this technology to target specific proteins to tumor tissues (Senter et al., Bioconjugate Chem., 2:447-451, (1991); Bagshawe, KD, Br. J. Cancer, 60:275-281, (1989); Bagshawe et al., Br. J. Cancer, 58:700-703, (1988); Senter et al., Bioconjugate Chem., 4:3-9, (1993); Battelli et al., Cancer Immunol. Immunother., 35:421-425, (1992); Pietersz and McKenzie, Immunolog. Reviews, 129:57-80, (1992); and Roffler et al., Biochem. Pharmacol, 42:2062-2065, (1991)). These techniques can be used for a variety of other specific cell types. Vehicles such as "stealth" and other antibody-conjugated liposomes (including lipid-mediated drug targeting for colon cancer), receptor-mediated DNA targeting by cell-specific ligands, lymphocyte-directed tumor targeting, and highly specific therapeutic retroviral targeting of mouse glioma cells in vivo. The following references are examples of using this technology to target specific proteins to tumor tissues (Hughes et al., Cancer Research, 49: 6214-6220, (1989); and Litzinger and Huang, Biochimica et Biophysica Acta, 1104: 179-187, (1992)). In general, receptors participate in constitutive or ligand-induced endocytic pathways. These receptors are aggregated in clathrin-coated pits, enter cells through clathrin-coated vesicles, pass through acidified endosomes where receptors are sorted, and then either circulate to the cell surface, store in cells, or be degraded in lysosomes. The internalization pathway has multiple functions, such as nutrient uptake, removal of active proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligands, and receptor level regulation. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, ligand type, valence of the ligand, and ligand concentration. The molecular and cellular mechanisms of receptor-mediated endocytosis have been reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)).

[0085] The nucleic acid delivered to the cell to be integrated into the host cell genome generally contains integration sequences. These sequences are generally virus-related sequences, especially when using a virus-based system. These viral integration systems can also be incorporated into the nucleic acid to be delivered using a non-nucleic acid-based delivery system (such as liposome) so that the nucleic acid included in the delivery system can be integrated into the host genome.

[0086] Other general techniques for integration into the host genome include, for example, systems designed to promote homologous recombination with the host genome. These systems generally rely on sequences flanking the nucleic acid to be expressed that have sufficient homology to the target sequence in the host cell genome so that recombination occurs between the vector nucleic acid and the target nucleic acid, thereby causing the delivered nucleic acid to be integrated into the host genome. These systems and methods required for promoting homologous recombination are known to those skilled in the art.

[0087] In one aspect, the secretome compositions disclosed herein (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) may further comprise any known ingredients commonly found in the field of wound healing, such as oils, waxes or other standard fatty substances, or conventional gelling agents and / or thickeners; emulsifiers; moisturizers; lubricants; sunscreens; hydrophilic or lipophilic active agents, such as ceramides; agents for combating free radicals; bactericides; chelating agents; preservatives; alkalizing agents or acidifying agents; fragrances; surfactants; fillers; natural products or natural product extracts, such as aloe vera or green tea extracts; vitamins; or coloring materials. Other ingredients that may be combined with the powder may include antioxidants, which may be selected from a variety of antioxidants. Suitable antioxidants include vitamins such as vitamin C (L-ascorbic acid, magnesium ascorbyl-2 phosphate, ascorbyl palmitate, tetrahexyldecyl ascorbate), vitamin E (tocotrienols), vitamin A (retinol, retinal, retinoic acid, provitamin A carotenoids such as beta-carotene), N-acetylglucosamine or other derivatives of glucosamine. Other ingredients may include at least one essential fatty acid such as omega-3, omega-6 and omega-9 polyunsaturated fatty acids such as linoleic acid (LA), gamma-linoleic acid (GLA), alpha-linoleic acid (ALA), dihomo-gamma-linolenic acid (DGLA), arachidonic acid (ARA), etc. The fatty acids may be derived from a variety of sources including evening primrose oil, black currant oil, borage oil or GLA-modified safflower seeds. Other components may include a platelet-rich fibrin matrix, at least one component that supports ECM production and hyaluronic acid production, such as N-acetylglucosamine or other derivatives of glucosamine, ultra-low molecular weight (ULMW) hyaluronic acid, chondroitin sulfate, or keratin sulfate.

[0088] The secretome loaded with RNA can be prepared by any natural or synthetic process known in the art. For example, RNA synthesis and vesicle loading processes naturally occurring in cells are used to generate EVs loaded with RNA. Alternatively, RNA can be synthesized by de novo organic synthesis methods and loaded into artificial lipid nanoparticles. In another example, RNA species in EVs of natural origin are combined with artificial lipid nanoparticles loaded with synthetic RNA species at various combination ratios of 1:1 to 1:10000, wherein the various combinations are delivered in the form of single vesicles. In another example, RNA species in EVs of natural origin are combined with artificial lipid nanoparticles loaded with synthetic RNA species at various combination ratios of 1:1 to 1:10000, wherein various combinations are fused 1:1 to generate combined chimeric natural / synthetic EV particles containing natural and synthetic RNA sequence combinations. In some configurations, synthetic RNA can be loaded into synthetic lipid nanoparticles together with cofactor proteins that enhance the function of RNA sequences. It can be understood and envisioned herein that natural and synthetically produced secretomes can be used in the same composition. Thus, in one aspect, different combinations of naturally occurring and synthetically produced EVs are administered to a recipient at different times to improve the effects on genes expressed in different cell types or at different times during the resolution of immune regulation.

[0089] 1. Homology / Identity

[0090] It should be understood that any known variants and derivatives of genes and proteins disclosed herein or a method of variants and derivatives that may occur is to define variants and derivatives according to the homology with a specific known sequence. Specifically disclosed are variants of these variants and other genes and proteins disclosed herein, which have at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% homology with the sequence. Those skilled in the art will readily understand how to determine the homology of two proteins or nucleic acids (such as genes). For example, homology can be calculated after comparing two sequences to achieve the highest level of homology.

[0091] Another method of calculating homology can be performed by published algorithms. The best alignment of sequences for comparison can be performed by the following methods: the local homology algorithm of Smith and Waterman Adv. Appl. Math. 2: 482 (1981), the homology alignment algorithm of Needleman and Wunsch, J. MoL Biol. 48: 443 (1970), the similarity search method of Pearson and Lipman, Proc. Natl. Acad. Sci. USA 85: 2444 (1988), by computer implementation of these algorithms (GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI) or inspection.

[0092] The same type of nucleic acid homology can be obtained by the algorithms disclosed, for example, in Zuker, M. Science 244:48-52, 1989, Jaeger et al., Proc. Natl. Acad. Sci. USA 86:7706-7710, 1989, Jaeger et al., Methods Enzymol. 183:281-306, 1989, which are incorporated herein by reference for at least the material related to nucleic acid alignment.

[0093] 2. Hybridization / Selective Hybridization

[0094] The term hybridization generally refers to a sequence-driven interaction between at least two nucleic acid molecules (such as a primer or probe and a gene). A sequence-driven interaction refers to an interaction between two nucleotides or nucleotide analogs or nucleotide derivatives that occurs in a nucleotide-specific manner. For example, G interacts with C or A interacts with T, which are sequence-driven interactions. Typically, sequence-driven interactions occur on the Watson-Crick or Hoogsteen surfaces of nucleotides. The hybridization of two nucleic acids is affected by many conditions and parameters known to those skilled in the art. For example, the salt concentration, pH value, and temperature of the reaction can affect whether two nucleic acid molecules hybridize.

[0095] Those skilled in the art are familiar with the parameters of selective hybridization between two nucleic acid molecules. For example, in some embodiments, selective hybridization conditions can be defined as stringent hybridization conditions. For example, the stringency of hybridization is controlled by the temperature and salt concentration of one or both of the hybridization and washing steps. For example, the hybridization conditions for achieving selective hybridization can include hybridization in a high ionic strength solution (6XSSC or 6X SSPE) at a temperature of about 12-25°C (the melting temperature at which half of the molecules are separated from their hybridization partners) below Tm, followed by washing at a selected temperature and salt concentration combination so that the washing temperature is about 5°C to 20°C below Tm. In preliminary experiments, temperature and salt conditions are easily determined empirically, where a reference DNA sample fixed on a filter is hybridized with a labeled nucleic acid of interest, and then washed under conditions of different stringencies. The hybridization temperatures for DNA-RNA and RNA-RNA hybridizations are generally higher. The conditions can be used as described above or as known in the art to achieve stringency. Preferred stringent hybridization conditions for DNA:DNA hybridization can be in 6X SSC or 6X SSPE at about 68°C (in aqueous solution), followed by washing at 68°C. If desired, the stringency of hybridization and washing can be reduced accordingly as the desired degree of complementarity decreases, and further depends on the GC or AT richness of any region in which variability is sought. Likewise, if desired, the stringency of hybridization and washing can be increased accordingly as the desired homology increases, and further depends on the GC or AT richness of any region in which high homology is desired, all of which are known in the art.

[0096] Another method of defining selective hybridization is by observing the amount (percentage) of one nucleic acid combined with another nucleic acid. For example, in some embodiments, selective hybridization conditions are when at least about 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% of the restrictive nucleic acid is combined with the non-restrictive nucleic acid. Typically, the non-restrictive primer is in excess, for example, 10 times or 100 times or 1000 times. This type of assay can be performed when both the restrictive primer and the non-restrictive primer are their k d For example, 1 / 10, 1 / 100 or 1 / 1000 is lower, or only one nucleic acid molecule is its k d 1 / 10, 1 / 100 or 1 / 1000 of its k d Under high conditions.

[0097] Another way to define selective hybridization is by observing the percentage of primers that undergo enzymatic manipulation under conditions that require hybridization to promote the desired enzymatic manipulation. For example, in some embodiments, selective hybridization conditions are when at least about 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% of the primers undergo enzymatic manipulation under conditions that promote enzymatic manipulation. When the enzymatic operation is, for example, DNA extension, then the selective hybridization conditions are when at least about 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% of the primer molecules are extended. Preferred conditions also include those recommended by the manufacturer or those indicated in the art to be suitable for the enzyme performing the operation.

[0098] As with homology, it is understood that a variety of methods for determining the level of hybridization between two nucleic acid molecules are disclosed herein. It is understood that these methods and conditions can provide different hybridization percentages between two nucleic acid molecules, but unless otherwise specified, it is sufficient to meet the parameters of any one of the methods. For example, if 80% hybridization is required, it is considered disclosed herein as long as hybridization occurs within the parameters required by any one of these methods.

[0099] It is understood that one of skill in the art will understand that if a composition or method collectively or individually meets any of these criteria for determining hybridization, then it is a composition or method disclosed herein.

[0100] 3. Nucleic Acids

[0101] A plurality of nucleic acid-based molecules are disclosed herein. The disclosed nucleic acids are composed of, for example, nucleotides, nucleotide analogs or nucleotide substitutes. Non-limiting examples of these and other molecules are discussed herein. It should be understood that, for example, when the vector is expressed in a cell, the expressed mRNA is generally composed of A, C, G and U. Similarly, it should be understood that, if, for example, antisense molecules are introduced into a cell or a cell environment by, for example, exogenous delivery, it is advantageous that the antisense molecules are composed of nucleotide analogs, which reduce the degradation of the antisense molecules in the cell environment.

[0102] a) Nucleotides and related molecules

[0103] Nucleotide is a molecule comprising a base moiety, a sugar moiety and a phosphate moiety. Nucleotide can be linked together by its phosphate moiety and sugar moiety, thereby producing an internucleoside bond. The base moiety of a nucleotide can be adenine-9-base (A), cytosine-1-base (C), guanine-9-base (G), uracil-1-base (U) and thymine-1-base (T). The sugar moiety of a nucleotide is ribose or deoxyribose. The phosphate moiety of a nucleotide is a pentavalent phosphoric acid. Non-limiting examples of nucleotides are 3'-AMP (3'-adenosine monophosphate) or 5'-GMP (5'-guanosine monophosphate). There are many variants of these types of molecules available in this area and herein.

[0104] A nucleotide analog is a nucleotide that contains some type of modification to a base moiety, a sugar moiety, or a phosphate moiety. Modifications to nucleotides are well known in the art and include, for example, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, and 2-aminoadenine, as well as modifications to a sugar moiety or a phosphate moiety. There are many variants of these types of molecules available in the art and herein.

[0105] Nucleotide substitutes are molecules with functional properties similar to nucleotides but without a phosphate moiety, such as peptide nucleic acids (PNAs). Nucleotide substitutes are molecules that will recognize nucleic acids in a Watson-Crick or Hoogsteen manner, but they are linked together by parts other than the phosphate moiety. Nucleotide substitutes can conform to a double helix structure when interacting with appropriate target nucleic acids. There are many variants of these types of molecules available in the art and herein.

[0106] Other types of molecules (conjugates) can also be attached to nucleotides or nucleotide analogs to enhance, for example, cellular uptake. Conjugates can be chemically attached to nucleotides or nucleotide analogs. Such conjugates include, but are not limited to, lipid moieties, such as cholesterol moieties. (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556). There are many variants of these types of molecules available in the art and herein.

[0107] The Watson-Crick interaction is at least one interaction with the Watson-Crick surface of a nucleotide, nucleotide analog or nucleotide substitute. The Watson-Crick surface of a nucleotide, nucleotide analog or nucleotide substitute includes the C2, N1 and C6 positions of a purine-based nucleotide, nucleotide analog or nucleotide substitute and the C2, N3, C4 positions of a pyrimidine-based nucleotide, nucleotide analog or nucleotide substitute.

[0108] Hoogsteen interactions occur on the Hoogsteen face of a nucleotide or nucleotide analog, which is exposed in the major groove of double-stranded DNA. The Hoogsteen face includes reactive groups (NH2 or O) at the N7 position and the C6 position of a purine nucleotide.

[0109] In some aspects, RNA can be modified to reduce degradation. For example, RNA can include the addition of 2'-O-methyl, 2'-fluoro, or 2'-hydrogen groups.

[0110] b) Sequence

[0111] The sequences of human analogs of the RNA molecules disclosed herein, as well as other analogs, and alleles of these genes, as well as splice variants and other types of variants, can be obtained in various protein and gene databases, including Genbank. Those skilled in the art understand how to resolve sequence deviations and differences, and how to adjust compositions and methods associated with a specific sequence to other related sequences. Primers and / or probes can be designed for any given sequence based on information disclosed herein and known in the art.

[0112] c) Functional nucleic acids

[0113] Functional nucleic acid is a nucleic acid molecule with a specific function, such as binding a target molecule or catalyzing a specific reaction. Functional nucleic acid molecules can be divided into the following categories, but these categories are not restrictive. For example, functional nucleic acid includes antisense molecules, aptamers, ribozymes, triplex-forming molecules and external guide sequences. Functional nucleic acid molecules can serve as influencers, inhibitors, regulators and stimulants of the specific activity possessed by target molecules, or functional nucleic acid molecules can have a new activity (de novo activity) independent of any other molecule.

[0114] Functional nucleic acid molecules can interact with any macromolecule such as DNA, RNA, polypeptides or carbohydrate chains. Thus, the functional nucleic acid can interact with the mRNA of any of the disclosed nucleic acids, such as hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7e-5p, hsa-let-7g-5p, hsa-let-7i, hsa-let-7i-5p, hsa-miR-100-5p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-106b-5p, hsa-mir-10b, hsa-miR-10b-5p, hsa-mir-10c-5p, hsa-mir-10d-5p, hsa-mir-10d-5p, hsa-mir-10e-5p, hsa-mir-10f-5p, hsa-mir-10g-5p, hsa-mir-10g-5p, hsa-mir-10g-5p, hsa-mir-10h ... -1246, hsa-miR-1246, hsa-miR-125a-5p, hsa-miR-125b-5p, hsa-miR-130a-3p, hsa-mir-130b, hsa-miR-130b-3p, hsa-miR-132-3p, hsa-miR-1 36-5p, hsa-miR-138-5p, hsa-miR-139-5p, hsa-mir-140, hsa-miR-140-3p, hsa-miR-145-5p, hsa-mir-146a, hsa-miR-146a-5p, hsa-miR-148a- 3p, hsa-miR-152-3p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-mir-16-1, hsa-mir-16-2, hsa-miR-16-5p, hsa-miR-17-5p, hsa-miR-181a-5p, hs a-miR-191-5p, hsa-miR-193a-5p, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-199a-3p, hsa-miR-199a-5p, hsa-miR-199b-5p, hsa-miR-19a- 3p, hsa-miR-19b-3p, hsa-miR-20a-5p, hsa-miR-203a, hsa-miR-203a-3p, hsa-miR-214-3p, hsa-mir-21, hsa-miR-21-3p, hsa-miR-21-5p, hsa- mir-221, hsa-miR-221-3p, hsa-mir-222, hsa-miR-222-3p, hsa-miR-22-3p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-mir-24-1, hsa-mir-24-2,hsa-miR-24-3p, hsa-miR-25, hsa-miR-25-3p, hsa-miR-26a-5p, hsa-miR-27a-3p, hsa-miR-27b, hsa-miR-27b-3p, hsa-miR-29a-3p, hsa-miR-29c-3p, hsa-miR-30a-5p, hsa-miR-30a-5p, hsa-miR-30b-5p, hsa-miR-30c-5p, hsa-miR-30d, hsa-miR-30d-5p, hsa-miR-30e, hsa-miR-30e-5p, hsa-mi R-31-3p, hsa-miR-31-5p, hsa-miR-320a, hsa-miR-342-3p, hsa-miR-345-5p, hsa-miR-34a-5p, hsa-miR-361-5p, hsa-miR-376a-3p, hsa-miR-376c-3p, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424-5p, hsa-miR-484, hsa-miR-486-1, hsa-miR-486-2, hsa-miR-486-5p, hsa-miR-570-3p, and hsa-m iR-574-3p, hsa-miR-663a, hsa-miR-874-3p, hsa-miR-92a-1, hsa-miR-92a-2, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-miR-93, hsa-miR-93-5p, hs a-miR-940、hsa-miR-99a-5p、hsa-miR-99b-5p、HBII-202、U26、U29、HBII- 420、U30、U18A、U81、GSKIP、IFT88、PCDH11X、PCDH11Y、KIAA0226L、PDE11A、 PHACTR1、TEX14、DCUN1D2、SIM1、FILIP1、FAM107B、CHADL、ZNF365、MNAT1、 CYSTM1、GAS7、HOXB7、ASTN2、LGR5、ZFHX3、MCM7、GRIK1、MAP2、LHFPL3、PTER 、STAMBP、CCDC135、PAX9、RPL13、ABCA13、DAAM1、OPN1LW、OPN1MW2、CNOT6L、 MTRNR2L10、SMC4、RPL4、PSAP、ASIC4、AHCYL1、RD3L、SIGLEC1、SYCE2、NANS、LOC100129335-5、ZNF238、CADM2-7、SALL1-6、VWA5A、RF00019.441、RF00019.451、RF00019.621、RF00019.646、RF00019.413、piR-33044、piR-33043、piR-31703、RNY4、LOC441666、SNHG1、RNU11、LOC80154、LOC727751、LOC388152、GOLGA2P2Y、GOLGA2P3Y、SNHG12、RNU12、ASMTL-AS1、LOC284454 U2:RF00004.39、U2:RF00004.22、U2:RF00004.35、U2:RF00004.71、U2:RF00004.66 U2:RF00004.91、U2:RF00004.89、U2:RF00004.67、U1:RF00003.5、U1:RF00003.109、U1:RF00003.110、U1:RF00003.8、U1:RF00003.3、U1:RF00003.6、U1:RF00003.38、U1:RF00003.20、U1:RF00003.24、U1:RF00003.73、U1:RF00003.11、U1:RF00003.27、U1:RF00003.40、U1:RF00003.107、U1:RF00003.62、U1:RF00003.45、U1:RF00003.116、U1:RF00003.126、U1:RF00003.81、U1:RF00003.100、U1:RF00003.57、U1:RF00003.95、U1:RF00003.31、U1:RF00003.61、U1:RF00003.25、U1:RF00003.90、U1:RF00003.46、U1:RF00003.123、U2:RF00004.42、U2:RF00004.61、U2:RF00004.51、U1:RF00003.122、U1:RF00003.22、U1:RF00003.9、snoMBII-202:RF00324.2、let-7:RF00027.7、U2:RF00004.75、U1:RF00003.69、U2:RF00004.88、U12:RF00007.1、U7:RF00066.141、U1:RF00003.85、U7:RF00066.49、U2:RF00004.77、U1:RF00003.113、U1: RF00003.112, U1: RF00003.70, U1: RF00003.83, U7: RF00066.89, U7: RF00066.124, U7: RF00066.75, U7: RF00066.77, U7: RF00066.118, U7: RF00066.103, U7: RF00066.79, U7: RF0 0066.200, U7: RF00066.146, UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL 21. C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK 11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6GALNAC51, ABCA41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1, GAGE2D: copy 21, ANKRD5-1, ZNF236-1, ACP1, EPHA1-AS1, FLJ45974, ANKRD30BP2, LINC00340, GRIK1-AS1, LOC440300, CSPG4P8, ADARB2-AS1, MLLT4-AS1, and / or HNRNPU-AS1. Functional nucleic acids are often designed to interact with other nucleic acids based on sequence homology between the target molecule and the functional nucleic acid molecule. In other cases, the specific recognition between the functional nucleic acid molecule and the target molecule is not based on sequence homology between the functional nucleic acid molecule and the target molecule, but on the formation of a tertiary structure that allows specific recognition to occur.

