Apoptotic neutrophil loaded with nucleic acid nanomaterial as well as preparation method and application of apoptotic neutrophil

Abstract

The invention discloses an apoptotic neutrophil loaded with a nucleic acid nano-material and a preparation method and application thereof, and relates to the technical field of biological medicine, and the apoptotic neutrophil loaded with the nucleic acid nano-material comprises MnO2 nano-particles, siRNA and apoptotic neutrophil which are connected through chemical bonds. The apoptotic neutrophile granulocytes are neutrophile granulocytes in an apoptosis stage. The preparation method comprises the following steps: incubating MnO2 crystals and nucleic acid Syk siRNA to obtain a nucleic acid-loaded nano material; co-incubating with apoptotic neutrophils; the invention also provides application of the compound in preparation of anti-inflammatory drugs. The apoptotic neutrophil loaded with the nucleic acid nano material has triple anti-inflammatory effects and can be used for preparing anti-inflammatory drugs.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an apoptotic neutrophil loaded with nucleic acid nanomaterials, and a preparation method and application thereof. Background Art

[0002] Acute lung injury is usually caused by pathogen infection, mechanical ventilation, smoking and other factors. It has a high mortality rate and long-term health effects. It is a serious clinical disease and poses a major challenge to the society and medical system. The inflammatory response plays a key role in the pathogenesis of acute lung injury. The recruitment of a large number of neutrophils in the lesions of lung tissue, the release of inflammatory factors, proteases and ROS by necrotic cells, and the polarization of proinflammatory macrophages all damage the alveolar capillary membrane, leading to pulmonary edema and alveolar collapse. Therefore, blocking the activation and polarization of alveolar inflammatory cells is particularly important for improving this pathophysiological process.

[0003] At present, there are two main methods for clinical treatment of acute lung injury: mechanical ventilation and drug therapy. Mechanical ventilation mainly assists patients in spontaneous breathing to save patients with respiratory failure, but mechanical ventilation will retain airway secretions and cause lung infection and inflammation. Although drug therapy will not cause lung infection and inflammation, antibiotics and steroids are mainly used for drug therapy in the prior art. Long-term use of such drugs is prone to drug resistance and side effects. Therefore, it is necessary to provide safe and side-effect-free drugs for the treatment of acute lung injury. Summary of the invention

[0004] The purpose of the present invention is to solve at least one of the technical problems existing in the prior art and to provide an apoptotic neutrophil loaded with nucleic acid nanomaterials and a preparation method and application thereof.

[0005] The technical solution of the present invention is as follows: The first aspect of the present invention provides an apoptotic neutrophil loaded with nucleic acid nanomaterials, comprising MnO2 nanoparticles, siRNA and apoptotic neutrophils, wherein the MnO2 nanoparticles, siRNA and apoptotic neutrophils are connected by chemical bonds; The apoptotic neutrophils are neutrophils in the apoptosis stage.

[0006] Optionally, the siRNA is a nucleic acid Syk siRNA, and the nucleotide sequence of the nucleic acid Syk siRNA is as follows: F: 5'-CCAGAGATGAATCAGAGCAGAC-3'; R: 5'-GCAGGCACAGAGCATAGGA-3'.

[0007] Optionally, the mass ratio of the MnO2 nanoparticles to the Syk siRNA is 1-3:1; The concentration of apoptotic neutrophils was 1×10 5 / mL~1×10 6 Pieces / mL.

[0008] Optionally, the apoptosis rate of the apoptotic neutrophils is greater than 40%.

[0009] Optionally, the particle size of the MnO2 nanoparticles ranges from 150nm to 300nm.

[0010] Optionally, the MnO2 nanoparticles, nucleic acid Syk siRNA and apoptotic neutrophils are connected via covalent bonds and ionic bonds, specifically via polyethyleneimine (PEI).

[0011] The second aspect of the present invention provides a method for preparing the above-mentioned apoptotic neutrophils loaded with nucleic acid nanomaterials, comprising the following steps: Adding MnO2 crystals into water to dissolve to obtain a MnO2 solution; adding polyethyleneimine solution into the MnO2 solution, mixing, and obtaining a mixed solution; The mixed solution is incubated with nucleic acid Syk siRNA, and washed with nuclease-free water after centrifugation to obtain a nanomaterial loaded with nucleic acid; The newly extracted neutrophils were irradiated under ultraviolet light, centrifuged and washed with cell culture medium to obtain apoptotic neutrophils; The nucleic acid-loaded nanomaterial is co-incubated with the apoptotic neutrophils to obtain apoptotic neutrophils loaded with the nucleic acid nanomaterial.

