NNT activation composition and application thereof

Abstract

The invention discloses an NNT activation composition, which comprises an ormosia henryi bark extract, a Northern American arbor bark extract and ascorbyl tetraisopalmitate, and the mass ratio of the ormosia henryi bark extract to the Northern American arbor bark extract to the ascorbyl tetraisopalmitate is (1-15): (1-2.5): (2-50). The method has the characteristic of effectively activating the NNT.

Description

Technical Field

[0001] The present invention relates to a chemical composition, in particular to a NNT activation composition. Background Art

[0002] Nicotinamide nucleotide transhydrogenase (NNT) is a nuclear gene-encoded protein located in the inner membrane of mitochondria. It plays a key role in cellular energy metabolism. It couples the downward flow of protons along the electrochemical proton gradient to complete the hydride transfer from nicotinamide adenine dinucleotide (NADH) to nicotinamide adenine dinucleotide phosphate (NADPH), thereby maintaining the intracellular redox balance. This balance is essential for the normal physiological functions of cells, including energy production, antioxidant defense, DNA repair, etc. In view of the positive effects of NNT in the fields of cellular energy metabolism regulation, redox balance, disease treatment and prevention, and anti-aging, the development of a new composition that can activate NNT has important scientific significance and clinical application value.

[0003] Existing NNT activators are divided into natural extraction, chemical synthesis and biological preparations. Natural extraction NNT activators are active ingredients extracted from certain plants. These ingredients may activate NNT through various pathways and have lower toxicity and side effects, such as plant polyphenols and flavonoids. NNT activators designed and prepared by chemical synthesis have higher activity and specificity. Biological preparation NNT activators are proteins, peptides, antibodies or vaccines prepared by genetic engineering technology. They activate NNT by directly acting on NNT or its related signaling pathways. However, there is currently no new NNT activation composition formed by combining natural extraction and chemical synthesis. Summary of the invention

[0004] The object of the present invention is to provide a NNT activation composition. The present invention has the characteristics of effectively activating NNT.

[0005] The technical solution of the present invention is: an NNT activation composition, comprising a safflower bark extract, a pine bark extract and ascorbyl tetraisopalmitate, wherein the mass ratio of the safflower bark extract, the pine bark extract and the ascorbyl tetraisopalmitate is 1-15:1-2.5:2-50.

[0006] In the aforementioned NNT activation composition, the mass ratio of the Pterocarpus dasyphylla bark extract, the Pine Bark extract and ascorbyl tetraisopalmitate is 1-1.1:1-2:2-5.

[0007] In the aforementioned NNT activation composition, the mass ratio of the Pterocarpus tatarinowii bark extract, the Pine Bark Extract and ascorbyl tetraisopalmitate is 1:1:2.

[0008] In the aforementioned NNT activation composition, the mass ratio of the Pterocarpus tatarinowii bark extract, the Pine Bark Extract and ascorbyl tetraisopalmitate is 1.1:1:2.

[0009] In the aforementioned NNT activation composition, the mass ratio of the Pterocarpus dasyphylla bark extract, the Pine Bark extract and ascorbyl tetraisopalmitate is 5-15:1-2.5:5-50.

[0010] In the aforementioned NNT activation composition, the mass ratio of the Pterocarpus tatarinowii bark extract, the Pine Bark Extract and ascorbyl tetraisopalmitate is 15:2:50.

[0011] In the aforementioned NNT activation composition, the mass ratio of the Pterocarpus tatarinowii bark extract, the Pine Bark Extract and ascorbyl tetraisopalmitate is 15:2.5:50.

[0012] The invention also discloses the use of the NNT activation composition in preparing skin care products with NNT activation function.

[0013] The invention also discloses a skin care product, which contains the NNT activation composition.

[0014] In the aforementioned skin care products, the skin care products include any one of lotion, milk, eye cream, face cream and essence.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] The present invention provides a new NNT activation composition, which is composed of a Pterocarpus tatarinowii bark extract, a North American pine bark extract and ascorbyl tetraisopalmitate. As a single component, the three can activate the expression level of NNT gene and protein, and when mixed in a certain proportion at a specific concentration, the three active ingredients can synergistically activate NNT. DETAILED DESCRIPTION

[0017] The present invention will be further described below in conjunction with the embodiments, but they are not intended to limit the present invention.

[0018] Embodiment 1:

[0019] The invention discloses an NNT activation composition, which is composed of a Pterocarpus tatarinowii bark extract, a Pine bark extract and ascorbyl tetraisopalmitate in a mass ratio of 1:1:2.