[0115] Antisense molecules (e.g., UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6GALNAC51, ABCA41, COL5A11, AKIP11, UG T81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1, GAGE2D: copy 21, ANKRD5-1, ZNF236-1, ACP1, EPHA1-AS1, FLJ45974, ANKRD30BP2, LINC00340, GRIK1-AS1, LOC440300, CSPG4P8, ADARB2-AS1, MLLT4-AS1 and HNRNPU-AS1) are designed to interact with the target nucleic acid molecule through canonical or non-canonical base pairing. The interaction of the antisense molecule with the target molecule is designed to promote the destruction of the target molecule by RNA-DNA hybrid degradation mediated by, for example, RNAse H. Alternatively, the antisense molecule is designed to interrupt processing functions that usually occur on the target molecule, such as transcription or replication. Antisense molecules can be designed based on the sequence of the target molecule. There are a number of methods to optimize antisense efficiency by finding the most accessible regions of the target molecule. Exemplary methods are in vitro selection experiments and DNA modification studies using DMS and DEPC. -6 , 10 -8 , 10 -10 or 10 -12 The dissociation constant (k d) binds to a target molecule. A representative sample of methods and techniques useful for designing and using antisense molecules can be found in the following non-limiting list of U.S. patents: 5,135,917; 5,294,533; 5,627,158; 5,641,754; 5,691,317; 5,780,607; 5,786,138; 5,849,903; 5,856,103; 5,919,772; 5,9 and 6,057,437.

[0116] 4. Drug carrier / drug product delivery

[0117] As mentioned above, the composition can also be administered in vivo in a pharmaceutically acceptable carrier. "Pharmaceutically acceptable" refers to a material that is not biologically or otherwise undesirable, that is, the material can be administered to a subject together with a nucleic acid or a carrier without causing any undesirable biological effect or interacting in a harmful manner with any of the other components of the pharmaceutical composition comprising it. The carrier is naturally selected to minimize any degradation of the active ingredient and minimize any adverse side effects of the subject, as is well known to those skilled in the art.

[0118] The composition can be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, in vitro, topically, etc., including topical intranasal administration or administration by inhalation. As used herein, "topical intranasal administration" refers to the delivery of the composition to the nose and nasal passages through one or both nostrils, and may include delivery by a spray mechanism or a droplet mechanism, or by atomization delivery of a nucleic acid or a vector. The composition can be delivered by inhalation through the nose or mouth via a spray or droplet mechanism. It can also be delivered directly to any area of ​​the respiratory system (e.g., lungs) via an intubation tube. The exact amount of the desired composition varies from subject to subject, depending on the species, age, weight, and general condition of the subject, the severity of the allergic condition being treated, the specific nucleic acid or vector used, its mode of administration, etc. Therefore, it is impossible to specify an exact amount for each composition. However, a person of ordinary skill in the art can determine the appropriate amount using only routine experiments based on the teachings herein.

[0119] If parenteral administration of the composition is used, it is usually characterized by injection. Injections can be prepared in conventional forms, either as liquid solutions or suspensions, or as solid forms suitable for dissolution or suspension in liquids prior to injection, or as emulsions. Recently revised parenteral administration methods involve the use of slow-release or sustained-release systems in order to maintain a constant dose. See, for example, U.S. Pat. No. 3,610,795, which is incorporated herein by reference.

[0120] The materials can be in solution, suspension (e.g., incorporated into microparticles, liposomes, or cells). They can be targeted to specific cell types via antibodies, receptors, or receptor ligands. The following references are examples of using this technology to target specific proteins to tumor tissues (Senter et al., Bioconjugate Chem., 2:447-451, (1991); Bagshawe, KD, Br. J. Cancer, 60:275-281, (1989); Bagshawe et al., Br. J. Cancer, 58:700-703, (1988); Senter et al., Bioconjugate Chem., 4:3-9, (1993); Battelli et al., Cancer Immunol. Immunother., 35:421-425, (1992); Pietersz and McKenzie, Immunolog. Reviews, 129:57-80, (1992); and Roffler et al., Biochem. Pharmacol, 42:2062-2065, (1991)). Vehicles such as "stealth" and other antibody-conjugated liposomes (including lipid-mediated drug targeting to colon cancer), receptor-mediated DNA targeting by cell-specific ligands, lymphocyte-directed tumor targeting, and highly specific therapeutic retroviral targeting of mouse glioma cells in vivo. The following references are examples of using this technology to target specific proteins to tumor tissue (Hughes et al., Cancer Research, 49: 6214-6220, (1989); and Litzinger and Huang, Biochimica et Biophysica Acta, 1104: 179-187, (1992)). In general, receptors participate in constitutive or ligand-induced endocytic pathways. These receptors are aggregated in clathrin-coated pits, enter cells through clathrin-coated vesicles, pass through acidified endosomes where the receptors are sorted, and then either circulate to the cell surface, are stored in the cell, or are degraded in lysosomes. Internalization pathways have multiple functions, such as nutrient uptake, removal of active proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligands, and receptor level regulation. Many receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, ligand type, valence of the ligand, and ligand concentration. The molecular and cellular mechanisms of receptor-mediated endocytosis have been reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)).

[0121] a) Pharmaceutically acceptable carrier

[0122] Compositions including antibodies may be combined with a pharmaceutically acceptable carrier for use in therapy.

[0123] Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th edition) ed. A. R. Gennaro, Mack Publishing Company, Easton, PA 1995. Typically, an appropriate amount of pharmaceutically acceptable salts are used in the formulation to make the formulation isotonic. Examples of pharmaceutically acceptable carriers include, but are not limited to, saline, Ringer's solution, and dextrose solution. The pH of the solution is preferably from about 5 to about 8, more preferably from about 7 to about 7.5. Further carriers include sustained release formulations, such as semipermeable matrices of solid hydrophobic polymers containing antibodies, which are in the form of shaped articles, such as films, liposomes, or microparticles. It will be apparent to those skilled in the art that, depending on, for example, the route of administration and the concentration of the administered composition, certain carriers may be more preferred.

[0124] Pharmaceutical carriers are known to those skilled in the art. These are most typically standard carriers for administration to humans, including solutions such as sterile water, saline, and buffered solutions of physiological pH. The composition can be administered intramuscularly or subcutaneously. Other compounds will be administered according to standard procedures used by those skilled in the art.

[0125] In addition to the selected molecule, the pharmaceutical composition may also include carriers, thickeners, diluents, buffers, preservatives, surfactants, etc. The pharmaceutical composition may also include one or more active ingredients, such as antimicrobial agents, anti-inflammatory agents, anesthetics, and the like.

[0126] The pharmaceutical composition can be administered in a variety of ways, depending on whether local or systemic treatment is desired and the area to be treated. Administration can be topical (including ocular, vaginal, rectal, intranasal), oral, by inhalation, or parenteral, such as by intravenous infusion, subcutaneous, intraperitoneal or intramuscular injection. The disclosed antibodies can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intracavitary or transdermally.

[0127] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (such as olive oil) and injectable organic esters (such as ethyl oleate). Aqueous carriers include water, alcohol / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, glucose and sodium chloride, lactated Ringer's solution or fixed oils. Intravenous vehicles include liquid and nutritional supplements, electrolyte supplements (such as supplements based on Ringer's dextrose) etc. Preservatives and other additives may also be present, such as, for example, antimicrobial agents, antioxidants, chelating agents and inert gases etc.

[0128] Formulations for topical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.

[0129] Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets or tablets. It may be desirable to use thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders.

[0130] Some compositions may potentially be administered in the form of pharmaceutically acceptable acid addition salts or base addition salts formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid and phosphoric acid and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid and fumaric acid, or by reaction with inorganic bases such as sodium hydroxide, ammonium hydroxide, potassium hydroxide and organic bases such as mono-, di-, tri-alkyl and aryl amines and substituted ethanolamines.

[0131] b) Therapeutic use

[0132] The effective dose and administration schedule for administering the composition can be determined empirically, and making such determinations is within the technical scope of the art. The dosage range for administering the composition is large enough to produce the desired effect in which the symptoms of the disease are affected. The dosage should not be too large to avoid causing adverse side effects, such as unwanted cross-reactions, allergic reactions, etc. Usually, the dosage will vary with the patient's age, condition, sex and degree of disease, route of administration or whether other drugs are included in the regimen, and can be determined by those skilled in the art. If any contraindications occur, the individual doctor can adjust the dosage. The dosage can vary and can be administered once or multiple times a day for one or more days. Guidance on the appropriate dosage of a given class of medicine can be found in the literature. For example, guidance on selecting an appropriate dose of an antibody can be found in the literature on the therapeutic use of antibodies, such as Handbook of Monoclonal Antibodies, Ferrone et al., ed., Noges Publications, Park Ridge, NJ, (1985) Chapter 22 and pages 303-357; Smith et al., Antibodies in Human Diagnosis and Therapy, Haber et al., ed., Raven Press, New York (1977) pages 365-389. A typical daily dose of an antibody used alone can range from about 1 μg / kg to as high as 100 mg / kg body weight or more per day, depending on the factors mentioned above.

[0133] C. Methods of regulating inflammation

[0134] The disclosed RNA can target genes involved in immune regulation. For example, miR-92a-3p targets HAS2, NOX4 and / or ADAMTS-4; let-7i-5p targets HAS2, TLR4, NOX2, MMP1 and / or COX2; miR-16-5p targets HAS2, NOS1 and / or COX2; miR-93-5p targets HAS2, NOX2 and / or ADAMTS-4; miR-21-5p targets IL-1B, IL6, STAT3, PTEN, TNF, IRAK1 and / or CCL20; miR-214-3p targets CASP1; miR-29c-3p and miR-34a-5p target BDKRB2; mir-203a-3p targets MMP-13, NOX2 and / or ADAMTS-4; miR-27b-3p targets miR-140-3p targets MMP-13, NOX2 and / or IL1B; miR-140-3p targets MMP-13, ADAMTS-4 and / or BCL2; miR-24-3p targets MMP-13, ADAMTS-4 and / or IL1B, miR-222-3p targets MMP-13 and / or MMP1; miR-25-3p targets MMP-13, NOX4 and / or ADAMTS-4; miR-10b-5p targets NOX2 / ADAMTS-4; miR-221-3p targets MMP1 and / or IL1B; miR-17-5p targets the jak-stat pathway, PTEN, TNF and / or CXCL8; miR-30a-5p targets ESCC inhibition; and miR-30d-5p is a tumor suppressor in lung tumors.

[0135] Therefore, also disclosed herein is a method of regulating an immune response of a subject to inflammatory injury (including but not limited to increasing or decreasing inflammation), comprising administering to a subject any of the compositions disclosed herein, including but not limited to a composition comprising one or more secretomes (including but not limited to a composition comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the RNA molecules include hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7e-5p, hsa-let-7g-5 ... a-let-7i, hsa-let-7i-5p, hsa-miR-100-5p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-106b-5p, hsa-mir-10b, hsa-miR-10b-5p, hsa-mir-124 6. hsa-miR-1246, hsa-miR-125a-5p, hsa-miR-125b-5p, hsa-miR-130a-3p, hsa-mir-130b, hsa-miR-130b-3p, hsa-miR-132-3p, hsa-miR-136-5p, hs a-miR-138-5p, hsa-miR-139-5p, hsa-mir-140, hsa-miR-140-3p, hsa-miR-145-5p, hsa-mir-146a, hsa-miR-146a-5p, hsa-miR-148a-3p, hsa-miR- 152-3p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-mir-16-1, hsa-mir-16-2, hsa-miR-16-5p, hsa-miR-17-5p, hsa-miR-181a-5p, hsa-miR-191-5p, hs a-miR-193a-5p, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-199a-3p, hsa-miR-199a-5p, hsa-miR-199b-5p, hsa-miR-19a-3p, hsa-miR-19b-3p, h sa-miR-20a-5p, hsa-miR-203a, hsa-miR-203a-3p, hsa-miR-214-3p, hsa-mir-21, hsa-miR-21-3p, hsa-miR-21-5p, hsa-mir-221, hsa-miR-221-3p,hsa-mir-222, hsa-miR-222-3p, hsa-miR-22-3p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-miR-24-1, hsa-miR-24-2, hsa-miR-24-3p, hsa-miR-25, hsa-miR-25-3p, hsa-miR-26a-5p, hsa-miR-27a-3p, hsa-miR-27b, hsa-miR-27b-3p, hsa-miR-29a-3p, hsa-miR-29c-3p, hsa-miR-30a-5p, and hsa-miR-30a- 5p、hsa-miR-30b-5p、hsa-miR-30c-5p、hsa-mir-30d、hsa-miR-30d-5p、hs a-mir-30e、hsa-miR-30e-5p、hsa-miR-31-3p、hsa-miR-31-5p、hsa-miR-32 0a, hsa-miR-342-3p, hsa-miR-345-5p, hsa-miR-34a-5p, hsa-miR-361-5p, hsa-miR-376a-3p, hsa-miR-376c-3p, hsa-miR-423-3p, and hsa-miR-423-5p hsa-miR-424-5p, hsa-miR-484, hsa-miR-486-1, hsa-miR-486-2, hsa-miR-486-5p, hsa-miR-570-3p, hsa-miR-574-3p, hsa-miR-663a, hsa-miR-874-3p, hsa-miR-92a-1, hsa-miR-92a-2, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-miR-93, hsa-miR-93-5p, hsa-miR-940, hsa-miR-99a-5p, and hsa-miR-99b- 5p、HBII-202、U26、U29、HBII-420、U30、U18A、U81、GSKIP、IFT88、PCDH11X、 PCDH11Y、KIAA0226L、PDE11A、PHACTR1、TEX14、DCUN1D2、SIM1、FILIP1、FAM1 07B、CHADL、ZNF365、MNAT1、CYSTM1、GAS7、HOXB7、ASTN2、LGR5、ZFHX3、MCM7 、GRIK1、MAP2、LHFPL3、PTER、STAMBP、CCDC135、PAX9、RPL13、ABCA13、DAAM1、OPN1LW, OPN1MW2, CNOT6L, MTRNR2L10, SMC4, RPL4, PSAP, ASIC4, AHCYL1, RD3L, SIGLEC1, SYCE2, NA NS, LOC100129335-5, ZNF238, CADM2-7, SALL1-6, VWA5A, RF00019.441, RF00019.451, RF00019.621 , RF00019.646, RF00019.413, piR-33044, piR-33043, piR-31703, RNY4, LOC441666, SNHG1, RNU11 , LOC80154, LOC727751, LOC388152, GOLGA2P2Y, GOLGA2P3Y, SNHG12, RNU12, ASMTL-AS1, LOC284454 U2: RF00004.39, U2: RF00004.22, U2: RF00004.35, U2: RF00004.71, U2: RF00004.66 U2: RF00004.91, U2: RF00004.89, U2: RF00004.67, U1: RF00003.5, U1: RF00003.109, U1: RF 00003.110, U1: RF00003.8, U1: RF00003.3, U1: RF00003.6, U1: RF00003.38, U1: RF00003.2 0. U1: RF00003.24, U1: RF00003.73, U1: RF00003.11, U1: RF00003.27, U1: RF00003.40, U1: RF00003.107, U1: RF00003.62, U1: RF00003.45, U1: RF00003.116, U1: RF00003.126, U1: RF 00003.81, U1: RF00003.100, U1: RF00003.57, U1: RF00003.95, U1: RF00003.31, U1: RF0000 3.61, U1: RF00003.25, U1: RF00003.90, U1: RF00003.46, U1: RF00003.123, U2: RF00004.42 , U2: RF00004.61, U2: RF00004.51, U1: RF00003.122, U1: RF00003.22, U1: RF00003.9, snoM BII-202: RF00324.2, let-7: RF00027.7, U2: RF00004.75, U1: RF00003.69, U2: RF00004.88,U12: RF00007.1, U7: RF00066.141, U1: RF00003.85, U7: RF00066.49, U2: RF00004.77, U1: RF00003.113, U1: RF00003.112, U1: RF00003.70, U1: RF00003.83, U7: RF00066.89, U7: RF00066.124, U7: RF00066.75, U7:RF00066.77, U7:RF00066.118, U7:RF00066.103, U7:RF00066.79, U7:RF00066.200 and / or U7:RF00066.146, UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41 , EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6GALNAC51, ABCA41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR27 1. NBPF141, TMEM132E1, GAGE131, GAGE2D1, GAGE2D: copy 21, ANKRD5-1, ZNF236-1, ACP1, EPHA1-AS1, FLJ45974, ANKRD30BP2, LINC00340, GRIK1-AS1, LOC440300, CSPG4P8, ADARB2-AS1, MLLT4-AS1, and / or HNRNPU-AS1.

[0136] For example, disclosed herein are methods of modulating an immune response, wherein the modulation increases inflammation, and wherein the two or more RNAs in the composition include at least one mRNA selected from the group consisting of HBII-202, U26, U29, HBII-420, U30, U18A, U81, GSKIP, IFT88, PCDH11X, PCDH11Y, KIAA0226L, PDE11A, PHACTR1, TEX14, DCUN1D2, SIM1, FILIP1, FAM107B, CHADL, ZN F365, MNAT1, CYSTM1, GAS7, HOXB7, ASTN2, LGR5, ZFHX3, MCM7, GRIK1, MAP2, LHFPL3, PTER, STAMBP, CCDC135, PAX9, RPL1 3. ABCA13, DAAM1, OPN1LW, OPN1MW2, CNOT6L, MTRNR2L10, SMC4, RPL4, PSAP, ASIC4, AHCYL1, RD3L, SIGLEC1, SYCE2 and NANS. Also for example, disclosed herein is a method of modulating an immune response, wherein the modulation reduces inflammation, and wherein the two or more RNAs in the composition include at least one miRNA selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7e-5p, hsa-let-7g-5p, hsa-let-7i, hsa-let-7i-5p, hsa-miR-100-5p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-106b-5p, hsa-mir-104, hsa-miR-104b-5p, hsa-mir-106a-5p, hsa-miR-106b-5p, hsa-mir-104, hsa-miR-106d-5p, hsa-mir-104d-5p, hsa-miR-104e-5p, hsa-miR-104e-5p, hsa-miR-104e-5p, hsa-miR-104e-5p, hsa-miR-104e-5p, hsa-miR-104e-5p, hsa-miR-104e-5p, hsa-miR-104e-5p, hsa-miR-104e-5p, hsa-miR-104e-5p, hsa-miR-104e-5p. 5a-5p, hsa-miR-125b-5p, hsa-miR-130a-3p, hsa-mir-130b, hsa-miR-130b-3p, hsa-miR -132-3p, hsa-miR-136-5p, hsa-miR-138-5p, hsa-miR-139-5p, hsa-mir-140, hsa-miR-14 0-3p, hsa-miR-145-5p, hsa-mir-146a, hsa-miR-146a-5p, hsa-miR-148a-3p, hsa-miR-15 2-3p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-mir-16-1, hsa-mir-16-2, hsa-miR-16-5p,hsa-miR-17-5p, hsa-miR-181a-5p, hsa-miR-191-5p, hsa-miR-193a-5p, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-199a-3p, and hsa-miR-199a-5p hsa-miR-199b-5p, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-20a-5p, hsa-miR-203a, hsa-miR-203a-3p, hsa-miR-214-3p, hsa-miR-21, hsa-miR-21-3p, hsa-miR-21-5p, hsa-miR-221, hsa-miR-221-3p, hsa-miR-222, hsa-miR-222-3p, hsa-miR-22-3p, hsa-miR-23a-3p, hsa-miR-23b-3p, and hsa-mi R-24-1, R-24-2, R-24-3p, R-25, R-25-3p, R-26a-5p, R-27a-3p, R-27b, R-27b-3p, R-29a-3p, R-29c-3p, R-30a-5p, R-30a-5p, R-30b-5p, R-30c-5p, R-30d, R-30d-5p, R-30e, R-29a-3p, R-30c-5p ... -miR-30e-5p, hsa-miR-31-3p, hsa-miR-31-5p, hsa-miR-320a, hsa-miR-342-3p, hsa-miR-345-5p, hsa-miR-34a-5p, hsa-miR-361-5p, hsa-miR-376a-3p, hsa-miR-376c-3p, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424-5p, hsa-miR-484, hsa-miR-486-1, hsa-miR-486-2, hsa-miR-486-5p, hsa -miR-570-3p, hsa-miR-574-3p, hsa-miR-663a, hsa-miR-874-3p, hsa-miR-92a-1, hsa-miR-92a-2, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-miR-93hsa-miR-93-5p, hsa-miR-940, hsa-miR-99a-5p and hsa-miR-99b-5p. ,