[0012] Optionally, the method for preparing the MnO2 crystal comprises the following steps: Dissolve potassium permanganate in water and stir to obtain a potassium permanganate solution; Add oleic acid dropwise to the potassium permanganate solution and stir to obtain a reaction solution; The reaction solution is centrifuged, and the precipitate is washed with anhydrous ethanol until the supernatant is transparent; the ethanol is further removed by washing with deionized water to obtain MnO2 crystals; Wherein, the addition ratio of potassium permanganate to oleic acid is 0.1g:0.5~1.5mL.

[0013] Optionally, the concentration of the MnO2 solution is 0.5-1.5 mg / mL, the concentration of the polyethyleneimine solution is 15-25 mg / mL, and the added volume ratio of the MnO2 solution to the polyethyleneimine solution is 1-2:1-2.

[0014] Optionally, the mass ratio of the MnO2 crystal to the Syk siRNA is 1-3:1, the incubation temperature is 3-5°C, and the incubation time is 25-35 min; The concentration of apoptotic neutrophils was 1×10 5 / mL~1×10 6 / mL, the irradiation time is 5-15min, the co-incubation temperature is 35-39°C, and the co-incubation time is 1.5-2.5 hours.

[0015] The third aspect of the present invention provides the use of the apoptotic neutrophils loaded with nucleic acid nanomaterials in the preparation of anti-inflammatory drugs.

[0016] Optionally, the drugs include anti-inflammatory drugs and autoimmune disease drugs.

[0017] The fourth aspect of the present invention provides an anti-inflammatory drug, comprising the apoptotic neutrophils loaded with nucleic acid nanomaterials as described above.

[0018] The present invention has at least one of the following beneficial effects: 1. The apoptotic neutrophils of the present invention have the functions of anti-inflammatory and promoting tissue repair. The principle is to recruit macrophages, remove dead cells through burial without causing inflammatory response, and promote the process of inflammation resolution. siRNA is a kind of research on the development of anti-inflammatory and anti-tumor drugs by inhibiting the polarization of inflammatory cells. The nucleic acid Syk siRNA used in the present invention is synthesized by Shanghai Shenggong Biotechnology Co., Ltd. (F (5'-3'): CCAGAGATGAATCAGAGCAGAC; R (5'-3'): GCAGGCACAGAGCATAGGA), which has anti-inflammatory effect. MnO2 is a ROS catalyst and is used in the targeted treatment of chronic inflammatory diseases, such as atherosclerosis.

[0019] 2. The apoptotic neutrophil @ MnO2 nanoparticles @ Syk siRNA (aNeut@pMn@iSyk) system prepared by the present invention has triple anti-inflammatory effects. First, the Syk siRNA loaded by the MnO2 nanomaterial itself exerts an anti-inflammatory effect, secondly, the nanomaterial MnO2 exerts an anti-inflammatory effect through redox action and scavenging ROS, and finally, the apoptotic neutrophils exert an anti-inflammatory effect through cell burial and release of anti-inflammatory substances. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Particle size distribution of MnO2 obtained by dynamic light scattering (DLS).

[0021] Figure 2The phase analysis light scattering (PALS) technique was used to obtain the zeta potential of MnO2, pMn, and pMn@iSyk, and gel electrophoresis was used to detect the connection efficiency of MnO2@PEI and Syk siRNA.

[0022] Figure 3 Schematic diagram of the material structure obtained by SEM and the localization of the material engulfed by apoptotic neutrophils in lysosomes.

[0023] Figure 4 The alleviating effect of aNeut@pMn@iSyk on lung inflammation in ALI mice. H&E, PAS, and Masson staining results of C (Control), M (Model), and NM (aNeut@pMn@iSyk) groups (magnification 100 times).

[0024] Figure 5 This is the polarization effect of aNeut@pMn@iSyk on macrophages in the lung perfusate of ALI mice. DETAILED DESCRIPTION

[0025] In order to make the technical problems, technical solutions and beneficial effects solved by the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0026] The present invention is further described in detail below with specific examples, but the present invention is not limited to the following specific examples.

[0027] Example 1 This embodiment provides a method for preparing apoptotic neutrophils loaded with nucleic acid nanomaterials (apoptotic neutrophils @ MnO2 nanoparticles @ Syk siRNA, aNeut@pMn@iSyk), comprising the following steps: (1) Preparation of manganese dioxide crystals Preparation: ① Weigh 0.1g potassium permanganate into a clean round-bottom flask, dissolve it in 50ml deionized water, put a magnetic bar into the flask, and stir in a blender for 15min; ② Add 1ml oleic acid to the flask and stir for 1h; ③ Centrifuge the solution and wash the precipitate with anhydrous ethanol until the supernatant is transparent; ④ Wash with deionized water to remove the ethanol.