[0020] Embodiment 2:

[0021] The invention discloses an NNT activation composition, which is composed of a Pterocarpus tatarinowii bark extract, a Pine bark extract and ascorbyl tetraisopalmitate in a mass ratio of 1.1:1:2.

[0022] Embodiment 3:

[0023] The invention discloses an NNT activation composition, which is composed of a Pterocarpus tatarinowii bark extract, a Pine bark extract and ascorbyl tetraisopalmitate in a mass ratio of 15:2:50.

[0024] Embodiment 4:

[0025] The invention discloses an NNT activation composition, which is composed of a Pterocarpus tatarinowii bark extract, a Pine bark extract and ascorbyl tetraisopalmitate in a mass ratio of 15:2.5:50.

[0026] Comparative Example 1:

[0027] The extract solutions of P. truncatum bark were prepared at concentrations of 0.5, 1, 10, and 25 μg / mL.

[0028] Comparative Example 2:

[0029] North American pine bark extract solutions, with concentrations of 0.5, 1, 10, and 25 μg / mL.

[0030] Comparative Example 3:

[0031] Ascorbyl tetraisopalmitate solutions with concentrations of 1, 25, 100, and 200 μg / mL, respectively.

[0032] Experimental reagents:

[0033] B16F10 melanoma cells (Shanghai Aike Biotechnology Co., Ltd.); RPMI-1640 complete medium (Gibco, Catalog No.: 72400047); 2NNaOH (Sinopharm Group, Catalog No.: 10019718); SPARKscript II RT PlusKit (With gDNAEraser) reverse transcription kit (Acori Biotechnology, Catalog No.: AG11706); RIPA lysis buffer (Biyuntian, Catalog No.: P0013C); NNT antibody (1:1000) (Proteintech, 13442-2-AP); 2×SYBR Green qPCR Mix (With ROX) (Sikejie, Catalog No.: AH0104-C); PBS (Solaibao, Catalog No.: P1010); CCK8 (Biyuntian, Catalog No.: C0038); DMSO (Sigma, Catalog No.: D119415); RNAiso Plus (Acori Biotechnology, catalog number: AG21102); fluorescent dye (Acori Biotechnology, catalog number: AG11701).

[0034] Reagent configuration:

[0035] Preparation of mother solution of Pterocarpus tatarinowii bark extract: weigh 0.03 g of Pterocarpus tatarinowii bark extract sample powder and add it to 1 mL of DMSO (DMSO is used as a co-solvent) to prepare a 30 mg / mL mother solution; the DMSO content in the final concentration of the Pterocarpus tatarinowii bark extract solution is less than or equal to 0.05%;

[0036] Preparation of the stock solution of North American pine bark extract: weigh 1 g of North American pine bark extract sample powder and add it to DMEM complete medium to prepare a 1 g / mL stock solution;

[0037] Preparation of ascorbyl tetraisopalmitate stock solution: Measure 1 mL of ascorbyl tetraisopalmitate sample and add it to DMEM complete medium to prepare a 1% stock solution.

[0038] Then, the mother liquor was diluted according to the addition ratio of the examples and comparative examples to obtain examples 1-4 and comparative examples 1-3.

[0039] Experimental methods:

[0040] 1. NNT activation experiment

[0041] (1) Cell culture: B16F10 cells in the logarithmic growth phase were taken to prepare a cell suspension, and the cell count was adjusted to a concentration of 2×10 5 / mL, inoculated in a 6-well plate, the density of the cells to be tested is 200000 / well; the inoculated cell culture plate is placed in an incubator and cultured for 24 hours until the cells are completely attached to the wall and grow stably, the cell culture medium is discarded, and the mother solution is prepared and the required final concentration of each substance in Examples 1-4 and Comparative Examples 1-3 is used for administration, 3 replicate wells are set, and a cell control well (cells + culture medium) is set at the same time; at 5% CO 2 , and continue incubation at 37°C for 48 hours.

[0042] (2) RNA extraction: Aspirate the cell suspension, add 1 mL of RNA extraction reagent, pipette and transfer to a 1.5 mL centrifuge tube, and let stand for 10 min. Add 200 μL of chloroform to each tube, invert and mix, let stand for 5 min, and centrifuge at 4°C, 12000 g for 10 min. Take 300 μL of supernatant to a new centrifuge tube. Add 300 μL of isopropanol, mix, let stand for 10 min, and then centrifuge to remove the supernatant. Add 75% ethanol to the precipitate to wash the precipitate, and centrifuge at 4°C, 12000 g for 5 min. Discard the supernatant, dry for 10 min, and dissolve the precipitate with enzyme-free water. NanoDrop determines the concentration and purity of RNA and records them, and then uses enzyme-free water to unify the RNA concentration of each group.