[0137] D. Methods for treating autoimmune diseases

[0138] As described above, the secretome and RNA compositions disclosed herein can modulate inflammation and prevent inflammation-driven destruction associated with diseases including autoimmune diseases. Therefore, the disclosed compositions can be used to treat autoimmune diseases or their inflammatory symptoms. As used herein, "autoimmune disease" refers to a group of diseases, disorders or conditions caused by an adaptive immune response (T cell and / or B cell response) to a host organism. In this case, whether due to mutation or other potential causes, host T cells and / or B cells and / or antibodies are no longer able to distinguish host cells from non-self antigens and attack host cells carrying their specific antigens. Examples of autoimmune diseases include, but are not limited to, graft-versus-host disease, transplant rejection, achalasia, acute disseminated encephalomyelitis, acute motor axonal neuropathy, Addison's disease, obesity, adult-onset Still's disease, agammaglobulinemia, alopecia areata, Alzheimer's disease, amyloidosis, ankylosing spondylitis, anti-GBM / anti-TBM nephritis, antiphospholipid syndrome, aplastic anemia, autoimmune angioedema, autoimmune autonomic dysfunction, autoimmune encephalomyelitis, autoimmune enteropathy, autoimmune hemolytic anemia, autoimmune liver disease, and Inflammation, autoimmune inner ear disease (AIED), autoimmune myocarditis, autoimmune oophoritis, autoimmune orchitis, autoimmune pancreatitis, autoimmune polyendocrine syndrome, autoimmune retinopathy, autoimmune urticaria, axonal and neuronal neuropathy (AMAN), Baló disease, Behcet's disease, benign mucous membrane pemphigoid, Bickerstaff encephalitis, bullous pemphigoid, giant lymphadenopathy (CD), celiac disease, Chagas disease, chronic fatigue syndrome, chronic inflammatory demyelinating polymyelitis Neuropathy (CIDP), chronic recurrent multifocal osteomyelitis (CRMO), Churg-Strauss syndrome (CSS), eosinophilic granuloma (EGPA), cicatricial pemphigoid, Cogan syndrome, cold agglutinin disease, congenital heart block, coxsackievirus myocarditis, CREST syndrome, Crohn's disease, dermatitis herpetiformis, dermatomyositis, Devic's disease (neuromyelitis optica), type 1 diabetes, discoid lupus, Dressler syndrome, endometriosis, enthesitis, Eosinophilic esophagitis (EoE), eosinophilic fasciitis, erythema nodosum, essential mixed cryoglobulinemia, Evans syndrome, Felty syndrome, fibromyalgia, fibrosing alveolitis, giant cell arteritis (temporal arteritis), giant cell myocarditis, glomerulonephritis, Goodpasture syndrome, granulomatosis with polyangiitis, Graves disease, Guillain-Barré syndrome, Hashimoto's encephalopathy, Hashimoto's thyroiditis, hemolytic anemia, Henoch-Schonlein purpura (HSP), herpes gestationis or pemphigoid gestationis (PG),Hidradenitis suppurativa (HS) (inverse acne), hypogammaglobulinemia, IgA nephropathy, IgG4-related sclerosing disease, immune thrombocytopenic purpura (ITP), inclusion body myositis (IBM), interstitial cystitis (IC), inflammatory bowel disease (IBD), juvenile arthritis, juvenile diabetes mellitus (type 1 diabetes), juvenile myositis (JM), Kawasaki disease, Lambert-Eaton syndrome, leukocytic vasculitis, lichen planus, atrophic lichen sclerosus, woody conjunctivitis, thread IgA disease (LAD), lupus nephritis, lupus vasculitis, chronic Lyme disease, Meniere's disease, microscopic polyangiitis (MPA), mixed connective tissue disease (MCTD), Mooren's corneal ulcer, Mucha-Habermann disease, multifocal motor neuropathy (MMN) or MMNCB, multiple sclerosis, myasthenia gravis, myositis, narcolepsy, neonatal lupus, neuromyelitis optica, neutropenia, ocular cicatricial pemphigoid, optic neuritis, Ord's thyroiditis, relapsing rheumatic disease (PR), PANDAS, paraneoplastic cerebellar degeneration (PCD), paroxysmal nocturnal hemoglobinuria (PNH), Parry's Romberg syndrome, cycloplanitis (peripheral uveitis), Parsonnage-Turner syndrome, pemphigus, peripheral neuropathy, perivenous encephalomyelitis, pernicious anemia (PA), POEMS syndrome, polyarteritis nodosa, polyglandular syndromes I, II, and III, polymyalgia rheumatica, polymyositis, post-myocardial infarction syndrome, postpericardiotomy syndrome, primary biliary cirrhosis, primary sclerosing cholangitis, progestogen dermatitis, psoriasis, psoriatic arthritis, pure red cell aplasia (PRCA), pyoderma gangrenosum, Raynaud's phenomenon, reactive arthritis, reflex sympathetic dystrophy, relapsing polychondritis, restless legs syndrome (RLS), retroperitoneal fibrosis, rheumatic fever, rheumatoid arthritis, rheumatoid vascular disease In one aspect, the present invention discloses a method of treating, inhibiting, reducing, alleviating, reducing, or mitigating an infection in a patient with a disease such as leukemia, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukoderma, leukodermaA method for improving and / or preventing an autoimmune disease or an inflammatory symptom associated with an autoimmune disease in a subject suffering from an autoimmune disease, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the RNA molecules include hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7e-5p, hsa-let-7g-5p, hsa-let-7i-3p, hsa-let-7e-5p, hsa-let-7g-5p, hsa-let-7i-3p , hsa-let-7i-5p, hsa-miR-100-5p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-106b-5p, hsa-mir-10b, hsa-miR-10b-5p, hsa-mir-1246, hsa-mi R-1246, hsa-miR-125a-5p, hsa-miR-125b-5p, hsa-miR-130a-3p, hsa-mir-130b, hsa-miR-130b-3p, hsa-miR-132-3p, hsa-miR-136-5p, hsa-miR-138 -5p, hsa-miR-139-5p, hsa-mir-140, hsa-miR-140-3p, hsa-miR-145-5p, hsa-mir-146a, hsa-miR-146a-5p, hsa-miR-148a-3p, hsa-miR-152-3p, hsa -miR-15a-5p, hsa-miR-15b-5p, hsa-mir-16-1, hsa-mir-16-2, hsa-miR-16-5p, hsa-miR-17-5p, hsa-miR-181a-5p, hsa-miR-191-5p, hsa-miR-193a- 5p, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-199a-3p, hsa-miR-199a-5p, hsa-miR-199b-5p, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-20a- 5p, hsa-miR-203a, hsa-miR-203a-3p, hsa-miR-214-3p, hsa-mir-21, hsa-miR-21-3p, hsa-miR-21-5p, hsa-mir-221, hsa-miR-221-3p, hsa-mir-222,hsa-miR-222-3p, hsa-miR-22-3p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-miR-24-1, hsa-miR-24-2, hsa-miR-24-3p, hsa-miR-25, hsa-miR-25-3p, hsa-miR-26a-5p, hsa-miR-27a-3p, hsa-miR-27b, hsa-miR-27b-3p, hsa-miR-29a-3p, hsa-miR-29c-3p, hsa-miR-30a-5p, hsa-miR-30a-5p, hsa-miR -30b-5p、hsa-miR-30c-5p、hsa-mir-30d、hsa-miR-30d-5p、hsa-mir-30e、 hsa-miR-30e-5p、hsa-miR-31-3p、hsa-miR-31-5p、hsa-miR-320a、hsa-mi R-342-3p, hsa-miR-345-5p, hsa-miR-34a-5p, hsa-miR-361-5p, hsa-miR-376a-3p, hsa-miR-376c-3p, hsa-miR-423-3p, hsa-miR-423-5p, and hsa-miR-4 24-5p, hsa-miR-484, hsa-miR-486-1, hsa-miR-486-2, hsa-miR-486-5p, hsa-miR-570-3p, hsa-miR-574-3p, hsa-miR-663a, hsa-miR-874-3p, and hsa-m IR-92a-1, hsa-mir-92a-2, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-miR-93, hsa-miR-93-5p, hsa-miR-940, hsa-miR-99a-5p, hsa-miR-99b-5p, HBII- 202、U26、U29、HBII-420、U30、U18A、U81、GSKIP、IFT88、PCDH11X、PCDH11Y、 KIAA0226L、PDE11A、PHACTR1、TEX14、DCUN1D2、SIM1、FILIP1、FAM107B、CHA DL、ZNF365、MNAT1、CYSTM1、GAS7、HOXB7、ASTN2、LGR5、ZFHX3、MCM7、GRIK1、 MAP2、LHFPL3、PTER、STAMBP、CCDC135、PAX9、RPL13、ABCA13、DAAM1、OPN1LW、OPN1MW2, CNOT6L, MTRNR2L10, SMC4, RPL4, PSAP, ASIC4, AHCYL1, RD3L, SIGLEC1, SYCE2, NANS, LOC100129335-5, ZNF23 8. CADM2-7, SALL1-6, VWA5A, RF00019.441, RF00019.451, RF00019.621, RF00019.646, RF00019.413, piR-33044, piR -33043, piR-31703, RNY4, LOC441666, SNHG1, RNU11, LOC80154, LOC727751, LOC388152, GOLGA2P2Y, GOLGA2P3Y, SNHG 12. RNU12, ASMTL-AS1, LOC284454U2: RF00004.39, U2: RF00004.22, U2: RF00004.35, U2: RF00004.71, U2: RF00004.66 U2: RF00004.91, U2: RF00004.89, U2: RF00004.67, U1: RF00003.5, U1: RF00003.109, U1: RF 00003.110, U1: RF00003.8, U1: RF00003.3, U1: RF00003.6, U1: RF00003.38, U1: RF00003.2 0. U1: RF00003.24, U1: RF00003.73, U1: RF00003.11, U1: RF00003.27, U1: RF00003.40, U1: RF00003.107, U1: RF00003.62, U1: RF00003.45, U1: RF00003.116, U1: RF00003.126, U1: RF 00003.81, U1: RF00003.100, U1: RF00003.57, U1: RF00003.95, U1: RF00003.31, U1: RF0000 3.61, U1: RF00003.25, U1: RF00003.90, U1: RF00003.46, U1: RF00003.123, U2: RF00004.42 , U2: RF00004.61, U2: RF00004.51, U1: RF00003.122, U1: RF00003.22, U1: RF00003.9, snoM BII-202: RF00324.2, let-7: RF00027.7, U2: RF00004.75, U1: RF00003.69, U2: RF00004.88,U12: RF00007.1, U7: RF00066.141, U1: RF00003.85, U7: RF00066.49, U2: RF00004.77, U1: RF00003.113, U1: RF00003.112, U1: RF00003.70, U1: RF00003.83, U7: RF00066.89, U7: RF00066.124, U7: RF00066.75, U 7:RF00066.77, U7:RF00066.118, U7:RF00066.103, U7:RF00066.79, U7:RF00066.200, and / or U7:RF00066.146, UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41 , EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6GALNAC51, ABCA41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR27 1. NBPF141, TMEM132E1, GAGE131, GAGE2D1, GAGE2D: copy 21, ANKRD5-1, ZNF236-1, ACP1, EPHA1-AS1, FLJ45974, ANKRD30BP2, LINC00340, GRIK1-AS1, LOC440300, CSPG4P8, ADARB2-AS1, MLLT4-AS1, and / or HNRNPU-AS1. For example, disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing an autoimmune disease or an inflammatory symptom associated with an autoimmune disease in a subject having an autoimmune disease, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one miRNA selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7e-5p, hsa-let-7g-5p, hsa-let-7i, hsa-let-7i-5p,hsa-miR-100-5p、hsa-miR-103a-3p、hsa-miR-106a-5p、hsa-miR-106b-5 p、hsa-mir-10b、hsa-miR-10b-5p、hsa-mir-1246、hsa-miR-1246、hsa-miR -125a-5p、hsa-miR-125b-5p、hsa-miR-130a-3p、hsa-mir-130b、hsa-miR- 130b-3p、hsa-miR-132-3p、hsa-miR-136-5p、hsa-miR-138-5p、hsa-miR-1 39-5p, hsa-mir-140, hsa-miR-140-3p, hsa-miR-145-5p, hsa-mir-146a, hsa-miR-146a-5p, hsa-miR-148a-3p, hsa-miR-152-3p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-miR-16-1, hsa-miR-16-2, hsa-miR-16-5p, hsa-miR-17-5p, hsa-miR-181a-5p, hsa-miR-191-5p, hsa-miR-193a-5p, hsa-miR- 193b-3p, hsa-miR-197-3p, hsa-miR-199a-3p, hsa-miR-199a-5p, hsa-miR-199b-5p, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-20a-5p, hsa-miR-203a, hsa-miR-203a-3p, hsa-miR-214-3p, hsa-miR-21, hsa-miR-21-3p, hsa-miR-21-5p, hsa-miR-221, hsa-miR-221-3p, hsa-miR-222, hsa-miR-2 22-3p, hsa-miR-22-3p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-miR-24-1, hsa-miR-24-2, hsa-miR-24-3p, hsa-miR-25, hsa-miR-25-3p, hsa-miR- 26a-5p、hsa-miR-27a-3p、hsa-mir-27b、hsa-miR-27b-3p、hsa-miR-29a-3 p、hsa-miR-29c-3p、hsa-miR-30a-5p、hsa-miR-30a-5p、hsa-miR-30b-5p、hsa-miR-30c-5p, hsa-mir-30d, hsa-miR-30d-5p, hsa-mir-30e, hsa-miR-30e-5p, hsa-miR-31-3p, hsa-miR-31-5p, hsa-miR-320a, hsa-miR-342 -3p, hsa-miR-345-5p, hsa-miR-34a-5p, hsa-miR-361-5p, hsa-miR-376a-3p, hsa-miR-376c-3p, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-42 4-5p, hsa-miR-484, hsa-mir-486-1, hsa-mir-486-2, hsa-miR-486-5p, hsa-miR-570-3p, hsa-miR-574-3p, hsa-miR-663a, hsa-miR-874-3p, hsa -mir-92a-1, hsa-mir-92a-2, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-mir-93, hsa-miR-93-5p, hsa-miR-940, hsa-miR-99a-5p and hsa-miR-99b-5p. Preferably, disclosed herein is a composition wherein the two or more RNAs include at least one miRNA selected from the group consisting of miR-92a-3p, let-7i-5p, miR-16-5p, miR-93-5p, miR-21-5p, miR-214-3p, miR-29c-3p, miR-34a-5p, mir-203a-3p, miR-27b-3p, miR-140-3p, miR-24-3p, miR-222-3p, miR-25-3p, miR-10b-5p, miR-221-3p, miR-17-5p, miR-30a-5p and miR-30d-5p. Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing an autoimmune disease or an inflammatory symptom associated with an autoimmune disease in a subject suffering from an autoimmune disease, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs comprise at least one mRNA selected from the group consisting of HBII-202, U26, U29, HBII-420, U30, U18A, U81, GSKIP, IFT88, PCDH11X, PCDH11Y, KIAA0226L,PDE11A, PHACTR1, TEX14, DCUN1D2, SIM1, FILIP1, FAM107B, CHADL, ZNF365, MNAT1, CYSTM1, GAS7, HOXB7, ASTN2, LGR5, ZFHX3, MCM7, GRIK1, MAP2, LHFPL3, P TER, STAMBP, CCDC135, PAX9, RPL13, ABCA13, DAAM1, OPN1LW, OPN1MW2, CNOT6L, MTRNR2L10, SMC4, RPL4, PSAP, ASIC4, AHCYL1, RD3L, SIGLEC1, SYCE2 and NANS. Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing an autoimmune disease or an inflammatory symptom associated with an autoimmune disease in a subject suffering from an autoimmune disease, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one y-RNA selected from the group consisting of RF00019.441, RF00019.451, RF00019.621, RF00019.646 and RF00019.413. Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing an autoimmune disease or an inflammatory symptom associated with an autoimmune disease in a subject having an autoimmune disease, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs comprise at least one lncRNA selected from the group consisting of LOC100129335-5, ZNF238, CADM2-7, SALL1-6 and VWA5A. Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing an autoimmune disease or inflammatory symptoms associated with an autoimmune disease in a subject suffering from an autoimmune disease, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs comprise at least one pi-RNA selected from the group consisting of piR-33044, piR-33043 and piR-31703. In one aspect, the RNA can be an antisense RNA. Therefore, also disclosed herein are methods for treating, inhibiting, reducing, alleviating, improving and / or preventing an autoimmune disease or inflammatory symptoms associated with an autoimmune disease in a subject suffering from an autoimmune disease.A method for reducing, alleviating, ameliorating and / or preventing an autoimmune disease or an inflammatory symptom associated with an autoimmune disease in a subject having an autoimmune disease, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs comprise at least one antisense mRNA selected from the group consisting of UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10or f531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6GALNAC51, ABCA41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1, and GAGE2D: 21, an antisense lnRNA selected from the group consisting of ANKRD5-1, ZNF236-1, and ACP1, and / or an antisense RNA selected from the group consisting of UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6 GALNAC51, ABCA41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1, GAGE2D: copy 21, ANKRD5-1, ZNF236-1, ACP1, EPHA1-AS1, FLJ45974, ANKRD30BP2, LINC00340, GRIK1-AS1, LOC440300, CSPG4P8, ADARB2-AS1, MLLT4-AS1, and / or HNRNPU-AS1.