[0028] Calculate the MnO2 concentration: ① Use 10ml of deionized water to dissolve the precipitate, take a 1ml centrifuge tube, weigh it, and place 1ml of the solution in the centrifuge tube. After sufficient centrifugation, pour out the supernatant and dry it, weigh it again, and you can calculate the concentration; (2) Preparation of nucleic acid-loaded nanomaterials Nucleic acid Syk siRNA was purchased from Shanghai Shenggong Biotechnology Co., Ltd., and its nucleotide sequence is F (5'-3'): CCAGAGATGAATCAGAGCAGAC; R (5'-3'): GCAGGCACAGAGCATAGGA.

[0029] Combined with PEI: ① Dilute the manganese dioxide crystals to 1 mg / ml and take 5 ml into a vial; ② Take 5 ml of 20 mg / ml PEI and transfer it to the vial containing manganese dioxide, that is, there is 10 ml of reaction system in the vial, and stir for 4 hours; ③ Incubate the above-prepared materials with nucleic acid Syk siRNA at a concentration ratio of 1~6:1 (that is, in the reaction system, the concentration of nucleic acid Syk siRNA is 1 / 6 mg / ml~1 mg / ml) at 4°C for 30 minutes; after centrifugation, wash with nuclease-free water 2-3 times.

[0030] At the same time, for comparison, no manganese dioxide crystals were added, that is, the manganese dioxide crystals and the nucleic acid Syk siRNA were mixed at a concentration ratio of 1:0, and other conditions were the same as above.

[0031] (3) Preparation of apoptotic neutrophils After killing Kunming mice, the tibia and femur of the mice were separated, the bone marrow was washed with PBS under sterile conditions, and the cell suspension was collected. According to the instructions of the Solebol manufacturer, the mouse neutrophil suspension was separated and enriched.

[0032] The extracted mouse neutrophils were irradiated under ultraviolet light for 10 minutes, washed 2-3 times with 1640 culture medium (RPMI-1640 culture medium) after centrifugation, and the apoptosis rate was detected to be greater than 40%; then the apoptotic neutrophils were incubated with the nucleic acid-loaded nanomaterials in an incubator for 2 hours.

[0033] Figure 1 The particle size distribution of MnO2 obtained by dynamic light scattering (DLS) is Figure 1 It can be seen that in the aNeut@pMn@iSyk material prepared in this embodiment, the particle size of the MnO2 nanoparticles ranges from 150 to 300 nm; and it can be seen that potassium permanganate has formed manganese dioxide crystals.

[0034] Figure 2 The phase analysis light scattering (PALS) technique was used to obtain the zeta potential of MnO2, pMn, and pMn@iSyk, and the gel electrophoresis was used to detect the connection efficiency between MnO2@PEI and Syk siRNA. Figure 2 As can be seen from the left figure, the pMn@iSyk colloidal dispersion prepared in this example is stable. Figure 2As can be seen from the right figure, when manganese dioxide and nucleic acid Syk siRNA are mixed at a concentration ratio of 0 to 1:1, manganese dioxide and nucleic acid Syk siRNA are not connected together or the connection effect is poor; when they are mixed at a concentration ratio of 2 to 6:1, manganese dioxide and nucleic acid Syk siRNA are connected together, and the connection effect of 6:1 is the best.

[0035] Figure 3 The structure of aNeut@pMn@iSyk material obtained by SEM and the schematic diagram of apoptotic neutrophils engulfing the material and localizing it in lysosomes. Figure 3 It showed that activated macrophages in mice engulfed aNeut@pMn@iSyk to form phagosomes, which then fused with intracellular lysosomes to exert an endocytic effect.

[0036] Example 2 This example provides the use of apoptotic neutrophils loaded with nucleic acid nanomaterials (apoptotic neutrophils @ MnO2 nanoparticles @ Syk siRNA, aNeut@pMn@iSyk) prepared in Example 1 as an anti-inflammatory drug, specifically the use of aNeut@pMn@iSyk to inhibit mouse otitis, and the specific method is as follows: The model of acute otitis is that xylene induces the release of inflammatory mediators, such as histamine, kinins, and plasmin, which causes an increase in local capillary permeability and infiltration of inflammatory cells, resulting in acute exudative inflammatory edema in the ear. Therefore, the weight change of the ear before and after the induction of inflammation can reflect the severity of inflammation. This example is intended to explore the inhibitory effect of different concentrations of aNeut@pMn@iSyk (15ug / ml, 50ug / ml, and 75ug / ml) on the infiltration of inflammatory cells in otitis tissue.