[0043] (3) Real-time fluorescence quantitative PCR: The reverse transcription system was configured according to the SPARKscript II RT Plus Kit (With gDNA Eraser) reverse transcription kit. Then, the qPCR reaction was performed according to the instructions of the 2×SYBR Green qPCR Mix (With ROX), and the instrument default melting curve acquisition program was used; pre-denaturation at 94°C for 2.5 min. Then 40 cycles were performed, including denaturation at 94°C for 10 s, annealing at 60°C for 30 s, and fluorescence signal acquisition during annealing. The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. The primer sequences are shown in Table 1 below:

[0044] Table 1. Primer information

[0045] Gene Upstream primer sequence Downstream primer sequence β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT NNT CAGCTCTGATTCCAGGTGGTT ATACTCTGGAGGGTCCGTGG

[0046] (4) Immunoblotting analysis: The number of cells plated was the same as the above method. The extract of Pterocarpus chinensis bark, Pine bark extract and ascorbyl tetraisopalmitate were added according to the final concentration of each component in Table 3. After incubation for 48 hours, the samples were collected. 100 μL of lysis buffer (containing 1% PMSF) was added to each well of a 6-well plate, and the cells were collected and the supernatant was obtained by centrifugation. The BCA method was used to quantify and adjust the cell protein concentration of each group. SDS-PAGE was used for electrophoresis and then transferred to a PVDF membrane. After blocking with 5% skim milk powder at room temperature for 2 hours, the cells were incubated with primary antibodies NNT (1:1000) and β-actin (1:1000) at 4°C overnight, respectively. After 12 to 16 hours, the cells were rinsed with TBST three times, incubated with secondary antibodies for 2 hours, and rinsed with TBST three times. A color developer was added, and the protein bands were visualized under a chemiluminescence imaging system.

[0047] Result analysis:

[0048] Table 2 shows the activation results of NNT gene expression levels of Comparative Examples 1-3 at different concentration gradients.

[0049] Table 2. Comparative NNT gene expression level activation experiment results at different concentration gradients

[0050]

[0051] Note: Statistical analysis was performed between the groups, "SD" represents standard deviation, "*" represents significant difference compared with the BC group, ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05.

[0052] The BC group in the table is a blank control, without any sample added.

[0053] As shown in Table 2, the concentration of the Pterocarpus ovata bark extract is between 1-10 μg / mL, which is significantly different from the blank control (BC) group and can effectively activate the expression of the NNT gene level; the concentration of the North American pine bark extract is between 1-25 μg / mL, which is significantly different from the BC group and can effectively activate the expression of the NNT gene level; the concentration of ascorbyl tetraisopalmitate is between 100-200 μg / mL, which is significantly different from the BC group and can effectively activate the expression of the NNT gene level.

[0054] Table 3 shows the activation results of Comparative Examples 1-3 on the expression level of NNT protein at different concentration gradients.

[0055] Table 3. Comparative NNT protein expression level activation experiment results at different concentration gradients

[0056]

[0057] Note: Statistical analysis was performed between the groups, "SD" represents standard deviation, "*" represents significant difference compared with the BC group, ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05.

[0058] The BC group in the table is a blank control, without any sample added.

[0059] As can be seen from the above table, the sample concentration of the Pterocarpus ovata bark extract is between 10-25 μg / mL, which is significantly different from the BC group and can effectively activate the expression of NNT protein levels; the sample concentration of the Pine Bark Extract is between 10-25 μg / mL, which is significantly different from the BC group and can effectively activate the expression of NNT protein levels; when the sample concentration of ascorbyl tetraisopalmitate reaches 100 μg / mL, it is significantly different from the BC group and can effectively activate the expression of NNT protein levels.

[0060] Table 4 shows the activation results of NNT gene expression levels at different concentrations in Examples 1-4.

[0061] Table 4. Activation experiment results of NNT gene expression level in different concentration gradients

[0062]

[0063] Note: Statistical analysis was performed between the groups, "SD" represents standard deviation, "*" represents significant difference compared with the BC group, ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05.

[0064] The BC group in the table is a blank control, without any sample added.