[0139] E. Methods of treating autoinflammatory diseases

[0140] The compositions disclosed herein comprising secretomes and RNA are not limited to treating inflammation caused by adaptive immune responses, but are also effective in preventing inflammation-driven destruction associated with innate errors of innate immune responses (i.e., constitutive inflammation that underlies autoinflammatory diseases). As used herein, "autoinflammatory diseases" refer to conditions in which the innate immune response attacks host cells. Examples of autoinflammatory conditions include familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), neonatal-onset multisystem inflammatory disease (NOMID) (also known as chronic infantile neurocutaneous articular syndrome (CINCA)), familial Mediterranean fever (FMF) and other cold-inflammatory-associated periodic syndromes (CAPS), tumor necrosis factor (TNF)-associated periodic syndromes (TRAPS), TNFRSF11A-associated hereditary fever disease (TRAPS11), hyperimmunoglobulinemia D with periodic fever syndrome (HIDS), mevalonic aciduria (MA), mevalonic acid kinase deficiency (MKD), interleukin-1β (IL-1β) receptor antagonist deficiency (DIRA) (also known as sterile multifocal osteomyelitis with periostitis pustulosis), Majeed syndrome, chronic nonbacterial osteomyelitis (CNO), early-onset inflammatory bowel disease, diverticulitis, interleukin-36 receptor antagonist deficiency (DITRA), familial psoriasis (PSORS2), pustular psoriasis (15), suppurative sterile arthritis, pyoderma gangrenosum and acne syndrome (PAPA), congenital sideroblastic anemia with immunodeficiency, fever and developmental delay (SIFD), childhood granulomatous arthritis (PGA), familial The disease is also known to occur in a variety of autoinflammatory disorders, including spondylodysplasia with spondylochondrodysplasia associated with immune dysregulation (SPENCDI), STING-associated vasculopathy of infancy (SAVI), Aicardi-Goutieres syndrome and other type 1 interferonopathies, acute febrile neutrophilic dermatosis, X-linked familial hemophagocytic lymphohistiocytosis, Lyn kinase-associated autoinflammatory disease (LAID), and intestinal and skin inflammatory disorders caused by deletion mutations in the carboxyl-terminal fragment of NF-KB essential regulator (NEMO). In one aspect, disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing an autoinflammatory disease or an inflammatory symptom associated with an autoinflammatory disease in a subject, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the RNA molecules include hsa-let-7a-5p, hsa-let- 7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7e-5p, hsa-let-7g-5p, hsa-let-7i, hsa-let-7i-5p, hsa-miR- 100-5p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-106b-5p, hsa-mir-10b, hsa-miR-10b-5p, hsa-mir-1246, h sa-miR-1246, hsa-miR-125a-5p, hsa-miR-125b-5p, hsa-miR-130a-3p, hsa-mir-130b, hsa-miR-130b-3p, hsa-mi R-132-3p, hsa-miR-136-5p, hsa-miR-138-5p, hsa-miR-139-5p, hsa-mir-140, hsa-miR-140-3p, hsa-miR-145-5p, hsa-mir-146a, hsa-miR-146a-5p, hsa-miR-148a-3p, hsa-miR-152-3p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-m ir-16-1, hsa-mir-16-2, hsa-miR-16-5p, hsa-miR-17-5p, hsa-miR-181a-5p, hsa-miR-191-5p, hsa-miR-193a-5p,hsa-miR-193b-3p、hsa-miR-197-3p、hsa-miR-199a-3p、hsa-miR-199a-5p 、hsa-miR-199b-5p、hsa-miR-19a-3p、hsa-miR-19b-3p、hsa-miR-20a-5p、h sa-miR-203a, hsa-miR-203a-3p, hsa-miR-214-3p, hsa-mir-21, hsa-miR-21-3p, hsa-miR-21-5p, hsa-mir-221, hsa-miR-221-3p, hsa-miR-222, hsa-miR-222-3p, hsa-miR-22-3p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-mir-24-1, hsa-mir-24-2, hsa-miR-24-3p, hsa-mir-25, hsa-miR-25-3p, and hsa-m iR-26a-5p, hsa-miR-27a-3p, hsa-miR-27b, hsa-miR-27b-3p, hsa-miR-29a-3p, hsa-miR-29c-3p, hsa-miR-30a-5p, hsa-miR-30a-5p, and hsa-miR-30b-5 p、hsa-miR-30c-5p、hsa-mir-30d、hsa-miR-30d-5p、hsa-mir-30e、hsa-mi R-30e-5p、hsa-miR-31-3p、hsa-miR-31-5p、hsa-miR-320a、hsa-miR-342-3 p, hsa-miR-345-5p, hsa-miR-34a-5p, hsa-miR-361-5p, hsa-miR-376a-3p, hsa-miR-376c-3p, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424-5p, h sa-miR-484, hsa-miR-486-1, hsa-miR-486-2, hsa-miR-486-5p, hsa-miR-570-3p, hsa-miR-574-3p, hsa-miR-663a, hsa-miR-874-3p, and hsa-miR-92a-1 hsa-mir-92a-2, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-mir-93, hsa-miR-93-5p, hsa-miR-940, hsa-miR-99a-5p, hsa-miR-99b-5p, HBII-202, U26U29、HBII-420、U30、U18A、U81、GSKIP、IFT88、PCDH11X、PCDH11Y、KIAA0226L、PDE11A 、PHACTR1、TEX14、DCUN1D2、SIM1、FILIP1、FAM107B、CHADL、ZNF365、MNAT1、CYSTM1、G AS7、HOXB7、ASTN2、LGR5、ZFHX3、MCM7、GRIK1、MAP2、LHFPL3、PTER、STAMBP、CCDC135、 PAX9、RPL13、ABCA13、DAAM1、OPN1LW、OPN1MW2、CNOT6L、MTRNR2L10、SMC4、RPL4、PSAP 、ASIC4、AHCYL1、RD3L、SIGLEC1、SYCE2、NANS、LOC100129335-5、ZNF238、CADM2-7、SA LL1-6、VWA5A、RF00019.441、RF00019.451、RF00019.621、RF00019.646、RF00019.41 3、piR-33044、piR-33043、piR-31703、RNY4、LOC441666、SNHG1、RNU11、LOC80154、LO C727751、LOC388152、GOLGA2P2Y、GOLGA2P3Y、SNHG12、RNU12、ASMTL-AS1、LOC284454 U2:RF00004.39、U2:RF00004.22、U2:RF00004.35、U2:RF00004.71、U2:RF00004.66 U2:RF00004.91、U2:RF00004.89、U2:RF00004.67、U1:RF00003.5、U1:RF00003.109、U1:RF1100003. 0003.8、U1:RF00003.3、U1:RF00003.6、U1:RF00003.38、U1:RF00003.20、U1:RF00003.24.U3、3、U1: RF00003.11、U1:RF00003.27、U1:RF00003.40、U1:RF00003.107、U1:RF00003.62、U1:RF00:0003.45 3.116、U1:RF00003.126、U1:RF00003.81、U1:RF00003.100、U1:RF00003.57、U1:RF00003.30.95、U1:RF00003.95、U1U1: RF00003.61, U1: RF00003.25, U1: RF00003.90, U1: RF00003.46, U1: RF00003.123, U2: RF00004.42, U2: RF00004.61, U2: RF00004.51, U1 : RF00003.122, U1: RF00003.22, U1: RF00003.9, snoMBII-202: RF00324.2, let-7: RF00027.7, U2: RF00004.75, U1: RF00003.69, U2: RF00004 .88, U12: RF00007.1, U7: RF00066.141, U1: RF00003.85, U7: RF00066.49, U2: RF00004.77, U1: RF00003.113, U1: RF00003.112, U1: RF00003. 70. U1: RF00003.83, U7: RF00066.89, U7: RF00066.124, U7: RF00066.75, U7: RF00066.77, U7: RF00066.118, U7: RF00066.103, U7: RF00066.7 9. U7: RF00066.200 and / or U7: RF00066.146, UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6GALNAC51, ABCA41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1, GAGE2D: copy 21, ANKRD5-1, ZNF236-1, ACP1, EPHA1-AS1, FLJ45974, ANKRD30BP2, LINC00340, GRIK1-AS1, LOC440300, CSPG4P8, ADARB2-AS1, MLLT4-AS1, and / or HNRNPU-AS1. For example, disclosed herein are methods of treating, inhibiting, reducing, alleviating,A method for improving and / or preventing an autoinflammatory disease or an inflammatory symptom associated with an autoinflammatory disease in a subject suffering from an autoinflammatory disease, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs comprise at least one miRNA selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7e-5p, hsa -let-7g-5p, hsa-let-7i, hsa-let-7i-5p, hsa-miR-100-5p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-106b-5p, hsa-mir-10b, hsa-miR-10b- 5p, hsa-mir-1246, hsa-miR-1246, hsa-miR-125a-5p, hsa-miR-125b-5p, hsa-miR-130a-3p, hsa-mir-130b, hsa-miR-130b-3p, hsa-miR-132-3p, hsa -miR-136-5p, hsa-miR-138-5p, hsa-miR-139-5p, hsa-mir-140, hsa-miR-140-3p, hsa-miR-145-5p, hsa-mir-146a, hsa-miR-146a-5p, hsa-miR-14 8a-3p, hsa-miR-152-3p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-mir-16-1, hsa-mir-16-2, hsa-miR-16-5p, hsa-miR-17-5p, hsa-miR-181a-5p, hsa -miR-191-5p, hsa-miR-193a-5p, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-199a-3p, hsa-miR-199a-5p, hsa-miR-199b-5p, hsa-miR-19a-3p, h sa-miR-19b-3p, hsa-miR-20a-5p, hsa-miR-203a, hsa-miR-203a-3p, hsa-miR-214-3p, hsa-mir-21, hsa-miR-21-3p, hsa-miR-21-5p, hsa-mir-221,hsa-miR-221-3p, hsa-mir-222, hsa-miR-222-3p, hsa-miR-22-3p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-mir-24 -1, hsa-mir-24-2, hsa-miR-24-3p, hsa-mir-25, hsa-miR-25-3p, hsa-miR-26a-5p, hsa-miR-27a-3p, hsa-mir-27b , hsa-miR-27b-3p, hsa-miR-29a-3p, hsa-miR-29c-3p, hsa-miR-30a-5p, hsa-miR-30a-5p, hsa-miR-30b-5p, hsa-m iR-30c-5p, hsa-mir-30d, hsa-miR-30d-5p, hsa-mir-30e, hsa-miR-30e-5p, hsa-miR-31-3p, hsa-miR-31-5p, hsa- miR-320a, hsa-miR-342-3p, hsa-miR-345-5p, hsa-miR-34a-5p, hsa-miR-361-5p, hsa-miR-376a-3p, hsa-miR-376 c-3p, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424-5p, hsa-miR-484, hsa-mir-486-1, hsa-mir-486-2, hsa-mi R-486-5p, hsa-miR-570-3p, hsa-miR-574-3p, hsa-miR-663a, hsa-miR-874-3p, hsa-mir-92a-1, hsa-mir-92a-2, h sa-miR-92a-3p, hsa-miR-92b-3p, hsa-mir-93, hsa-miR-93-5p, hsa-miR-940, hsa-miR-99a-5p and hsa-miR-99b-5p. Preferably, disclosed herein is a composition wherein the two or more RNAs include at least one miRNA selected from the group consisting of miR-92a-3p, let-7i-5p, miR-16-5p, miR-93-5p, miR-21-5p, miR-214-3p, miR-29c-3p, miR-34a-5p, mir-203a-3p, miR-27b-3p, miR-140-3p, miR-24-3p, miR-222-3p, miR-25-3p, miR-10b-5p, miR-221-3p, miR-17-5p,miR-30a-5p and miR-30d-5p.

[0141] Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing an autoinflammatory disease or an inflammatory symptom associated with an autoinflammatory disease in a subject suffering from an autoinflammatory disease, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to a composition comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one mRNA selected from the group consisting of HBII-202, U26, U29, HBII-420, U30, U18A, U81, GSKIP, IFT88, PCDH11X, PCDH11Y, KIA A0226L, PDE11A, PHACTR1, TEX14, DCUN1D2, SIM1, FILIP1, FAM107B, CHADL, ZNF365, MNAT1, CYSTM1, GAS7, HOXB7, ASTN2, LGR5, ZFHX3, MCM7, GRIK1, MAP2, LHFP L3, PTER, STAMBP, CCDC135, PAX9, RPL13, ABCA13, DAAM1, OPN1LW, OPN1MW2, CNOT6L, MTRNR2L10, SMC4, RPL4, PSAP, ASIC4, AHCYL1, RD3L, SIGLEC1, SYCE2 and NANS. Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing an autoinflammatory disease or an inflammatory symptom associated with an autoinflammatory disease in a subject suffering from an autoinflammatory disease, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one y-RNA selected from the group consisting of RF00019.441, RF00019.451, RF00019.621, RF00019.646 and RF00019.413.Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing an autoinflammatory disease or an inflammatory symptom associated with an autoinflammatory disease in a subject suffering from an autoinflammatory disease, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one lncRNA selected from the group consisting of LOC100129335-5, ZNF238, CADM2-7, SALL1-6 and VWA5A. Also disclosed herein is a method of treating, inhibiting, reducing, alleviating, ameliorating and / or preventing an autoinflammatory disease or an inflammatory symptom associated with an autoinflammatory disease in a subject having an autoinflammatory disease, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one pi-RNA selected from the group consisting of piR-33044, piR-33043 and piR-31703. In one aspect, the RNA can be an antisense RNA.Therefore, the present invention also discloses a method for treating, inhibiting, reducing, alleviating, improving and / or preventing an autoinflammatory disease or an inflammatory symptom associated with an autoinflammatory disease in a subject suffering from an autoinflammatory disease, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs comprise at least one antisense mRNA selected from the group consisting of UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, C DKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, S LC44A51, CLCN51, ST6GALNAC51, ABCA41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1 and G AGE2D: copy 21, antisense lnRNA selected from the group consisting of ANKRD5-1, ZNF236-1, and ACP1 and / or antisense RNA selected from the group consisting of UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51 , ST6GALNAC51, ABCA41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1, GAGE2D: copy 21, ANKRD5-1, ZNF236-1, ACP1, EPHA1-AS1, FLJ45974, ANKRD30BP2, LINC00340, GRIK1-AS1, LOC440300, CSPG4P8, ADARB2-AS1, MLLT4-AS1, and / or HNRNPU-AS1.

[0142] F. Methods of treating physical injury that causes inflammation in the body or post-traumatic inflammation.

[0143] Many inflammatory conditions are caused by inflammation-mediated physical injuries (e.g., abrasions, punctures, lacerations, contusions, including brain trauma, blunt force trauma, ischemia, surgery, transplantation, sunburn, chemical burns, high temperature burns, low temperature burns, radiation). As described above, the compositions disclosed herein comprising secretomes and RNA can modulate inflammation. Therefore, the novel immunotherapies disclosed herein can prevent inflammation-driven organ damage associated with these physical injuries that cause swelling, redness, elevated body temperature, pain, and loss of organ function. Therefore, in one aspect, disclosed herein is a method for treating, inhibiting, reducing, alleviating, ameliorating and / or preventing inflammation caused by physical injury (e.g., abrasions, punctures, lacerations, contusions, blunt force trauma, ischemia, surgery, transplantation, sunburn, chemical burns, high temperature burns, low temperature burns), comprising administering to a subject suffering from physical injury a therapeutically effective amount of a composition comprising one or more secretomes and two or more RNAs, wherein the RNAs include hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-1 et-7d-3p, hsa-let-7e-5p, hsa-let-7g-5p, hsa-let-7i, hsa-let-7i-5p, hsa-miR-100-5p, hsa-miR-103a-3p, hsa-miR-1 06a-5p, hsa-miR-106b-5p, hsa-mir-10b, hsa-miR-10b-5p, hsa-mir-1246, hsa-miR-1246, hsa-miR-125a-5p, hsa-miR-12 5b-5p, hsa-miR-130a-3p, hsa-mir-130b, hsa-miR-130b-3p, hsa-miR-132-3p, hsa-miR-136-5p, hsa-miR-138-5p, hsa-m iR-139-5p, hsa-mir-140, hsa-miR-140-3p, hsa-miR-145-5p, hsa-mir-146a, hsa-miR-146a-5p, hsa-miR-148a-3p, hsa-m iR-152-3p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-mir-16-1, hsa-mir-16-2, hsa-miR-16-5p, hsa-miR-17-5p, hsa-miR- 181a-5p, hsa-miR-191-5p, hsa-miR-193a-5p, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-199a-3p, hsa-miR-199a-5p,hsa-miR-199b-5p, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-20a-5p, hsa-miR-203a, hsa-miR-203a-3p, hsa-miR-214-3p, hsa-miR-21, hsa-miR-2 1-3p, hsa-miR-21-5p, hsa-miR-221, hsa-miR-221-3p, hsa-miR-222, hsa-miR-222-3p, hsa-miR-22-3p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-miR-24-1, hsa-miR-24-2, hsa-miR-24-3p, hsa-miR-25, hsa-miR-25-3p, hsa-miR-26a-5p, hsa-miR-27a-3p, hsa-miR-27b, hsa-miR-27b-3p, and hsa-miR-29a -3p、hsa-miR-29c-3p、hsa-miR-30a-5p、hsa-miR-30a-5p、hsa-miR-30b-5 p、hsa-miR-30c-5p、hsa-mir-30d、hsa-miR-30d-5p、hsa-mir-30e、hsa-miR -30e-5p, hsa-miR-31-3p, hsa-miR-31-5p, hsa-miR-320a, hsa-miR-342-3p, hsa-miR-345-5p, hsa-miR-34a-5p, hsa-miR-361-5p, and hsa-miR-376a-3p hsa-miR-376c-3p, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424-5p, hsa-miR-484, hsa-miR-486-1, hsa-miR-486-2, hsa-miR-486-5p, hsa-miR-570-3p, hsa-miR-574-3p, hsa-miR-663a, hsa-miR-874-3p, hsa-miR-92a-1, hsa-miR-92a-2, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-miR-93, hsa-miR -93-5p、hsa-miR-940、hsa-miR-99a-5p、hsa-miR-99b-5p、HBII-202、U26、U 29、HBII-420、U30、U18A、U81、GSKIP、IFT88、PCDH11X、PCDH11Y、KIAA0226L、PDE11A、PHACTR1、TEX14、DCUN1D2、SIM1、FILIP1、FAM107B、CHADL、ZNF365、MNAT1、CYSTM1、GAS7、HOXB7、ASTN2、LGR5、ZFHX3、MCM7、GRIK1、MAP2、LHFPL 3、PTER、STAMBP、CCDC135、PAX9、RPL13、ABCA13、DAAM1、OPN1LW、OPN1MW2、CNOT6L、MTRNR2L10、SMC4、RPL4、PSAP、ASIC4、AHCYL1、RD3L、SIGLEC1、SYCE2 、NANS、LOC100129335-5、ZNF238、CADM2-7、SALL1-6、VWA5A、RF00019.441、RF00019.451、RF00019.621、RF00019.646、RF00019.413、piR-33044 33043、piR-31703、RNY4、LOC441666、SNHG1、RNU11、LOC80154、LOC727751、LOC388152、GOLGA2P2Y、GOLGA2P3Y、SNHG12、RNU12、ASMTL-AS1、LOC284454 U2:RF00004.39、U2:RF00004.22、U2:RF00004.35、U2:RF00004.71、U2:RF00004.66 U2:RF00004.91、U2:RF00004.89、U2:RF00004.67、U1:RF00003.5、U1:RF00003.109、U1:RF00003.110、U1:RF00003.8、U1:RF0000 003.3、U1:RF00003.6、U1:RF00003.38、U1:RF00003.20、U1:RF00003.24、U1:RF00003.73、U1:RF00003.11、U1:RF00003.27、U1: RF00003.40、U1:RF00003.107、U1:RF00003.62、U1:RF00003.45、U1:RF00003.116、U1:RF00003.126、U1:RF00003.81、U1:RF00003. 003.100、U1:RF00003.57、U1:RF00003.95、U1:RF00003.31、U1:RF00003.61、U1:RF00003.25、U1:RF00003.90、U1:RF00003.46、U1: RF00003.123, U2: RF00004.42, U2: RF00004.61, U2: RF00004.51, U1: RF00003.122, U1: RF00003.22, U1: RF00003.9, snoMBII-2 02: RF00324.2, let-7: RF00027.7, U2: RF00004.75, U1: RF00003.69, U2: RF00004.88, U12: RF00007.1, U7: RF00066.141, U1: RF0000 3.85, U7: RF00066.49, U2: RF00004.77, U1: RF00003.113, U1: RF00003.112, U1: RF00003.70, U1: RF00003.83, U7: RF00066.89, U7: RF00066.124, U7: RF00066.75, U7: RF00066.77, U7: RF00066.118, U7: RF00066.103, U7: RF00066.79, U7: RF00066.200, and / or U7: RF000 66.146, UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, Z RANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6GALNAC51, ABCA41, COL5A1 1, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1, GAGE2D: copy 21, ANKRD5-1, ZNF236-1, ACP1, EPHA1-AS1, FLJ45974, ANKRD30BP2, LINC00340, GRIK1-AS1, LOC440300, CSPG4P8, ADARB2-AS1, MLLT4-AS1, and HNRNPU-AS1.

[0144] A method for treating, inhibiting, reducing, alleviating, improving and / or preventing inflammation caused by physical injury (e.g., abrasions, punctures, lacerations, contusions, blunt force trauma, ischemia, surgery, transplantation, sunburn, chemical burns, high temperature burns, low temperature burns) comprising administering to a subject suffering from physical injury a therapeutically effective amount of a composition comprising one or more secretomes and two or more RNAs, wherein the two or more RNAs include at least one miRNA selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7e-5p, hsa-let-7g-5 ... sa-let-7i, hsa-let-7i-5p, hsa-miR-100-5p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-106b-5p, hsa-mir-10b, hsa-miR-10b-5p, hsa-mir-12 46. ​​hsa-miR-1246, hsa-miR-125a-5p, hsa-miR-125b-5p, hsa-miR-130a-3p, hsa-mir-130b, hsa-miR-130b-3p, hsa-miR-132-3p, hsa-miR-136-5p, h sa-miR-138-5p, hsa-miR-139-5p, hsa-mir-140, hsa-miR-140-3p, hsa-miR-145-5p, hsa-mir-146a, hsa-miR-146a-5p, hsa-miR-148a-3p, hsa-miR- 152-3p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-mir-16-1, hsa-mir-16-2, hsa-miR-16-5p, hsa-miR-17-5p, hsa-miR-181a-5p, hsa-miR-191-5p, hs a-miR-193a-5p, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-199a-3p, hsa-miR-199a-5p, hsa-miR-199b-5p, hsa-miR-19a-3p, hsa-miR-19b-3p, h sa-miR-20a-5p, hsa-miR-203a, hsa-miR-203a-3p, hsa-miR-214-3p, hsa-mir-21, hsa-miR-21-3p, hsa-miR-21-5p, hsa-mir-221, hsa-miR-221-3p,hsa-mir-222, hsa-miR-222-3p, hsa-miR-22-3p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-mir-24-1, hsa-mir-24 -2, hsa-miR-24-3p, hsa-mir-25, hsa-miR-25-3p, hsa-miR-26a-5p, hsa-miR-27a-3p, hsa-mir-27b, hsa-miR-27 b-3p, hsa-miR-29a-3p, hsa-miR-29c-3p, hsa-miR-30a-5p, hsa-miR-30a-5p, hsa-miR-30b-5p, hsa-miR-30c-5p , hsa-mir-30d, hsa-miR-30d-5p, hsa-mir-30e, hsa-miR-30e-5p, hsa-miR-31-3p, hsa-miR-31-5p, hsa-miR-320 a, hsa-miR-342-3p, hsa-miR-345-5p, hsa-miR-34a-5p, hsa-miR-361-5p, hsa-miR-376a-3p, hsa-miR-376c-3p, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424-5p, hsa-miR-484, hsa-mir-486-1, hsa-mir-486-2, hsa-miR-4 86-5p, hsa-miR-570-3p, hsa-miR-574-3p, hsa-miR-663a, hsa-miR-874-3p, hsa-mir-92a-1, hsa-mir-92a-2, hs a-miR-92a-3p, hsa-miR-92b-3p, hsa-mir-93, hsa-miR-93-5p, hsa-miR-940, hsa-miR-99a-5p and hsa-miR-99b-5p. Preferably, disclosed herein is a composition, wherein the two or more RNAs include at least one miRNA selected from the group consisting of miR-92a-3p, let-7i-5p, miR-16-5p, miR-93-5p, miR-21-5p, miR-214-3p, miR-29c-3p, miR-34a-5p, mir-203a-3p, miR-27b-3p, miR-140-3p, miR-24-3p, miR-222-3p, miR-25-3p, miR-10b-5p, miR-221-3p, miR-17-5p, miR-30a-5p, and miR-30d-5p.

[0145] Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, ameliorating and / or preventing inflammation caused by physical injury (e.g., such as abrasions, punctures, lacerations, contusions, blunt force trauma, ischemia, surgery, transplantation, sunburn, chemical burns, high temperature burns, low temperature burns) or inflammatory symptoms associated with inflammation caused by physical injury (e.g., such as abrasions, punctures, lacerations, contusions, blunt force trauma, ischemia, surgery, transplantation, sunburn, chemical burns, high temperature burns, low temperature burns) in a subject suffering from inflammation caused by physical injury (e.g., such as abrasions, punctures, lacerations, contusions, blunt force trauma, ischemia, surgery, transplantation, sunburn, chemical burns, high temperature burns, low temperature burns), comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs comprise At least one mRNA selected from the group consisting of HBII-202, U26, U29, HBII-420, U30, U18A, U81, GSKIP, IFT88, PCDH11X, PCDH11Y, KIAA0226L, PDE11A, PHACTR1, TEX14, DCUN1D2, SIM1, FILIP1, FAM107B, CHADL, ZNF365, MNAT1, CYSTM1, GAS7, H OXB7, ASTN2, LGR5, ZFHX3, MCM7, GRIK1, MAP2, LHFPL3, PTER, STAMBP, CCDC135, PAX9, RPL13, ABCA13, DAA M1, OPN1LW, OPN1MW2, CNOT6L, MTRNR2L10, SMC4, RPL4, PSAP, ASIC4, AHCYL1, RD3L, SIGLEC1, SYCE2 and NANS. Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, ameliorating and / or preventing inflammation caused by physical injury (e.g., such as abrasions, punctures, lacerations, contusions, blunt force trauma, ischemia, surgery, transplantation, sunburn, chemical burns, high temperature burns, low temperature burns) or inflammatory symptoms associated with inflammation caused by physical injury (e.g., such as abrasions, punctures, lacerations, contusions, blunt force trauma, ischemia, surgery, transplantation, sunburn, chemical burns, high temperature burns, low temperature burns) in a subject suffering from inflammation caused by physical injury (e.g., such as abrasions, punctures, lacerations, contusions, blunt force trauma, ischemia, surgery, transplantation, sunburn, chemical burns, high temperature burns, low temperature burns), comprising administering to the subject a therapeutically effective amount of a composition,The composition comprises one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one y-RNA selected from the following: RF00019.441, RF00019.451, RF00019.621, RF00019.646 and RF00019.413. Also disclosed herein are methods of treating, inhibiting, reducing, alleviating, ameliorating and / or preventing inflammation caused by or associated with physical injury (e.g., such as abrasions, punctures, lacerations, contusions, blunt force trauma, ischemia, surgery, transplantation, sunburn, chemical burns, high temperature burns, low temperature burns) in a subject suffering from inflammation caused by or associated with physical injury (e.g., such as abrasions, punctures, lacerations, contusions, blunt force trauma, ischemia, surgery, transplantation, sunburn, chemical burns, high temperature burns, low temperature burns). A method for treating inflammatory symptoms associated with inflammation caused by chemical burns, high-temperature burns, and low-temperature burns, comprising administering to a subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts, and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one lncRNA selected from the group consisting of LOC100129335-5, ZNF238, CADM2-7, SALL1-6, and VWA5A. Also disclosed herein are methods of treating, inhibiting, reducing, alleviating, ameliorating and / or preventing inflammation caused by physical injury (e.g., such as abrasions, punctures, lacerations, contusions, blunt force trauma, ischemia, surgery, transplants, sunburns, chemical burns, high temperature burns, low temperature burns) or inflammation caused by physical injury (e.g., such as abrasions, punctures, lacerations, contusions, blunt force trauma, ischemia, surgery, transplants, sunburns, chemical burns, high temperature burns, low temperature burns) in a subject suffering from inflammation caused by physical injury (e.g., such as abrasions, punctures, lacerations, contusions, blunt force trauma, ischemia, surgery, transplants, sunburns, chemical burns, high temperature burns, low temperature burns) or inflammation caused by physical injury (e.g., such as abrasions, punctures, lacerations, contusions, blunt force trauma, ischemia, surgery, transplants, sunburns, chemical burns, high temperature burns, low temperature burns). A method for treating inflammatory symptoms associated with inflammation caused by inflammatory injury (eg, transplantation, sunburn, chemical burn, high temperature burn, low temperature burn), comprising administering to a subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one pi-RNA selected from the group consisting of piR-33044, piR-33043, and piR-31703. In one aspect, the RNA may be an antisense RNA. Thus,Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, ameliorating and / or preventing inflammation caused by physical injury (e.g., such as abrasions, punctures, lacerations, contusions, blunt force trauma, ischemia, surgery, transplantation, sunburn, chemical burns, high temperature burns, low temperature burns) or inflammatory symptoms associated with inflammation caused by physical injury (e.g., such as abrasions, punctures, lacerations, contusions, blunt force trauma, ischemia, surgery, transplantation, sunburn, chemical burns, high temperature burns, low temperature burns) in a subject suffering from inflammation caused by physical injury (e.g., such as abrasions, punctures, lacerations, contusions, blunt force trauma, ischemia, surgery, transplantation, sunburn, chemical burns, high temperature burns, low temperature burns), comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, The two or more RNAs include at least one antisense mRNA selected from the group consisting of UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6GALNAC51, ABCA41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1 and GAGE2D: 21 copies,An antisense lnRNA selected from the group consisting of ANKRD5-1, ZNF236-1, and ACP1 and / or an antisense RNA selected from the group consisting of UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6GA LNAC51, ABCA41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1, GAGE2D: copy 21, ANKRD5-1, ZNF236-1, ACP1, EPHA1-AS1, FLJ45974, ANKRD30BP2, LINC00340, GRIK1-AS1, LOC440300, CSPG4P8, ADARB2-AS1, MLLT4-AS1, and / or HNRNPU-AS1.

[0146] In one aspect, it is understood and contemplated herein that one method of treating wounds is by administering a secretome (including but not limited to a composition comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and RNA compositions subcutaneously, intramuscularly, intravenously, topically (such as by using an ointment, cream and / or an ointment, for example), but also by impregnating a stent, sponge, matrix, scaffold, bandage, dressing, suture, graft, surgical drape, surgical adhesive and / or staple with the MSC secretome composition. Thus, in one aspect, disclosed herein is a medicated stent, scaffold, sponge, matrix, adhesive bandage, wound dressing, graft, surgical drape, suture, ointment, cream or wound adhesive comprising a therapeutically effective amount of a MSC secretome composition. As described above, the MSC secretome composition (including but not limited to a composition comprising MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) can be administered topically and applied to the face, neck, hands or any other desired part of the body. When applied to an adhesive bandage, wound dressing, graft, surgical drape, suture, scaffold, matrix, sponge or scaffold, the MSC secretome composition can be applied as a powder.

[0147] G. Methods of treating microbial diseases

[0148] In response to infection by microorganisms (such as viruses, bacteria, fungi or parasites, for example), the host immune system attempts to eliminate the infecting microorganisms by utilizing branches of the innate and adaptive immune systems, including the production of cytokines, antibodies and effector mechanisms of granulocytes, monocytes, macrophages, dendritic cells, innate lymphocytes, NK cells, NK T cells, T cells, B cells and plasma cells. In any microbial inflammation, the inflammatory signal transduction cascade initiated by the response of cells to microbial virulence factors and endogenous cytokines ultimately leads to the nuclear translocation of stress response transcription factors (SRTFs), thereby upregulating inflammatory gene networks. If uncontrolled, this genomic reprogramming (genomic storm) can lead to endothelial dysfunction, multiple organ failure, and ultimately to fatal shock, i.e., septic shock, which is the final stage of microbial inflammation and one of the top ten causes of death in developed and developing countries.

[0149] "Microbial inflammation" refers to a condition associated with its main symptoms such as redness, swelling, elevated temperature, pain and impaired organ function, such as respiratory disorders caused by damage to the lung (and other organs) epithelium and adjacent microvascular endothelial damage due to microbial infection such as viruses, bacteria, fungi or parasites. In other words, "microbial inflammation" is a disease mechanism caused by infection ("microbial damage"). Microbial inflammation evolves from the innate immune response caused by infection with microorganisms (such as viruses, bacteria, fungi or parasites, for example). Therefore, microbial damage caused by microbial virulence factors is aggravated by inflammatory mediators produced by the host, which hinder the clearance of invading microorganisms and aggravate organ damage. It is understood and contemplated herein that microbial inflammation and its terminal stage sepsis can be caused by any microbial damage caused by known (or unknown) virulence factors and microbial antigens.

[0150] The innate and adaptive immune responses to infecting pathogens (pathogenic microorganisms) can include massive production of cytokines, chemokines, and proteolytic enzymes by granulocytes, monocytes, macrophages, dendritic cells, mast cells, innate lymphocytes, T cells, B cells, NK cells, and NK T cells. Microbial inflammation can be localized to specific organs or systemic. Microbial inflammation can progress in stages from acute to subacute and chronic, with tissue destruction and subsequent fibrosis. If uncontrolled, acute microbial inflammation can lead to sepsis and septic shock, the terminal stage of microbial inflammation.

[0151] A "pathogen" is an agent that causes infection or disease, especially a virus, bacterium, fungus, protozoa, or parasite.

[0152] It is understood that the pathogen can be a virus. Therefore, in one embodiment, the pathogen can be selected from: herpes simplex virus-1, herpes simplex virus-2, varicella zoster virus, Epstein-Barr virus, cytomegalovirus, human herpes virus-6, smallpox virus, vesicular stomatitis virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, hepatitis D virus, hepatitis E virus, rhinovirus, coronavirus (including but not limited to avian coronavirus (IBV), porcine coronavirus HKU15 (PorCoV HKU15), porcine epidemic diarrhea virus (PEDV), HCoV-229E, HCoV-OC43, HCoV-HKU1, HCoV-NL63, SARS-CoV, SARS-CoV-2 or MERS-CoV), influenza A virus, influenza B virus, measles virus, polyomavirus, human papillomavirus, respiratory syncytial virus, adenovirus, coxsackie virus, chikungunya virus, dengue virus, mumps virus, polio virus, rabies virus, Canine virus, Rous sarcoma virus, reovirus, yellow fever virus, Ebola virus, Marburg virus, Lassa fever virus, Eastern equine encephalitis virus, Japanese encephalitis virus, St. Louis encephalitis virus, Murray Valley fever virus, West Nile virus, Rift Valley fever virus, rotavirus A, rotavirus B, rotavirus C, Sindbis virus, simian immunodeficiency virus, human T-cell leukemia virus type 1, Hantavirus, rubella virus, simian immunodeficiency virus, human immunodeficiency virus type 1, and human immunodeficiency virus type 2.

[0153] Also disclosed are methods wherein the pathogen is a bacterium. The pathogen may be selected from the group consisting of Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium bovis strain BCG, BCG substrain, Mycobacterium avium, Mycobacterium intracellular, Mycobacterium africanum, Mycobacterium kansasii, Mycobacterium marinum, Mycobacterium ulcerans, Mycobacterium avium subspecies paratuberculosis, Mycobacterium chimaera, Nocardia asteroides, other Nocardia species, Legionella pneumophila, pneumophila), other Legionella species, Acetinobacter baumanii, Salmonella typhi, Salmonella enterica, other Salmonella species, Shigella boydii, Shigella dysenteriae, Shigella sonnei, Shigella flexneri, other Shigella species, Yersinia pestis, Pasteurella haemolytica, Pasteurella multocida, other Pasteurella species, Actinobacillus pleuropneumoniae, Listeria monocytogenes, Listeria ivanovii), Brucella abortus, other Brucella species, Cowdria ruminantium, Borreliaburgdorferi), Bordetella avium, Bordetella pertussis, Bordetella bronchiseptica, Bordetella trematum, Bordetella hinzii, Bordetella pteri, Bordetella parapertussis, Bordetella ansorpii, other Bordetella species, Burkholderia mallei, Burkholderia psuedomallei, Burkholderia cepacian, Chlamydia pneumoniae, Chlamydia trachomatis trachomatis, Chlamydia psittaci, Coxiella burnetii, Rickettsial species, Ehrlichia species, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus pyogenes, Streptococcus agalactiae, Escherichia coli, Vibrio cholerae, Campylobacter species, Neiserria meningitidis, Neiserriagonorrhea, Pseudomonas aeruginosa, other Pseudomonas species, Haemophilus influenzae, influenzae), Haemophilus ducreyi, other Haemophilus species, Clostridium tetanitetani), other Clostridium species, Yersinia enterolitica and other Yersinia species, and Mycoplasma species.

[0154] Also disclosed are methods wherein the pathogen is a fungus selected from the group consisting of Candida albicans, Cryptococcus neoformans, Histoplasma capsulatum, Aspergillus fumigatus, Coccidiodes immitis, Paracoccidiodes brasiliensis, Blastomyces dermitidis, Pneumocystis carinii, Penicillium marneffi, and Alternaria alternata.

[0155] Also disclosed are methods wherein the pathogen is a parasite, wherein the parasite is selected from the group consisting of Toxoplasma gondii, Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, other Plasmodium species, Entamoeba histolytica, Naegleria fowleri, Rhinosporidium seeberi, Giardia lamblia, Enterobius vermicularis, Enterobius gregorii, Ascaris lumbricoides, Ancylostoma duodenale, Necator americanus, Cryptosporidium species. spp.), Trypanosoma brucei, Trypanosoma cruzi, Leishmania major, other Leishmania species, Diphyllobothrium latum, Hymenolepis nana, Hymenolepis diminuta, Echinococcus granulosus, Echinococcus multilocularis, Echinococcus vogeli, Echinococcus oligarthrus, Diphyllobothrium latum, Clonorchis sinensis; Clonorchis sinensis viverrini, Fasciola hepatica, Fasciola gigantica, Dicrocoelium dendriticum, Fasciolopsis buski, Metagonimus yokogawai, Opisthorchis viverrini, Opisthorchis felineus, Clonorchis sinensis, Trichomonas vaginalis, Acanthamoeba species, Schistosoma intercalatum, Schistosoma haematobium, Schistosoma japonicum, Schistosoma mansoni mansoni, other schistosome species, Trichobilharziaregenti, Trichinella spiralis, Trichinella britovi, Trichinella nelsoni, Trichinella nativa, and Entamoeba histolytica.

[0156] It is understood and contemplated herein that the microbial inflammation treated can be in any tissue, organ or system in a subject where microbial infection may occur, including but not limited to the blood, brain, sinuses, upper respiratory tract, or lungs, heart, bone marrow, spleen, liver, kidneys, genitourinary tract, bladder, ear cavity, stomach, intestines, skin, eyes, teeth or gums, and musculoskeletal system. Thus, in one aspect, disclosed herein are methods for treating, inhibiting, reducing, alleviating, ameliorating and / or preventing microbial inflammation in a subject at various stages thereof (such as, for example, acute inflammation, subacute inflammation, chronic inflammation, organ-specific inflammation, systemic inflammation and / or sepsis and septic shock as the terminal stage of microbial inflammation), comprising administering to the subject a therapeutically effective amount of any of the compositions disclosed herein (i.e., a composition comprising one or more secretomes and two or more RNAs). Therefore, one aspect disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing inflammatory damage caused by microbial infection in a subject, comprising administering to the subject a composition comprising one or more secretomes and two or more RNAs, wherein the RNAs comprise: hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7e-5p, hsa-let-7g-5p , hsa-let-7i, hsa-let-7i-5p, hsa-miR-100-5p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-106b-5p , hsa-mir-10b, hsa-miR-10b-5p, hsa-mir-1246, hsa-miR-1246, hsa-miR-125a-5p, hsa-miR-125b-5p, hs a-miR-130a-3p, hsa-mir-130b, hsa-miR-130b-3p, hsa-miR-132-3p, hsa-miR-136-5p, hsa-miR-138-5p, hsa-miR-139-5p, hsa-mir-140, hsa-miR-140-3p, hsa-miR-145-5p, hsa-mir-146a, hsa-miR-146a-5p, hs a-miR-148a-3p, hsa-miR-152-3p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-mir-16-1, hsa-mir-16-2, hsa -miR-16-5p, hsa-miR-17-5p, hsa-miR-181a-5p, hsa-miR-191-5p, hsa-miR-193a-5p, hsa-miR-193b-3p,hsa-miR-197-3p、hsa-miR-199a-3p、hsa-miR-199a-5p、hsa-miR-199b-5p 、hsa-miR-19a-3p、hsa-miR-19b-3p、hsa-miR-20a-5p、hsa-miR-203a、hsa- miR-203a-3p, hsa-miR-214-3p, hsa-mir-21, hsa-miR-21-3p, hsa-miR-21-5p, hsa-mir-221, hsa-miR-221-3p, hsa-mir-222, hsa-miR-222-3p, hsa-miR-22-3p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-mir-24-1, hsa-mir-24-2, hsa-miR-24-3p, hsa-mir-25, hsa-miR-25-3p, hsa-miR-26a-5p, hsa-mi R-27a-3p, hsa-mir-27b, hsa-miR-27b-3p, hsa-miR-29a-3p, hsa-miR-29c-3p, hsa-miR-30a-5p, hsa-miR-30a-5p, hsa-miR-30b-5p, and hsa-miR-30c-5p 、hsa-mir-30d、hsa-miR-30d-5p、hsa-mir-30e、hsa-miR-30e-5p、hsa-miR -31-3p、hsa-miR-31-5p、hsa-miR-320a、hsa-miR-342-3p、hsa-miR-345-5p hsa-miR-34a-5p, hsa-miR-361-5p, hsa-miR-376a-3p, hsa-miR-376c-3p, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424-5p, hsa-miR-484, hsa-m IR-486-1, HSA-MIR-486-2, HSA-MIR-486-5P, HSA-MIR-570-3P, HSA-MIR-574-3P, HSA-MIR-663A, HSA-MIR-874-3P, HSA-MIR-92A-1, HSA-MIR-92A-2, H sa-miR-92a-3p, hsa-miR-92b-3p, hsa-miR-93, hsa-miR-93-5p, hsa-miR-940, hsa-miR-99a-5p, hsa-miR-99b-5p, HBII-202, U26, U29, HBII-420, U30U18A、U81、GSKIP、IFT88、PCDH11X、PCDH11Y、KIAA0226L、PDE11A、PHACTR1、TEX14 、DCUN1D2、SIM1、FILIP1、FAM107B、CHADL、ZNF365、MNAT1、CYSTM1、GAS7、HOXB7、AS TN2、LGR5、ZFHX3、MCM7、GRIK1、MAP2、LHFPL3、PTER、STAMBP、CCDC135、PAX9、RPL13 、ABCA13、DAAM1、OPN1LW、OPN1MW2、CNOT6L、MTRNR2L10、SMC4、RPL4、PSAP、ASIC4、A HCYL1、RD3L、SIGLEC1、SYCE2、NANS、LOC100129335-5、ZNF238、CADM2-7、SALL1-6、 VWA5A、RF00019.441、RF00019.451、RF00019.621、RF00019.646、RF00019.413、pi R-33044、piR-33043、piR-31703、RNY4、LOC441666、SNHG1、RNU11、LOC80154、LOC7 27751、LOC388152、GOLGA2P2Y、GOLGA2P3Y、SNHG12、RNU12、ASMTL-AS1、LOC284454 U2:RF00004.39、U2:RF00004.22、U2:RF00004.35、U2:RF00004.71、U2:RF00004.66 U2:RF00004.91、U2:RF00004.89、U2:RF00004.67、U1:RF00003.5、U1:RF00003.109、U1:RF10103003. .8、U1:RF00003.3、U1:RF00003.6、U1:RF00003.38、U1:R F00003.20、U1:RF00003.24、U1:RF00003.73、U1:RF00003 .11、U1:RF00003.27、U1:RF00003.40、U1:RF00003.107、 U1:RF00003.62、U1:RF00003.45、U1:RF00003.116、U1:RF 00003.126、U1:RF00003.81、U1:RF00003.100、U1:RF00003.57、U1:RF00003.95、U1:RF000003.31U1: RF00003.25, U1: RF00003.90, U1: RF00003.46, U1: RF00003.123, U2: RF00004.42, U2: RF00004.61, U2: RF00004.51, U1: RF00003.122, U1: RF00003.22, U1: RF00003.9, snoMBII-202: RF00324.2, let-7: RF00027.7, U2: RF00004.75, U1: RF00003.69, U2: RF00004.88, U12: RF0 0007.1, U7: RF00066.141, U1: RF00003.85, U7: RF00066.49, U2: RF00004.77, U1: RF00003.113, U1: RF00003.112, U1: RF00003.70, U1: RF0 0003.83, U7: RF00066.89, U7: RF00066.124, U7: RF00066.75, U7: RF00066.77, U7: RF00066.118, U7: RF00066.103, U7: RF00066.79, U7: RF 00066.200, and / or U7: RF00066.146, UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6GALNAC51, ABC A41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1, GAGE2D: copy 21, ANKRD5-1, ZNF236-1, ACP1, EPHA1-AS1, FLJ45974, ANKRD30BP2, LINC00340, GRIK1-AS1, LOC440300, CSPG4P8, ADARB2-AS1, MLLT4-AS1, and / or HNRNPU-AS1.

[0157] Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing inflammatory damage caused by microbial infection in a subject, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes and two or more RNA molecules, wherein the two or more RNAs include at least one miRNA selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7e-5p, hsa-let-7g-5p, hsa-let-7i, hsa-let-7i-5p, hsa-miR-100-5p, hsa-m iR-103a-3p, hsa-miR-106a-5p, hsa-miR-106b-5p, hsa-mir-10b, hsa-miR-10b-5p, hsa-mir-1246, hsa-miR-1246, hsa-miR-125a-5p, hsa-miR-125 b-5p, hsa-miR-130a-3p, hsa-mir-130b, hsa-miR-130b-3p, hsa-miR-132-3p, hsa-miR-136-5p, hsa-miR-138-5p, hsa-miR-139-5p, hsa-mir-140, hs a-miR-140-3p, hsa-miR-145-5p, hsa-mir-146a, hsa-miR-146a-5p, hsa-miR-148a-3p, hsa-miR-152-3p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-m ir-16-1, hsa-mir-16-2, hsa-miR-16-5p, hsa-miR-17-5p, hsa-miR-181a-5p, hsa-miR-191-5p, hsa-miR-193a-5p, hsa-miR-193b-3p, hsa-miR-197- 3p, hsa-miR-199a-3p, hsa-miR-199a-5p, hsa-miR-199b-5p, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-20a-5p, hsa-miR-203a, hsa-miR-203a-3 p, hsa-miR-214-3p, hsa-mir-21, hsa-miR-21-3p, hsa-miR-21-5p, hsa-mir-221, hsa-miR-221-3p, hsa-mir-222, hsa-miR-222-3p, hsa-miR-22-3p,hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-mir-24-1, hsa-mir-24-2, hsa-miR-24-3p, hsa-mir-25, hsa-miR- 25-3p, hsa-miR-26a-5p, hsa-miR-27a-3p, hsa-mir-27b, hsa-miR-27b-3p, hsa-miR-29a-3p, hsa-miR-29c -3p, hsa-miR-30a-5p, hsa-miR-30a-5p, hsa-miR-30b-5p, hsa-miR-30c-5p, hsa-mir-30d, hsa-miR-30d-5 p, hsa-mir-30e, hsa-miR-30e-5p, hsa-miR-31-3p, hsa-miR-31-5p, hsa-miR-320a, hsa-miR-342-3p, hsa- miR-345-5p, hsa-miR-34a-5p, hsa-miR-361-5p, hsa-miR-376a-3p, hsa-miR-376c-3p, hsa-miR-423-3p, h sa-miR-423-5p, hsa-miR-424-5p, hsa-miR-484, hsa-mir-486-1, hsa-mir-486-2, hsa-miR-486-5p, hsa-m iR-570-3p, hsa-miR-574-3p, hsa-miR-663a, hsa-miR-874-3p, hsa-mir-92a-1, hsa-mir-92a-2, hsa-miR- 92a-3p, hsa-miR-92b-3p, hsa-mir-93, hsa-miR-93-5p, hsa-miR-940, hsa-miR-99a-5p and hsa-miR-99b-5p. Preferably, disclosed herein is a composition, wherein the two or more RNAs include at least one miRNA selected from the group consisting of miR-92a-3p, let-7i-5p, miR-16-5p, miR-93-5p, miR-21-5p, miR-214-3p, miR-29c-3p, miR-34a-5p, mir-203a-3p, miR-27b-3p, miR-140-3p, miR-24-3p, miR-222-3p, miR-25-3p, miR-10b-5p, miR-221-3p, miR-17-5p, miR-30a-5p, and miR-30d-5p.