[0065] As can be seen from the above table, when the concentration of the composition of Example 1 is 10-25 μg / mL, there is a significant difference compared with the BC group, and the gene expression level of NNT can be effectively activated; when the concentration of the composition of Example 2 is 25 μg / mL, there is a significant difference compared with the BC group, and the gene expression level of NNT can be effectively activated; when the concentration of the composition of Example 3 reaches 10-25 μg / mL, there is a significant difference compared with the BC group, and the gene expression level of NNT can be effectively activated. When the concentration of the composition of Example 4 reaches 25 μg / mL, there is a significant difference compared with the BC group, and the gene expression level of NNT can be effectively activated.

[0066] Table 5 shows the NNT gene levels and NNT gene activation comparison results of Examples 1-4 and Comparative Examples 1-3 with a uniform limited concentration of 25 μg / mL.

[0067] Table 5. NNT gene level activation table of Examples 1-4 and Comparative Examples 1-3 at a concentration of 25 μg / mL

[0068]

[0069] Note: Statistical analysis was performed between the groups, "SD" represents standard deviation, "*" represents significant difference compared with the BC group, ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05.

[0070] The BC group in the table is a blank control, without any sample added.

[0071] The King's formula is used to calculate the synergistic effect of the combination. The King's formula is expressed as Q = E(a+b+c) / (Ea+Eb+Ec-Ea*Eb*Ec), E(a+b+c) is the efficacy data after the three substances are combined, and Ea, Eb and Ec are the efficacy data of single components treated separately. If Q < 0.55 is obvious antagonism, Q = 0.55-0.85 is antagonism, Q = 0.85-1.15 is addition, and Q> 1.15 is synergistic effect. It can be seen from the above table that according to King's formula, the Q value calculated in Example 1 is 1.61, which is greater than 1.15; the Q value calculated in Example 2 is 1.26, which is greater than 1.15; the Q value calculated in Example 3 is 1.34, which is greater than 1.15; the Q value calculated in Example 4 is 1.41, which is greater than 1.15. Therefore, compared with Comparative Examples 1, 2 and 3, Examples 1-4 of the present invention have the effect of synergistically improving the activation of NNT. Therefore, it can be considered that the Pterocarpus dasyphylla bark extract, the North American pine bark extract and ascorbyl tetraisopalmitate play a synergistic role in a certain proportion, increasing the ability to activate the expression level of the NNT gene.

[0072] It should be understood that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. For those skilled in the art, the technical solutions described in the above embodiments can be modified, or some of the technical features therein can be replaced by equivalents; and all these modifications and replacements should fall within the scope of protection of the claims attached to the present invention.

Claims

1. A NNT activation composition, characterized in that: The invention comprises a safflower bark extract, a pine bark extract and ascorbyl tetraisopalmitate, wherein the mass ratio of the safflower bark extract, the pine bark extract and the ascorbyl tetraisopalmitate is 1-15:1-2.5:2-50.

2. The NNT activation composition according to claim 1, characterized in that: The mass ratio of the palm tree bark extract, the North American pine bark extract and ascorbyl tetraisopalmitate is 1-1.1:1-2:2-5.

3. A NNT activation composition according to claim 2, characterized in that: The mass ratio of the Pterocarpus tatarinowii bark extract, the Pine bark extract and ascorbyl tetraisopalmitate is 1:1:

2.

4. The NNT activation composition according to claim 2, characterized in that: The mass ratio of the Pterocarpus tatarinowii bark extract, the Pine bark extract and ascorbyl tetraisopalmitate is 1.1:1:

2.

5. The NNT activation composition according to claim 1, characterized in that: The mass ratio of the palm tree bark extract, the North American pine bark extract and ascorbyl tetraisopalmitate is 5-15:1-2.5:5-50.

6. The NNT activation composition according to claim 5, characterized in that: The mass ratio of the Pterocarpus tatarinowii bark extract, the Pine bark extract and ascorbyl tetraisopalmitate is 15:2:

50.

7. The NNT activation composition according to claim 5, characterized in that: The mass ratio of the Pterocarpus tatarinowii bark extract, the Pine bark extract and ascorbyl tetraisopalmitate is 15:2.5:

50.

8. Use of the NNT activating composition according to any one of claims 1 to 7 in preparing a skin care product having the function of activating NNT.

9. A skin care product, characterized in that: The invention comprises the NNT activating composition according to any one of claims 1 to 7.

10. A skin care product according to claim 9, characterized in that: The skin care product includes any one of lotion, milk, eye cream, face cream and essence.

Images