[0158] Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing inflammatory damage caused by microbial infection or inflammatory symptoms associated with inflammatory damage caused by microbial infection in a subject suffering from inflammatory damage caused by microbial infection, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one mRNA selected from the group consisting of HBII-202, U26, U29, HBII-420, U30, U18A, U81, GSKIP, IFT88, PCDH11X, PCDH11Y, KIAA0226L, PDE11A, PHACTR1, TEX14, DCUN1D2, SIM1, FILIP1, FAM107B, CHADL, ZNF365, MNAT1, CYSTM1, GAS7, HOXB7, ASTN2, LGR5, ZFHX3, MCM7, GRIK1, MAP2 , LHFPL3, PTER, STAMBP, CCDC135, PAX9, RPL13, ABCA13, DAAM1, OPN1LW, OPN1MW2, CNOT6L, MTRNR2L10, SMC4, RPL4, PSAP, ASIC4, AHCYL1, RD3L, SIGLEC1, SYCE2 and NANS. Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing inflammatory damage caused by microbial infection or inflammatory symptoms associated with inflammatory damage caused by microbial infection in a subject suffering from inflammatory damage caused by microbial infection, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one y-RNA selected from the following: RF00019.441, RF00019.451, RF00019.621, RF00019.646 and RF00019.413.Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing inflammatory damage caused by microbial infection or inflammatory symptoms associated with inflammatory damage caused by microbial infection in a subject suffering from inflammatory damage caused by microbial infection, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one lncRNA selected from the group consisting of LOC100129335-5, ZNF238, CADM2-7, SALL1-6 and VWA5A. Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing inflammatory damage caused by microbial infection or inflammatory symptoms associated with inflammatory damage caused by microbial infection in a subject suffering from inflammatory damage caused by microbial infection, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one pi-RNA selected from the group consisting of piR-33044, piR-33043 and piR-31703. In one aspect, the RNA may be an antisense RNA.Therefore, the present invention also discloses a method for treating, inhibiting, reducing, alleviating, improving and / or preventing inflammatory damage caused by microbial infection or inflammatory symptoms associated with inflammatory damage caused by microbial infection in a subject suffering from inflammatory damage caused by microbial infection, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one antisense mRNA selected from the group consisting of UBAP11, SMC51, TMX11, LTA4H1, KIF20B 1. OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA 351, HS3ST41, SLC44A51, CLCN51, ST6GALNAC51, ABCA41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE13 1, GAGE2D1 and GAGE2D: copy 21, antisense lnRNA selected from the following: ANKRD5-1, ZNF236-1 and ACP1 and / or antisense RNA selected from the following: UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, C LCN51, ST6GALNAC51, ABCA41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1, GAGE2D: copy 21, ANKRD5-1, ZNF236-1, ACP1, EPHA1-AS1, FLJ45974, ANKRD30BP2, LINC00340, GRIK1-AS1, LOC440300, CSPG4P8, ADARB2-AS1, MLLT4-AS1, and / or HNRNPU-AS1.

[0159] In one aspect, microbial inflammation is located in the blood, brain, sinuses, upper respiratory tract, or lungs, heart, bone marrow, spleen, liver, kidneys, genitourinary tract, bladder, ear cavity, stomach, intestines, skin, eyes, teeth or gums, and musculoskeletal system.

[0160] It is understood and contemplated herein that, although the disclosed compositions have the ability to inhibit microbial inflammation, in some cases, it is still necessary to add (in the form of the composition itself or as a separate application) an antimicrobial agent to treat the actual infection. Therefore, disclosed herein is a method for treating, inhibiting, alleviating or preventing microbial inflammation in an object, wherein the method further includes administering an antimicrobial agent to the object. Antimicrobials can include any antibiotics, antibodies, small molecules, and functional nucleic acids (siRNA, RNAi, antisense oligonucleotides) that directly attack infected microorganisms or change host conditions to make the host system unfriendly to microorganisms. Such agents include, but are not limited to, Abacavir, Acyclovir, Adefovir, Amantadine, Amprenavir, Ampligen, Arbidol, Atazanavir, Atripla, Balavir, β-D-N4-hydroxycytidine (NHC, EIDD-1931), Cidofovir, Combivir, Dolutegravir, Darunavir, Delavirdine, Didanosine, Docosanol, Edoxudine, Efavirenz, Emtricitabine, Enfuvirtide, Entecavir, Ecoli Ecoliever, Famciclovir, Fomivirsen, Fosamprenavir, Foscarnet, Fosfonet, Ganciclovir, Hydroxy-chloroquine, Ibacitabine, Imunovir, Idoxuridine, Imiquimod, Indinavir, Inosine, Lamivudine, Lopinavir, Loviride, Maraviroc, Moroxydine, Methisazone, Nelfinavir, Nevirapine, Nexavir, Nitazoxanide,Norvir, Oseltamivir, Peginterferon alfa-2a, Penciclovir, Peramivir, Pleconaril, Podophyllotoxin, Raltegravir, Remdecivir, Ribavirin, Rimantadine, Ritonavir, Pyramidine, Saquinavir, Sofosbuvir, Stavudine, Telaprevir, Tenofovir, Tenofovir Disoproxil disoproxil), Tipranavir, Trifluridine, Trizivir, Tromantadine, Truvada, Valaciclovir, Valganciclovir, Vicriviroc, Vidarabine, Viramidine, Zalcitabine, Zanamivir, Zidovudine,Clofazimine; Dapsone; Capreomycin; Cycloserine; Ethambutol (Bs); Ethionamide; Isoniazid; Pyrazinamide; Rifampicin; Rifabutin; Rifapentine; Streptomycin; Arsphenamine; Chloramphenicol (Bs); Fosfomycin; Fusidic acid acid; Metronidazole; Mupirocin; Platensimycin; Quinupristin / Dalfopristin; Thiamphenicol; Tigecycline (Bs); Tinidazole; Trimethoprim (Bs); Aminoglycosides such as, for example, Amikacin, Gentamicin, Kanamycin, Meropenem, Neomycin, Netilmicin, Tobramycin, Paromomycin, Streptomycin, Spectinomycin, Nitazoxanide, Melarsoprol Eflornithine), Metronidazole, Tinidazole, Miltefosine, Mebendazole, Pyrantel pamoate, Thiabendazole, Diethylcarbamazine, Ivermectin, Niclosamide, Praziquantel, Albendazole, Praziquantel, Rifampin, Amphotericin B, Fumagillin, Amphotericin B,Candicidin, Filipin, Hamycin, Natamycin, Nystatin, Rimocidin, Bifonazole, Butoconazole, Clotrimazole, Econazole, Fenticonazole, Isoconazole soconazole), Ketoconazole, Luliconazole, Miconazole, Omoconazole, Oxiconazole onazole), Sertaconazole, Sulconazole, Tioconazole, Albaconazole, Efina conazole, Epoxiconazole, Fluconazole, Isavuconazole, Itraconazole, Posaconazole, Propiconazole, Ravuconazole, Terconazole, Voriconazole, Abafungin, Anidulafungin, Caspofungin, Micafungin, Aurones, Benzoic acid, Ciclopirox, Flucytosine, Griseofulvin, Haloprogin, Tolnaftate, Undecylenic acid, Crystal violet violet), Balsam of Peru, Orotomide, Miltefosine; Ansamycins, such as, for example, geldanamycin, rifaximin, herbimycin; Carbapenems, such as, for example, Ertapenem, Doripenem,Imipenem / Cilastatin and Meropenem; Cephalosporins, such as, for example, Cefadroxil, Cefazolin, Cephradine, Cephapirin, Cephalothin, Cefalexin, Cefaclor, Cefoxitin, Cefotetan, Cefamandole, Cefmetazole, efmetazole), Cefonicid, Loracarbef, Cefprozil, Cefuroxime, Cefixime, Cefdinir, Cefditoren, Cefoperazone, Cefotaxime, Cefpodoxime, Ceftazidime, Ceftibuten, Ceftizoxime, Moxalactam, Ceftriaxone, Cefepime, Ceftarolinefosamil and Ceftobiprole; Glycopeptides such as, for example, Teicoplanin, Vancomycin, Telavancin, Dalbavancin and Oritavancin; Lincosamides (Bs), such as, for example, Clindamycin and Lincomycin; Lipopeptides, such as, for example, Daptomycin and in); Macrolides (Bs), such as, for example, Azithromycin, Clarithromycin, Erythromycin, Roxithromycin, Telithromycin, and Spiramycin; Monolides, such as, for example, Aztreonam; Nitrofurans, such as, for example, Furazolidone and Nitrofurantoin (Bs); Oxazolidinones (Bs), such as, for example, Linezolid,Posizolid, Radezolid and Torezolid; Penicillins, such as, for example, Amoxicillin, Ampicillin, Azlocillin, Dicloxacillin, Flucloxacillin, Mezlocillin, Methicillin, Nafcillin, Oxacillin, Penicillin G, Penicillin V, Piperacillin, Penicillin G, Temocillin and Ticarcillin; Peptides, such as, for example, Bacitracin, Colistin and Polymyxin B B); Quinolones / Fluoroquinolones, such as, for example, Ciprofloxacin, Enoxacin, Gatifloxacin, Gemifloxacin, Levofloxacin, Lomefloxacin, Moxifloxacin, Nadifloxacin, Nalidixic acid, Norfloxacin, Ofloxacin, Trovafloxacin, Grepafloxacin, Sparfloxacin and Temafloxacin; Sulfonamides (Bs), such as, for example, Mafenide, Sulfacetamide, Sulfadiazine, Silver Sulfadiazine, sulfadiazine), Sulfadimethoxine, Sulfamethizole, Sulfamethoxazole, Sulfanilimide (no longer available), Sulfasalazine, Sulfisoxazole,Trimethoprim-Sulfamethoxazole (TMP-SMX) and Sulfonamidochrysoidine (obsolete); Tetracyclines (Bs), such as, for example, Demeclocycline, Doxycycline, Metacycline, Minocycline, Oxytetracycline and Tetracycline; Monoclonal antibodies, such as Actoxumab, Atidortoxumab, Berlimatoxumab, Bezlotoxumab, Cosfrovix imab), Edobacomab, Felvizumab, Firivumab, Foravirumab, Larcaviximab, Motavizumab, Navivumab, Panobacumab, Palivizumab, Porgaviximab, CR6261, Rafivirumab, Pagibaximab, Obiltoxaximab, Ibalizumab, Regavirumab, Rmab, Sevirumab, Rivabazumab pegol, tefibazumab, suvratoxumab, and tuvirumab; and checkpoint inhibitors; pembrolizumab, nivolumab, atezolizumab, avelumab, durvalumab, pidilizumab, AMP-224, AMP-514, PDR001, cemiplimab, and ipilimumab.

[0161] H. Methods of treating cancer

[0162] The disclosed secretome and RNA compositions can be used to treat any disease in which uncontrolled cell proliferation occurs, such as cancer. A representative but non-limiting list of cancers that the disclosed compositions can be used to treat is as follows: lymphomas, such as B-cell lymphomas and T-cell lymphomas; mycosis fungoides; Hodgkin's disease; myeloid leukemias (including but not limited to acute myeloid leukemia (AML) and / or chronic myeloid leukemia (CML)); bladder cancer; brain cancer; nervous system cancer; head and neck cancer; head and neck squamous cell carcinoma; kidney cancer; lung cancer, such as small cell lung cancer, non-small cell lung cancer (NSCLC), lung squamous cell carcinoma (LUSC) and lung adenocarcinoma (LUAD); neuroblastoma / glioblastoma; ovarian cancer; pancreatic cancer; prostate cancer; skin cancer; liver cancer; melanoma; squamous cell carcinoma of the oral cavity, throat, larynx and lung; cervical cancer; uterine cervical cancer; breast cancer (including but not limited to triple-negative breast cancer); genitourinary cancer; lung cancer; esophageal cancer; head and neck cancer; colorectal cancer; hematopoietic cancer; testicular cancer; and colon and rectal cancer. Therefore, in one aspect, disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing inflammatory damage caused by cancer and / or metastasis in a subject, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the RNA molecules include hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7e-5p, hsa-let-7g-5p, hsa-let-7i, hsa-let-7i-5p, hsa-miR-100-5p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-107a-5p, hsa-miR-108a-5p, hsa-miR-109b-5p, hsa-miR-110c-5p, hsa-miR-111d-5p, hsa-miR-112d-5p, hsa-miR-113a-3p, hsa-miR-114a-5p, hsa-miR-115b-5p, hsa-miR-116c-5p, hsa-miR-117d-5p, hsa-miR-118e-5p, hsa-miR-119b-5p, hsa-miR-111c-5p, hsa-miR-114d-5p, hsa-miR-115e-5p, hsa-miR-116f-5p, hsa-miR-117d-5p, hsa-miR-118e a-miR-106b-5p, hsa-mir-10b, hsa-miR-10b-5p, hsa-mir-1246, hsa-miR-1246, hsa-miR-125a- 5p, hsa-miR-125b-5p, hsa-miR-130a-3p, hsa-mir-130b, hsa-miR-130b-3p, hsa-miR-132-3p, h sa-miR-136-5p, hsa-miR-138-5p, hsa-miR-139-5p, hsa-mir-140, hsa-miR-140-3p, hsa-miR-1 45-5p, hsa-mir-146a, hsa-miR-146a-5p, hsa-miR-148a-3p, hsa-miR-152-3p, hsa-miR-15a-5p,hsa-miR-15b-5p, hsa-miR-16-1, hsa-miR-16-2, hsa-miR-16-5p, hsa-miR-17-5p, hsa-miR-181a-5p, hsa-miR-191-5p, hsa-miR-193a-5p, and hsa-miR- 193b-3p、hsa-miR-197-3p、hsa-miR-199a-3p、hsa-miR-199a-5p、hsa-miR -199b-5p、hsa-miR-19a-3p、hsa-miR-19b-3p、hsa-miR-20a-5p、hsa-miR- 203a, hsa-miR-203a-3p, hsa-miR-214-3p, hsa-mir-21, hsa-miR-21-3p, hsa-miR-21-5p, hsa-mir-221, hsa-miR-221-3p, hsa-miR-222, hsa-miR-222-3p, hsa-miR-22-3p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-miR-24-1, hsa-miR-24-2, hsa-miR-24-3p, hsa-miR-25, hsa-miR-25-3p, and hsa-miR-26 a-5p、hsa-miR-27a-3p、hsa-mir-27b、hsa-miR-27b-3p、hsa-miR-29a-3p、 hsa-miR-29c-3p、hsa-miR-30a-5p、hsa-miR-30a-5p、hsa-miR-30b-5p、hs a-miR-30c-5p, hsa-miR-30d, hsa-miR-30d-5p, hsa-miR-30e, hsa-miR-30e-5p, hsa-miR-31-3p, hsa-miR-31-5p, hsa-miR-320a, hsa-miR-342-3p, hsa-miR-345-5p, hsa-miR-34a-5p, hsa-miR-361-5p, hsa-miR-376a-3p, hsa-miR-376c-3p, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424-5p, hsa -miR-484, hsa-miR-486-1, hsa-miR-486-2, hsa-miR-486-5p, hsa-miR-570-3p, hsa-miR-574-3p, hsa-miR-663a, hsa-miR-874-3p, hsa-miR-92a-1hsa-mir-92a-2、hsa-miR-92a-3p、hsa-miR-92b-3p、hsa-mir-93、hsa-miR-93-5p、hsa-miR-940、hsa- miR-99a-5p、hsa-miR-99b-5p、HBII-202、U26、U29、HBII-420、U30、U18A、U81、GSKIP、IFT88、PCDH11X、P CDH11Y、KIAA0226L、PDE11A、PHACTR1、TEX14、DCUN1D2、SIM1、FILIP1、FAM107B、CHADL、ZNF365、MNAT1、 CYSTM1, GAS7, HOXB7, ASTN2, LGR5, ZFHX3, MCM7, GRIK1, MAP2, LHFPL3, PTER, STAMBP, CCDC135, PAX9, RPL 13、ABCA13、DAAM1、OPN1LW、OPN1MW2、CNOT6L、MTRNR2L10、SMC4、RPL4、PSAP、ASIC4、AHCYL1、RD3L、SIGL EC1、SYCE2、NANS、LOC100129335-5、ZNF238、CADM2-7、SALL1-6、VWA5A、RF00019.441、RF00019.451、RF0 0019.621、RF00019.646、RF00019.413、piR-33044、piR-33043、piR-31703、RNY4、LOC441666、SNHG1、R NU11、LOC80154、LOC727751、LOC388152、GOLGA2P2Y、GOLGA2P3Y、SNHG12、RNU12、ASMTL-AS1、LOC284454 U2:RF00004.39、U2:RF00004.22、U2:RF00004.35、U2:RF00004.71、U2:RF00004.66 U2:RF00004.91、U2:RF00004.89、U2:RF00004.67、U1:RF00003.5、U1:RF00003.109、U1:RF00003.110、U1:RF00003.8、U1:RF00003.3、U1:RF0000 003.6、U1:RF00003.38、U1:RF00003.20、U1:RF00003.24、U1:RF00003.73、U1:RF00003.11、U1:RF00003.27、U1:RF00003.40、U1:RF00003.107、U1: RF00003.62, U1: RF00003.45, U1: RF00003.116, U1: RF00003.126, U1: RF00003.81, U1: RF00003.100, U1: RF00003.57, U1: RF00003.95, U1: RF00003.31, U1: RF00003.61, U1: RF00003.25, U1: RF00003.90, U1: RF00003.46, U1: RF00003.123, U2: RF00004.42, U2: RF00004.61, U2: RF00004.51, U1: RF00003.122, U1: RF00003.22, U1: RF00003.9, snoMBII-202: RF00324.2, let-7: RF00027.7, U2: RF00004.75, U1: RF00003.69, U2: RF00004.88, U12: RF00007.1, U7: RF00066.141, U1: RF00003.85, U7: RF00066.49, U2: RF00004.77, U1: RF00003.113, U1: RF00003.112, U1: RF00003.70, U1: RF00003.83, U7: RF00066.89, U7: RF00066.124, U7: RF00066.75, U7: RF00066.77, U7: RF00066.118, U7: RF00066.103, U7: RF00066.79, U7: RF00066.200, and / or U7: RF00066.146, UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6GALNAC51, ABCA41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1, GAGE2D: Copy 21, ANKRD5-1, ZNF236-1, ACP1, EPHA1-AS1, FLJ45974, ANKRD30BP2, LINC00340GRIK1-AS1, LOC440300, CSPG4P8, ADARB2-AS1, MLLT4-AS1, and / or HNRNPU-AS1.

[0163] For example, disclosed herein is a method for treating, inhibiting, reducing, alleviating, ameliorating and / or preventing cancer and / or metastasis or inflammatory symptoms associated with cancer in a subject having cancer, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs comprise at least one miRNA selected from the group consisting of: hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7d-5p, hsa-let-7e-3p, hsa-let-7f ... e-5p, hsa-let-7g-5p, hsa-let-7i, hsa-let-7i-5p, hsa-miR-100-5p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-106b-5p, hsa-mir-10b, hsa-mi R-10b-5p, hsa-mir-1246, hsa-miR-1246, hsa-miR-125a-5p, hsa-miR-125b-5p, hsa-miR-130a-3p, hsa-mir-130b, hsa-miR-130b-3p, hsa-miR-132-3 p, hsa-miR-136-5p, hsa-miR-138-5p, hsa-miR-139-5p, hsa-mir-140, hsa-miR-140-3p, hsa-miR-145-5p, hsa-mir-146a, hsa-miR-146a-5p, hsa-mi R-148a-3p, hsa-miR-152-3p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-mir-16-1, hsa-mir-16-2, hsa-miR-16-5p, hsa-miR-17-5p, hsa-miR-181a-5p, hsa-miR-191-5p, hsa-miR-193a-5p, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-199a-3p, hsa-miR-199a-5p, hsa-miR-199b-5p, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-20a-5p, hsa-miR-203a, hsa-miR-203a-3p, hsa-miR-214-3p, hsa-mir-21, hsa-miR-21-3p, hsa-miR-21-5p, hsa-mir-221,hsa-miR-221-3p, hsa-mir-222, hsa-miR-222-3p, hsa-miR-22-3p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-mir-24 -1, hsa-mir-24-2, hsa-miR-24-3p, hsa-mir-25, hsa-miR-25-3p, hsa-miR-26a-5p, hsa-miR-27a-3p, hsa-mir-27b , hsa-miR-27b-3p, hsa-miR-29a-3p, hsa-miR-29c-3p, hsa-miR-30a-5p, hsa-miR-30a-5p, hsa-miR-30b-5p, hsa-m iR-30c-5p, hsa-mir-30d, hsa-miR-30d-5p, hsa-mir-30e, hsa-miR-30e-5p, hsa-miR-31-3p, hsa-miR-31-5p, hsa- miR-320a, hsa-miR-342-3p, hsa-miR-345-5p, hsa-miR-34a-5p, hsa-miR-361-5p, hsa-miR-376a-3p, hsa-miR-376 c-3p, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424-5p, hsa-miR-484, hsa-mir-486-1, hsa-mir-486-2, hsa-mi R-486-5p, hsa-miR-570-3p, hsa-miR-574-3p, hsa-miR-663a, hsa-miR-874-3p, hsa-mir-92a-1, hsa-mir-92a-2, h sa-miR-92a-3p, hsa-miR-92b-3p, hsa-mir-93, hsa-miR-93-5p, hsa-miR-940, hsa-miR-99a-5p and hsa-miR-99b-5p. Preferably, disclosed herein is a composition wherein the two or more RNAs include at least one miRNA selected from the group consisting of miR-92a-3p, let-7i-5p, miR-16-5p, miR-93-5p, miR-21-5p, miR-214-3p, miR-29c-3p, miR-34a-5p, mir-203a-3p, miR-27b-3p, miR-140-3p, miR-24-3p, miR-222-3p, miR-25-3p, miR-10b-5p, miR-221-3p, miR-17-5p,miR-30a-5p and miR-30d-5p. Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing cancer and / or metastasis or inflammatory symptoms associated with cancer in a subject having cancer, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one mRNA selected from the group consisting of HBII-202, U26, U29, HBII-420, U30, U18A, U81, GSKIP, IFT88, PCDH11X, PCDH11Y, KIAA0226 L, PDE11A, PHACTR1, TEX14, DCUN1D2, SIM1, FILIP1, FAM107B, CHADL, ZNF365, MNAT1, CYSTM1, GAS7, HOXB7, ASTN2, LGR5, ZFHX3, MCM7, GRIK1, MAP2, LHFPL3, PTER, STAMBP, CCDC135, PAX9, RPL13, ABCA13, DAAM1, OPN1LW, OPN1MW2, CNOT6L, MTRNR2L10, SMC4, RPL4, PSAP, ASIC4, AHCYL1, RD3L, SIGLEC1, SYCE2 and NANS. Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing cancer and / or cancer-related metastasis or inflammatory symptoms in a subject having cancer, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one y-RNA selected from the group consisting of RF00019.441, RF00019.451, RF00019.621, RF00019.646 and RF00019.413. Also disclosed herein is a method for treating, inhibiting, reducing, alleviating, improving and / or preventing cancer and / or cancer-related metastasis or inflammatory symptoms in a subject suffering from cancer, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one lncRNA selected from the group consisting of LOC100129335-5, ZNF238, CADM2-7,SALL1-6 and VWA5A. Also disclosed herein are methods for treating, inhibiting, reducing, alleviating, ameliorating and / or preventing cancer and / or metastasis or inflammatory symptoms associated with cancer in a subject having cancer, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one pi-RNA selected from the group consisting of piR-33044, piR-33043 and piR-31703. In one aspect, the RNA may be an antisense RNA. Therefore, also disclosed herein is a method for treating, inhibiting, reducing, alleviating, ameliorating and / or preventing cancer and / or metastasis or inflammatory symptoms associated with cancer in a subject having cancer, comprising administering to the subject a therapeutically effective amount of a composition comprising one or more secretomes (including but not limited to compositions comprising liposomes, lipid nanoparticles, MSC growth factors, MSC exosomes, MSC extracts and / or extracellular vesicles) and two or more RNA molecules, wherein the two or more RNAs include at least one antisense mRNA selected from the group consisting of: BAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTN AP51, ZRANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6G ALNAC51, ABCA41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1 and GAGE2D: copy 21, antisense lnRNA selected from the group consisting of ANKRD5-1, ZNF236-1 and ACP1 and / or antisense RNA selected from the group consisting of UBAP11, SMC51, TMX11, LTA4H 1. KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK11, TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6GALNAC51, ABCA41, COL5A11,AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1, GAGE2D: copy 21, ANKRD5-1, ZNF236-1, ACP1, EPHA1-AS1, FLJ45974, ANKRD30BP2, LINC00340, GRIK1-AS1, LOC440300, CSPG4P8, ADARB2-AS1, MLLT4-AS1, and / or HNRNPU-AS1.

[0164] It is understood and contemplated herein that the disclosed therapeutic regimens may be used alone or in combination with any anti-cancer therapy known in the art, including but not limited to Abemaciclib, Abiraterone Acetate, Abitrexate (Methotrexate), Abraxane (Albumin-stabilized Nanoparticle Formulation of Paclitaxel), ABVD, ABVE, ABVE-PC, AC, AC-T, Adcetris (Brentuximab Vedotin), ADE, Ado-Trastuzumab Emtansine, Adriamycin (Doxorubicin Hydrochloride), Afatinib Bismaleate (Afatinib Dimaleate, Afinitor (Everolimus), Akynzeo (Netupitant and Palonosetron Hydrochloride), Aldara (Imiquimod), Aldesleukin, Alecensa (Alectinib), Alectinib, Alemtuzumab, Alimta (Pemetrexed Disodium), Aliqopa (Copanlisib Hydrochloride), Alkeran for Injection (Melphalan Hydrochloride), Hydrochloride), Aclant (Melphalan), Aloxi (Palonosetron Hydrochloride), Alunbrig (Brigatinib), Ambochlorin (Chlorambucil), Amboclorin (Chlorambucil), Amifostine, Aminolevulinic Acid, Anastrozole, Aprepitant, Aredia (Pamidronate Disodium),Disodium), Arimidex (anastrozole), Aromasin (Exemestane), Arranon (Nelarabine), Arsenic Trioxide, Arzerra (Ofatumumab), Asparaginase Erwiniachrysanthemi, Atezolizumab, Avastin (Bevacizumab), Avelumab, Axitinib, Azacitidine, Bavencio (Avelumab), BEACOPP, Becenum (Carmustine), Beleodaq (Belinostat), Belinostat, Bendamustine Hydrochloride Hydrochloride), BEP, Besponsa (Inotuzumab Ozogamicin), Bevacizumab, Bexarotene, Bexxar (Tositumomab and Iodine I 131 Tositumomab), Bicalutamide, BiCNU (Carmustine), Bleomycin, Blinatumomab, Blincyto (Lantumomab), Bortezomib, Bosulif (Bosutinib), Bosutinib, Brentuximab-VedotineVedotin), Brigatinib, BuMel, Busulfan, Busulfex, Cabazitaxel, Cabometyx, Cabometyx-S-malate, CAF, Campath, Camptosar, Irinotecan hydrochloride, Capecitabine, CAPOX, Carac, Carboplatin, CARBOPLATIN-TAXOL, Carfe Carfilzomib, Carmubris (carmustine), Carmustine, Carmustine implant, Casodex (bicalutamide), CEM, Ceritinib, Cerubidine (daunorubicin hydrochloride), Cervarix (recombinant HPV bivalent vaccine), Cetuximab, CEV, Chlorambucil, Chlorambucil-PREDNISONE, CHOP, Cisplatin, Cladrin Cladribine, Clafen (cyclophosphamide), Clofarabine, Clofarex (clofarabine), Clolar (clofarabine), CMF, Cobimetinib, Cometriq (cabozantinib-S-malate), Copagliflozin, COPDAC, COPP, COPP-ABV, Cosmegen (Dactinomycin), Cotellic (cobimetinib), Crizotinib, CVP, Cyclophosphamide, Cyfos (ifosfamide), Cy ramza (ramucirumab), cytarabine, cytarabine liposomal, Cytosar-U (cytarabine), Cytoxan (cyclophosphamide), dabrafenib, dacarbazine, Dacogen (decitabine), actinomycin D, daratumumab, Darzalex (daratumumab), dasatinib, daunorubicin hydrochloride, daunorubicin hydrochloride and cytarabine liposomal, decitabine, defibrotide sodiumSodium), Defitelio (defibrotide sodium), Degarelix, Denileukin Diftitox, Denosumab, DepoCyt (liposomal cytarabine), Dexamethasone, Dexrazoxane Hydrochloride, Dinutuximab, Docetaxel, Doxil (liposomal doxorubicin hydrochloride), Doxorubicin hydrochloride, Dox-SL (liposomal doxorubicin hydrochloride), DTIC-Dome (dacarbazine), Durvalumab, Efudex (fluorouracil-topical), Elitek (rasburicase), Ellence (epibicin hydrochloride), Hydrochloride), Elotuzumab, Eloxatin (Oxaliplatin), Eltrombopag Olamine, Emend (Aprepitant), Empliciti (Elotuzumab), Enasidenib Mesylate, Enzalutamide, Epirubicin Hydrochloride, EPOCH, Erbitux (Cetuximab), Eribulin Mesylate, Erivedge (Vismodegib), Erlotinib HydrochlorideHydrochloride), Erwinaze (Asparaginase Erwinia chrysanthemi), Ethyol (Amifostine), Etopophos (Etoposide phosphate), Etoposide, Etoposide phosphate, Evacet (liposomal doxorubicin hydrochloride), Everolimus, Evista, (Raloxifene hydrochloride), Evomela (Melphalan hydrochloride), Exemestane, 5-FU (Fluorouracil Injection), 5-FU (Fluorouracil Topical), Fareston (Toremifene) , Farydak (Panobinostat), Faslodex (Fulvestrant), FEC, Femara (Letrozole), Filgrastim, Fludara (Fludarabine Phosphate), Fludarabine Phosphate, Fluoroplex (Fluorouracil-Topical), Fluorouracil Injection, Fluorouracil-Topical, Flutamide, Folex (Methotrexate), Folex PFS (methotrexate), FOLFIRI, FOLFIRI-BEVACIZUMAB, FOLFIRI-CETUXIMAB, FOLFIRINOX, FOLFOX, Folotyn (Pralatrexate), FU-LV, Fulvestrant, Gardasil (quadrivalent HPV vaccine), Gardasil 9 (nonavalent HPV vaccine), Gazyva (obinutuzumab), Gefitinib, Gemcitabine hydrochloride, Gemcitabine-cisplatin, Gemcitabine-oxaliplatin, Gemtuzumab ozogamicin Ozogamicin), Gemzar (gemcitabine hydrochloride), Gilotrif (afatinib bismaleate), Gleevec (imatinib mesylate), Gliadel (carmustine implant), Gliadel wafer (carmustine implant), Glucarpidase, Goserelin Acetate, Halaven (eribulin mesylate), Hemangeol (propranolol hydrochloride), Herceptin (trastuzumab), Recombinant HPV Bivalent Vaccine, Recombinant HPV Nine-valent Vaccine, Recombinant HPV Four-valent Vaccine, Hycamtin (topotecan hydrochloride),Hydrochloride), Hydrea (hydroxyurea), Hydroxyurea, Hyper-CVAD, Ibrance (palbociclib), Ibritumomab Tiuxetan, Ibrutinib, ICE, Iclusig (Ponatinib Hydrochloride), Idamycin (Idarubicin Hydrochloride), Idarubicin Hydrochloride, Idelalisib, Idhifa (Ensidipine Mesylate), Ifex (Ifosfamide), Ifosfamide, Ifosfamidum (Ifosfamide), IL-2 (Aldesleukin), Imatinib Mesylate, Imbruvica (Ibrutinib), Imfinzi (Durvalumab), Imiquimod, Imlygic (Talimogene Laherparepvec), Inlyta (axitinib), Inotuzumab ozogamicin, Recombinant interferon alfa-2b, Interleukin-2 (aldesleukin), Intron A (recombinant interferon alfa-2b), Iodine I 131 Tositumomab and Tositumomab, Ipilimumab, Iressa (gefitinib), Irinotecan hydrochloride, Irinotecan liposomal hydrochloride, Istodax (romidepsin), Ixabepilone, Ixazomib Citrate, Ixempra (ixabepilone), Jakafi (ruxolitinib phosphate Phosphate), JEB, Jevtana (cabazitaxel), Kadcyla (Ado-enmetazocortuzumab), Keoxifene (raloxifene hydrochloride), Kepivance (palifermin), Keytruda (pembrolizumab), Kisqali (ribociclib), Kymriah (tisagenlecleucel), Kyprolis (carfilzomib), Lanreotide Acetate, Lapatinib ditosylateDitosylate), Lartruvo (olaratumab), Lenalidomide, Lenvatinib Mesylate, Lenvima (lenvatinib mesylate), Letrozole, Calcium Folinate, Leukeran (chlorambucil), Leuprolide Acetate, Leustatin (cladribine), Levulan (aminolevulinic acid), Linfolizin (chlorambucil), LipoDox (liposomal doxorubicin hydrochloride), Lomustine, Lonsurf (trifluridine hydrochloride and tipiracil), Lupron (leuprolide acetate), Lupron Depot (leuprolide acetate), Lupron Depot-Ped (leuprolide acetate), Lynparza (olaparib), Marqibo (liposomal vincristine sulfate), Liposome), Matulane (Procarbazine Hydrochloride), Mechlorethamine Hydrochloride, Megestrol Acetate, Mekinist (Trametinib), Melphalan, Melphalan Hydrochloride, Mercaptopurine, Mesna, Mesnex, Methazolastone (Temozolomide), Methotrexate, Methotrexate LPF (Methotrexate), Methylnaltrexone Bromide, Mexate (Methotrexate), Methotrexate-AQ (Methotrexate), Midostaurin, Mitomycin C (Mitomycin C), Mitoxantrone Hydrochloride, Mitozytrex (Mitomycin C), MOPP, Mozobil (Plerixafor), Mechlorethamine (Mechlorethamine Hydrochloride), Mutamycin (Mitomycin C), Myleran (Busulfan), Mylosar (Azacitidine), Mylotarg (Gemtuzumab Ozogacin), Paclitaxel Nanoparticles (Albumin-Stable Nanoparticle Formulation of Paclitaxel), Navelbine (Vinorelbine Tartrate),Tartrate), Necitumumab, Nelarabine, Neosar (cyclophosphamide), Neratinib Maleate, Nerlynx (Neratinib Maleate), Netupitant and Palonosetron Hydrochloride, Neulasta (Pegfilgrastim), Neupogen (Filgrastim), Nexavar (Sorafenib Tosylate), Tosylate), Nilandron (Nilutamide), Nilotinib, Nilutamide, Ninlaro (Ixazomib Citrate), Niraparib Tosylate Monohydrate, Nivolumab, Nolvadex (Tamoxifen Citrate), Nplate (Romiplostim), Atezolizumab, Odomzo (Sonidegib), OEPA, Ofatumumab, OFF, Olaparib, Olaratumab, Omacetaxine Mepesuccinate, Oncaspar (Pegaspargase), Ondansetron Hydrochloride (Ondansetron Hydrochloride), Onivyde (liposomal irinotecan hydrochloride), Ontak (denileukin-2), Opdivo (nivolumab), OPPA, Osimertinib, Oxaliplatin, Paclitaxel, Paclitaxel albumin-stabilized nanoparticle formulation, PAD, Palbociclib, Palifermin, Palonosetron hydrochloride, Palonosetron hydrochloride and Netupitant, Pamidronate disodium, Panitumumab, Panobinostat, Paraplat (carboplatin), Paraplatin (carboplatin), Pazopanib hydrochlorideHydrochloride), PCV, PEB, pegaspargase, pegfilgrastim, peginterferon alfa-2b, PEG-Intron (pegylated interferon alfa-2b), pembrolizumab, pemetrexed disodium, Perjeta (pertuzumab), pertuzumab, Platinol (cisplatin), Platinol-AQ (cisplatin), Plerixafor, Pomalidomide, Pomalyst (pomalidomide), Ponatinib hydrochloride, Portrazza (nesiumab), Pralatrexate, prednisone, procarbazine hydrochloride, Proleukin (aldesleukin), Prolia (denosumab), Promacta (eltrombopag Olamine), Propranolol Hydrochloride, Provenge (Sipuleucel-T), Purinethol (Mercaptopurine), Purixan (Mercaptopurine), Radium 223 Dichloride, Raloxifene Hydrochloride, Ramucirumab, Rasburicase, R-CHOP, R-CVP, Recombinant Human Papillomavirus (HPV) Bivalent Vaccine, Recombinant Human Papillomavirus (HPV) Nine-Valent Vaccine, Recombinant Human Papillomavirus (HPV) Quadrivalent Vaccine, Recombinant Interferon α-2b, Rego Regorafenib, Relistor (methylnaltrexone bromide), R-EPOCH, Revlimid (lenalidomide), Rheumatrex (methotrexate), Ribociclib, R-ICE, Rituxan (rituximab), RituxanHycela (rituximab and human hyaluronidase), Rituximab, Rituximab and human hyaluronidase, Rolapitant hydrochloride Hydrochloride), Romidepsin, Romiplostim, Rubidomycin (daunorubicin hydrochloride), Rubraca (rucaparib camsylate), Ruxolitinib phosphate, Rydapt (midostaurin), Sclerosol Intrapleural Aerosol (talc), Siltuximab, Sipuleucel-T, Somatuline Depot (lanreotide acetate), Sonidegib, Sorafenib Tosylate, Sprycel (dasatinib), STANFORDV, Sterile Talc (Talc), Steritalc (Talc), Stivarga (Regorafenib), Sunitinib Malate (Sunitinib), Sutent (Sunitinib Malate), Sylatron (pegylated interferon alfa-2b), Sylvant (Sylvant), Synribo (Mesutuximab), Tabloid (Thioguanine), TAC, Tafinlar (Dabrafenib), Tagrisso (Osimertinib), Talc, Talimogene Laherparepvec, Tamoxifen Citrate, Tarabine PFS (cytarabine), Tarceva (erlotinib hydrochloride), Targretin (bexarotene), Tasigna (nilotinib), Taxol (paclitaxel), Taxotere (docetaxel), Tecentriq (Tecentriq), (atezolizumab), Temodar (temozolomide), Temozolomide, Temsirolimus, Thalidomide, Thalomid, Thioguanine, Thiotepa, Seliferamine, Tolak (fluorouracil-topical), Topotecan hydrochloride, Toremifene, Torisel (temsirolimus), Tositumomab, and Iodine I 131 Tositumomab, Totect (dexrazoxane hydrochloride), TPF, Trabectedin, Trametinib, Trastuzumab, Treanda (bendamustine hydrochloride), Trifluridine hydrochloride and tipiracil, Trisenox (arsenic trioxide), Tykerb (lapatinib ditosylate), Unituxin (denutuximab), Uridine triacetate, VAC, Vandetanib, VAMP, Varubi (rolapitant hydrochloride), Vectibix (panitumumab), VeIP, Velban (vinblastine sulfate Sulfate), Velcade (bortezomib), Velsar (vinblastine sulfate), Vemurafenib, Venclexta (Venetoclax), Venetoclax, Verzenio (Abemaciclib), Viadur (leuprolide acetate), Vidaza (azacitidine), Vinblastine Sulfate, Vincristine Sulfate Injection (Vincasar PFS) (Vincristine Sulfate), Vincristine Sulfate, Vincristine Sulfate Liposomal, Vinorelbine Tartrate (VinorelbineTartrate), VIP, Vismodegib, Vistogard (uridine triacetate), Voraxaze (glutarcapase), Vorinostat (Vorinostat), Votrient (pazopanib hydrochloride), Vyxeos (daunorubicin hydrochloride and cytarabine liposome), Wellcovorin (leucovorin calcium), Xalkori (crizotinib), Xeloda (capecitabine), XELIRI, XELOX, Xgeva (denosumab), Xofigo (radium 223 dichloride), Xtandi (enzalutamide), Y Ervoy (ipilimumab), Yondelis (trabectedin), Zaltrap (ziv-aflibercept), Zarxio (filgrastim), Zejula (niraparib tosylate monohydrate), Zelboraf (vemurafenib), Zevalin (ibritumomab tiuxetan), Zinecard (dexrazoxane hydrochloride), Ziv-aflibercept, Zofran (ondansetron hydrochloride), Zoladex (goserelin acetate), zoledronic acid, Zolinza (vorinostat), Zometa (zoledronic acid), Zydelig (idelalib), Zykadia (ceritinib), and / or Zytiga (abiraterone acetate). The treatment method may include or further include checkpoint inhibitors, including but not limited to antibodies that block PD-1 (nivolumab (BMS-936558 or MDX1106), CT-011, MK-3475), PD-L1 (MDX-1105 (BMS-936559), MPDL3280A or MSB0010718C), PD-L2 (rHIgM12B7), CTLA-4 (ipilimumab (MDX-010), tremelimumab (CP-675,206)), IDO, B7-H3 (MGA271), B7-H4, TIM3, LAG-3 (BMS-986016)).

[0165] I. Embodiment

[0166] The following examples are presented to provide a person of ordinary skill in the art with a complete disclosure and description of how to prepare and evaluate the compounds, compositions, articles, devices and / or methods claimed herein, and are intended to be purely exemplary and not intended to limit the present disclosure. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperatures, etc.), but some errors and deviations should be taken into account. Unless otherwise indicated, parts are parts by weight, temperatures are in degrees Celsius or are ambient temperatures, and pressures are atmospheric or near atmospheric.

[0167] In this example, the effects of naturally occurring microRNAs packaged in bone marrow mesenchymal stem cell-derived extracellular vesicles (BM-MSC EVs) were compared with those of artificially synthesized microRNAs whose sequences were shown to inhibit the formation of inflammasomes and suppress the secretion of the proinflammatory cytokine interleukin 1-β (IL-1β).

[0168] THP-1 cells were differentiated into macrophage phenotype cells and exposed to LPS to induce the cells to produce IL-1β. The cells were then exposed to naturally occurring RNA packaged in BM-MSC EVs or, alternatively, transfected with a mixture of synthetic RNA sequences associated with negative regulation of IL-1β. The miRNA mixture included human miRNA sequences: miR-222-3p, miR-24-3p, miR-27b-3p, miR-221-3p, miR-21-5p. In one test condition, the microRNA hmiR21-5p was transfected alone as it is considered to be the major miRNA regulating IL-1β. 24 hours after LPS and the test article were added to the cells, the conditioned media was collected and IL-1β protein concentration was measured using a commercially available ELISA assay kit. The results of the study are as follows. Figure 1 Table 1 summarizes the percent inhibition of IL-1β in the tested samples relative to cells stimulated with LPS alone.

[0169] Table 1.

[0170]

[0171] Inflammatory modulation by natural and synthetic miRNAs packaged in BM-MSC EVs and synthetic miRNA mimic sequences reported in the literature to regulate IL-1B. Data are expressed as percent inhibition relative to controls of cells stimulated with LPS alone.

[0172] J. Sequence

[0173] SEQ ID NO: 1 miR-92a-3p stem-loop sequence

[0174] CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUG

[0175] UAUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGG

[0176] SEQ ID NO: 2let-7i-5p stem-loop sequence

[0177] CUGGCUGAGGUAGUAGUUUGUGCUGUUGGUCGGGUUGUGACA

[0178] UUGCCCGCUGUGGAGAUAACUGCGCAAGCUACUGCCUUGCUA SEQ ID NO: 3 miR-16-5p stem-loop sequence

[0179] GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAU

[0180] UCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGG

[0181] UUGACSEQ ID NO: 4 miR-93-5p stem-loop sequence

[0182] CUGGGGGCUCCAAAGUGCUGUUCGUGCAGGUAGUGUGAUUAC

[0183] CCAACCUACUGCUGAGCUAGCACUUCCCGAGCCCCCGG

[0184] SEQ ID NO: 5 miR-21-5p stem-loop sequence

[0185] UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCA

[0186] UGGCAACACCAGUCGAUGGGCUGUCUGACA

[0187] SEQ ID NO: 6 miR-29c-3p stem-loop sequence

[0188] AUCUCUUACACAGGCUGACCGAUUUCUCCUGGUGUUCAGAGU

[0189] CUGUUUUUGUCUAGCACCAUUUGAAAUCGGUUAUGAUGUAGG

[0190] GGGA

[0191] SEQ ID NO: 7 miR-34a-5p stem-loop sequence

[0192] GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUG

[0193] UUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCC

[0194] UAGAAGUGCUGCCUGGGGCCC

[0195] SEQ ID NO:8mir-203a-3p

[0196] HOLDING

[0197] UCACAKEKGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGY

[0198] AGACCCGGCGGGCCGGGCGACAGCGA

[0199] SEQ ID NO:9miR-27b-3p

[0200] ACCUMULACOACCAGGAGCUACUACCAGACAG

[0201] UGAUGGGUUUCCGCUUUGUGGGGUGCUUGCACC

[0202] UGAGAGAAGGU

[0203] SEQ ID NO:10miR-140-3p

[0204] UGUCUCUCUCUCUUCACCAGUUUUACCUAUGGU

[0205] HOLDINGHOLDINGHOUSEHOLDING

[0206] AGGAUACCGGGGCACC

[0207] SEQ ID NO:11miR-24-3p

[0208] CUCCGGUGCHOUSEHOLD

[0209] CUGGQGGAGGAG

[0210] SEQ ID NO:12miR-222-3p

[0211] GCUGCUGGAAGUACCAUGGCUCAGUACCAG

[0212] WATERCAREWATERWATERWATER

[0213] HOW TO HOLD UP

[0214] SEQ ID NO:13miR-25-3p

[0215] GGCCAGUUGAGAGGCGGACUUGGGCAAUUGCUGGACGC

[0216] UGCCUGGCAUUGCACUUCGCUGCUGCCCGGCC

[0217] SEQ ID NO:14miR-10b-5p

[0218] CCAGGGUUACCUACCAG

[0219] AUUUGUGGGGGGG

[0220] AAUAUUGGUCGAUGCAAAAACUUCA

[0221] SEQ ID NO:15miR-221-3p

[0222] UGAACAUCCAGCUGGGGCAUGAACCUGCCAUGUAG

[0223] AUUUCUCURRENTAGGCACUCUCUGCUGGGU

[0224] REPLACEMENTACCESSORIES

[0225] SEQ ID NO:16miR-17-5p

[0226] HOLD HOLD HOLD HOLD

[0227] GUGCAUCUACUGCAGUGAAGGCACUUGUAGCAUUAUGGUGAC

[0228] SEQ ID NO: 17miR-30a-5p stem-loop sequence

[0229] GCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCACAGA

[0230] UGGGCUUUCAGUCGGAUGUUUGCAGCUGC

[0231] SEQ ID NO: 18 miR-30d-5p stem-loop sequence

[0232] GUUGUUGUAAACAUCCCCGACUGGAAGCUGUAAGACACAGCU

[0233] AAGCUUUCAGUCAGAUGUUUUGCUGCUAC

[0234] SEQ ID NO: 19 miR-92a-3p mature sequence

[0235] UAUUGCACUUGUCCCGGCCUGU

[0236] SEQ ID NO: 20let-7i-5p mature sequence

[0237] UGAGGUAGUAGUUUGUGCUGUU

[0238] SEQ ID NO: 21 miR-16-5p mature sequence

[0239] UAGCAGCACGUAAAUAUUGGCG

[0240] SEQ ID NO: 22 miR-93-5p mature sequence

[0241] CAAAGUGCUGUUCGUGCAGGUAG

[0242] SEQ ID NO: 23 miR-21-5p mature sequence

[0243] UAGCUUAUCAGACUGAUGUUGA

[0244] SEQ ID NO: 24 miR-214-3p mature sequence

[0245] ACAGCAGGCACAGACAGGCAGU

[0246] SEQ ID NO: 25 miR-29c-3p mature sequence

[0247] UAGCACCAUUUGAAAUCGGUUA

[0248] SEQ ID NO: 26 miR-34a-5p mature sequence

[0249] UGGCAGUGUCUUAGCUGGUUGU

[0250] SEQ ID NO: 27mir-203a-3p mature sequence

[0251] GUGAAAUGUUUAGGACCACUAG

[0252] SEQ ID NO: 28 miR-27b-3p mature sequence

[0253] UUCACAGUGGCUAAGUUCUGC

[0254] SEQ ID NO: 29 miR-140-3p mature sequence

[0255] UACCACAGGGUAGAACCACGG

[0256] SEQ ID NO: 30 miR-24-3p mature sequence

[0257] UGGCUCAGUUCAGCAGGAACAG

[0258] SEQ ID NO: 31 miR-222-3p mature sequence

[0259] AGCUACAUCUGGCUACUGGGU

[0260] SEQ ID NO: 32 miR-25-3p mature sequence

[0261] CAUUGCACUUGUCUCGGUCUGA

[0262] SEQ ID NO: 33 miR-10b-5p mature sequence

[0263] UACCCUGUAGAACCGAAUUUGUG

[0264] SEQ ID NO: 34 miR-221-3p mature sequence

[0265] AGCUACAUUGUCUGCUGGGUUUC

[0266] SEQ ID NO: 35 miR-17-5p mature sequence

[0267] CAAAGUGCUUACAGUGCAGGUAG

[0268] SEQ ID NO: 36 miR-30a-5p mature sequence

[0269] UGUAAACAUCCUCGACUGGAAG

[0270] SEQ ID NO: 37 miR-30d-5p mature sequence

[0271] UGUAAACAUCCCCGACUGGAAG

Claims

1. A composition comprising one or more secretomes and two or more ribonucleic acids (RNAs).

2. The composition of claim 1, wherein the secretome comprises liposomes or lipid nanoparticles.

3. The composition according to claim 1, wherein the secretome comprises exosomes or extracellular vesicles derived from mesenchymal stem cells (MSCs).

4. The composition of any one of claims 1-3, wherein the two or more RNAs comprise microRNA (miRNA), messenger RNA (mRNA), long non-coding RNA (lncRNA), y-RNA and / or pi-RNA.

5. The composition of claim 4, wherein the two or more RNAs include at least one RNA selected from the group consisting of RNY4, LOC441666, SNHG1, RNU11, LOC80154, LOC727751, LOC388152, GOLGA2P2Y, GOLGA2P3Y, SNHG12, RNU12, ASMTL-AS1, LOC284454U2: RF00004.39, U2: RF00004.22, U2: RF00004.35, U2: RF00004.71, U2: RF00004.66 U2: RF00004.91, U2: RF00004.89, U2: RF00004.67, U1: RF00003.5, U1: RF00003.109, U1: RF00003.110, U1: RF00003.

8. U1: RF00003.3, U1: RF00003.6, U1: RF00003.38, U1: RF00003.20, U1: RF00003.24, U1: RF00003.73, U1: RF00003.1 1. U1: RF00003.27, U1: RF00003.40, U1: RF00003.107, U1: RF00003.62, U1: RF00003.45, U1: RF00003.116, U1: RF000 03.126, U1: RF00003.81, U1: RF00003.100, U1: RF00003.57, U1: RF00003.95, U1: RF00003.31, U1: RF00003.61, U1: RF 00003.25, U1: RF00003.90, U1: RF00003.46, U1: RF00003.123, U2: RF00004.42, U2: RF00004.61, U2: RF00004.51, U1 : RF00003.122, U1: RF00003.22, U1: RF00003.9, snoMBII-202: RF00324.2, let-7: RF00027.7, U2: RF00004.75, U1: R F00003.69, U2: RF00004.88, U12: RF00007.1, U7: RF00066.141, U1: RF00003.85, U7: RF00066.49, U2: RF00004.77, U 1: RF00003.113, U1: RF00003.112, U1: RF00003.70, U1: RF00003.83, U7: RF00066.89, U7: RF00066.124, U7: RF00066.

75. U7:RF00066.77, U7:RF00066.118, U7:RF00066.103, U7:RF00066.79, U7:RF00066.200 and U7:RF00066.

146.

6. The composition of claim 4, wherein the two or more RNAs include at least one antisense RNA selected from the group consisting of EPHA1-AS1, FLJ45974, ANKRD30BP2, LINC00340, GRIK1-AS1, LOC440300, CSPG4P8, ADARB2-AS1, MLLT4-AS1, and HNRNPU-AS1.

7. The composition according to claim 4, wherein the two or more RNAs comprise at least one miRNA selected from the group consisting of: hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7e-5p, hsa-let-7g-5p, hsa-let-7i, hsa-let-7i-5p, hsa-miR-100-5p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-106b-5p, hsa-mir-10b, hsa-miR-10b-5p, hsa-mir-1246, hsa-miR-1246, hsa-miR-125a-5p, hsa-miR-125b-5p, hsa-miR-130a-3p, hsa-mir-130b, hsa-miR-130b-3p, hsa-miR-132-3p, hsa-miR-136-5p, hsa-miR-138-5p, hsa-miR-139-5p, hsa-mir-140, hsa-miR-140-3p, hsa-miR-145-5p, hsa-mir-146a, hsa-miR-146a-5p, hsa-miR-148a-3p, hsa-miR-152-3p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-mir-16-1, hsa-mir-16-2, hsa-miR-16-5p, hsa-miR-17-5p, hsa-miR-181a-5p, hsa-miR-191-5p, hsa-miR-193a-5p, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-199a-3p, hsa-miR-199a-5p, hsa-miR-199b-5p, hsa-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-20a-5p, hsa-miR-203a, hsa-miR-203a-3p, hsa-miR-214-3p, hsa-mir-21, hsa-miR-21-3p, hsa-miR-21-5p, hsa-mir-221, hsa-miR-221-3p, hsa-mir-222, hsa-miR-222-3p, hsa-miR-22-3p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-mir-24-1, hsa-mir-24-2, hsa-miR-24-3p, hsa-mir-25hsa-miR-25-3p, hsa-miR-26a-5p, hsa-miR-27a-3p, hsa-mir-27b, hsa-miR-27b-3p, hsa-miR-29a-3p, hsa-miR-29c-3p, hsa-miR-30a-5p, hsa-miR-30a-5p, hsa-miR-30b-5p, hsa-miR-30c-5p, hsa-mir-30d, hsa-miR-30d-5p, hsa-mir-30e, hsa-miR-30e-5p, hsa-miR-31-3p, hsa-miR-31-5p, hsa-miR-320a, hsa-miR-342-3p, hsa-miR-345-5p, hsa-miR-34a-5p, hsa-miR-361-5p, hsa-miR-376a-3p, hsa-miR-376c-3p, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424-5p, hsa-miR-484, hsa-mir-486-1, hsa-mir-486-2, hsa-miR-486-5p, hsa-miR-570-3p, hsa-miR-574-3p, hsa-miR-663a, hsa-miR-874-3p, hsa-mir-92a-1, hsa-mir-92a-2, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-mir-93, hsa-miR-93-5p, hsa-miR-940, hsa-miR-99a-5p and hsa-miR-99b-5p., 8. The composition of claim 6, wherein the two or more RNAs include at least one miRNA selected from the group consisting of miR-92a-3p, let-7i-5p, miR-16-5p, miR-93-5p, miR-21-5p, miR-214-3p, miR-29c-3p, miR-34a-5p, mir-203a-3p, miR-27b-3p, miR-140-3p, miR-24-3p, miR-222-3p, miR-25-3p, miR-10b-5p, miR-221-3p, miR-17-5p, miR-30a-5p, and miR-30d-5p.

9. The composition of claim 4, wherein the two or more RNAs include at least one mRNA selected from the group consisting of HBII-202, U26, U29, HBII-420, U30, U18A, U81, GSKIP, IFT88, PCDH11X, PCDH11Y, KIAA0226L, PDE11A, PHACTR1, TEX14, DCUN1D2, SIM1, FILIP1, FAM107B, CHADL, ZNF365, MNAT 1. CYSTM1, GAS7, HOXB7, ASTN2, LGR5, ZFHX3, MCM7, GRIK1, MAP2, LHFPL3, PTER, STAMBP, CCDC135, PAX9, RPL13, ABC A13, DAAM1, OPN1LW, OPN1MW2, CNOT6L, MTRNR2L10, SMC4, RPL4, PSAP, ASIC4, AHCYL1, RD3L, SIGLEC1, SYCE2 and NANS.

10. The composition of claim 4, wherein the two or more RNAs include at least one antisense mRNA selected from the group consisting of UBAP11, SMC51, TMX11, LTA4H1, KIF20B1, OPCML1, RNLS1, CDKL21, C10orf531, ACOX31, GPC51, GATA41, EPHA61, CNTNAP51, ZRANB31, KIAA17151, TOX1, ALPK1 1. TACR11, ZNF6521, FAM154A1, NAA351, HS3ST41, SLC44A51, CLCN51, ST6GALNAC51, ABCA41, COL5A11, AKIP11, UGT81, DRP21, AMOTL11, FGFR1OP21, WBSCR271, NBPF141, TMEM132E1, GAGE131, GAGE2D1 and GAGE2D: copy 21.

11. The composition according to claim 4, wherein the two or more RNAs include at least one lncRNA selected from the group consisting of LOC100129335-5, ZNF238, CADM2-7, SALL1-6, and VWA5A. 12 . The composition according to claim 4 , wherein the two or more RNAs include at least one antisense lncRNA selected from the group consisting of ANKRD5-1, ZNF236-1, and ACP1.

13. The composition of claim 4, wherein the two or more RNAs include at least one y-RNA selected from the group consisting of RF00019.441, RF00019.451, RF00019.621, RF00019.646, and RF00019.

413.

14. The composition of claim 4, wherein the two or more RNAs include at least one pi-RNA selected from the group consisting of piR-33044, piR-33043, and piR-31703.

15. The composition of any one of claims 1-14, wherein the RNA comprises modifications to reduce degradation.

16. The composition of claim 15, wherein the modification comprises the addition of a 2'-O-methyl, 2'-fluoro, or 2'-hydrogen group.

17. A method of modulating an immune response to an inflammatory injury in a subject, comprising administering to the subject any one of the compositions of any one of claims 1-17.

18. The method of modulating an immune response according to claim 17, wherein the modulation increases inflammation, and wherein the two or more RNAs in the composition include at least one mRNA selected from the group consisting of HBII-202, U26, U29, HBII-420, U30, U18A, U81, GSKIP, IFT88, PCDH11X, PCDH11Y, KIAA0226L, PDE11A, PHACTR1, TEX14, DCUN1D2, SIM1, FILIP1, FAM107B, CHA DL, ZNF365, MNAT1, CYSTM1, GAS7, HOXB7, ASTN2, LGR5, ZFHX3, MCM7, GRIK1, MAP2, LHFPL3, PTER, STAMBP, CCDC135, PAX9, RP L13, ABCA13, DAAM1, OPN1LW, OPN1MW2, CNOT6L, MTRNR2L10, SMC4, RPL4, PSAP, ASIC4, AHCYL1, RD3L, SIGLEC1, SYCE2 and NANS.

19. The method of modulating an immune response according to claim 17, wherein the modulation reduces inflammation, and wherein the two or more RNAs in the composition include at least one miRNA selected from the group consisting of hsa-let-7a-5p, hsa-let-7b-5p, hsa-let-7c-5p, hsa-let-7d-3p, hsa-let-7e-5p, hsa-let-7g-5p, hsa-let-7i, hsa-let-7i-5p, hsa-miR-100-5p, hsa-miR-103a-3p, hsa-miR-106a-5p, hsa-miR-106b-5p, hsa- mir-10b, hsa-miR-10b-5p, hsa-mir-1246, hsa-miR-1246, hsa-miR-125a-5p, hsa-miR-125b-5p, hsa-miR-130a-3p, hsa-mir-130b, hsa-miR-130b-3p , hsa-miR-132-3p, hsa-miR-136-5p, hsa-miR-138-5p, hsa-miR-139-5p, hsa-mir-140, hsa-miR-140-3p, hsa-miR-145-5p, hsa-mir-146a, hsa-miR-1 46a-5p, hsa-miR-148a-3p, hsa-miR-152-3p, hsa-miR-15a-5p, hsa-miR-15b-5p, hsa-mir-16-1, hsa-mir-16-2, hsa-miR-16-5p, hsa-miR-17-5p, hsa -miR-181a-5p, hsa-miR-191-5p, hsa-miR-193a-5p, hsa-miR-193b-3p, hsa-miR-197-3p, hsa-miR-199a-3p, hsa-miR-199a-5p, hsa-miR-199b-5p, hs a-miR-19a-3p, hsa-miR-19b-3p, hsa-miR-20a-5p, hsa-miR-203a, hsa-miR-203a-3p, hsa-miR-214-3p, hsa-mir-21, hsa-miR-21-3p, hsa-miR-21-5p , hsa-mir-221, hsa-miR-221-3p, hsa-mir-222, hsa-miR-222-3p, hsa-miR-22-3p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-mir-24-1, hsa-mir-24-2,hsa-miR-24-3p, hsa-mir-25, hsa-miR-25-3p, hsa-miR-26a-5p, hsa-miR-27a-3p, hsa-mir-27b, hsa-miR-27b-3p, hsa-miR-29a-3p, hsa-miR-29c-3p, hsa-miR-30a-5p, hsa-miR-30a-5p, hsa-miR-30b-5p, hsa-miR-30c-5p, hsa-mir-30d, hsa-miR-30d-5p, hsa-mir-30e, hsa-miR-30e-5p, hsa-miR-31-3p, hsa-miR-31-5p, hsa-miR-320a, hsa-miR-342-3p, hsa-miR-345-5p, hsa-miR-34a-5p, hsa-miR-361-5p, hsa-miR-376a-3p, hsa-miR-376c-3p, hsa-miR-423-3p, hsa-miR-423-5p, hsa-miR-424-5p, hsa-miR-484, hsa-mir-486-1, hsa-mir-486-2, hsa-miR-486-5p, hsa-miR-570-3p, hsa-miR-574-3p, hsa-miR-663a, hsa-miR-874-3p, hsa-mir-92a-1, hsa-mir-92a-2, hsa-miR-92a-3p, hsa-miR-92b-3p, hsa-mir-93, hsa-miR-93-5p, hsa-miR-940, hsa-miR-99a-5p and hsa-miR-99b-5p.

20. A method of treating an autoimmune disease in a subject, comprising administering to the subject any one of the compositions of claims 1-17.

21. A method of treating an autoinflammatory disease in a subject, comprising administering to the subject any one of the compositions of claims 1-17.

22. A method of treating inflammatory damage caused by physical injury in a subject, comprising administering to the subject any one of the compositions of claims 1-17.

23. A method for treating inflammatory lesions caused by microbial infection in a subject, comprising administering to the subject any one of the compositions of claims 1-17.

24. A method for treating inflammatory lesions caused by cancer in a subject, comprising administering to the subject any one of the compositions of claims 1-17.

Images