[0037] Methods: Kunming male mice aged 6-8 weeks were divided into model group, low-dose group (15ug / ml), medium-dose group (50ug / ml), and high-dose group (75ug / ml) with 4 mice in each group. 200ul of apoptotic neutrophils@MnO2 nanoparticles@Syk siRNA solution of different concentrations was injected through the tail vein. The next day, 50ul of xylene was applied to both sides of the left ear of the mouse, and the right ear was not treated. After 60 minutes of induction, redness and swelling of the mouse ears were observed. The mice in each group were anesthetized and killed, and the ears of each mouse were cut off. The left and right ears of the same area were taken with a 6mm diameter puncher, weighed and recorded.

[0038] Results: Compared with the Model group, the ear weights of the 50ug / ml and 75ug / ml groups were significantly lower than those of the Model group. Statistical analysis showed that the differences were significant (Table 1).

[0039] Experimental Example 3 This example provides the use of apoptotic neutrophils loaded with nucleic acid nanomaterials (apoptotic neutrophils @ MnO2 nanoparticles @ Syk siRNA, aNeut@pMn@iSyk) prepared in Example 1 as an anti-inflammatory drug, specifically the effect of aNeut@pMn@iSyk on the alleviation of inflammation in the lung tissue of mice with acute lung injury, and the specific method is as follows: As mentioned above, in acute inflammatory reactions, inflammatory cells gather and infiltrate into the inflammatory lesions. The purpose of this example is to explore the effect of aNeut@pMn@iSyk on the alleviation of inflammation in the lung tissue of mice with acute lung injury from a pathological perspective.

[0040] Methods: The mice were divided into three groups, with five mice in each group; they were divided into Control group (group C), Model group (group M), and aNeut@pMn@iSyk (group NM). The concentration of aNeut@pMn@iSyk was 50ug / ml. Groups C and M were not treated first, and the NM group was injected with 200ul of the corresponding drug. The next day, mice in groups M and NM were injected with lipopolysaccharide (LPS, 200μg / kg) by intratracheal instillation to induce acute lung injury model. Within 24 hours after the end of the experiment, 5 mice in each group were anesthetized, fixed, chest dissected, and killed by cardiac exsanguination. The right hilum was ligated to remove the right lung. The right lung was fixed with 4% formaldehyde solution. The formaldehyde-treated right lung was dehydrated by alcohol gradient and transparentized by xylene, then embedded in paraffin, cooled and made into 3 μm sections, and stained with H&E, PAS, and Masson. The pathological results were analyzed by digital analysis imaging system for tissue morphology of the stained sections.

[0041] Figure 4 The alleviating effect of aNeut@pMn@iSyk on lung inflammation in ALI mice, including the H&E, PAS, and Masson staining results of the C (Control) group, M (Model) group, and NM (aNeut@pMn@iSyk) group (magnification 100 times). Figure 4 The pathological staining results showed that the degree of inflammatory cell infiltration in the lung tissue of mice treated with aNeut@pMn@iSyk was reduced, and the alveolar glycomucus secretion and collagen deposition were significantly reduced, indicating that aNeut@pMn@iSyk can alleviate lung inflammatory response.

[0042] Experimental Example 4 This example provides the use of apoptotic neutrophils loaded with nucleic acid nanomaterials (apoptotic neutrophils @ MnO2 nanoparticles @ Syk siRNA, aNeut@pMn@iSyk) prepared in Example 1 as an anti-inflammatory drug, specifically the effect of aNeut@pMn@iSyk on the polarization of pro-inflammatory macrophages M1 in bronchoalveolar lavage fluid, and the specific method is as follows: There are two polarized states of macrophages: M1 and M2. The activation level of M1 cells is often used as an important indicator to assess the severity of inflammatory response. In the pathological process of acute lung injury, macrophages tend to polarize to M1. These polarized M1 macrophages increase in number in the early stages of the disease and release proinflammatory cytokines including tumor necrosis factor α (TNF-α), interleukin 6 (IL-6), and inducible nitric oxide synthase (iNOS). These cytokines play a key role in the body's defense mechanism, helping to resist the invasion of pathogens. However, they also cause acute damage to the lungs, triggering a series of pathological changes such as alveolar edema and increased vascular permeability. The purpose of this example is to explore the effect of aNeut@pMn@iSyk on macrophage polarization.

[0043] Methods: The mouse acute lung injury model was induced and the administration method was the same as in Experimental Example 3. Within 24 hours after the end of the experiment, an equal amount of mouse lung perfusate was collected; antibodies Alexa Fluor® 594 anti-mouse CD68 (2.5 μg / mL) and FITCanti-mouse F4 / 80 (2.5 μg / mL) were added to the cells in the lung perfusate, incubated for 1 hour, and washed 4 times with PBS. The stained cell suspension was detected by flow cytometry (BD FACSVerse3), and the collected data were analyzed using flow cytometry analysis software to determine the polarization degree of macrophages to M1.

[0044] Figure 5 The polarization effect of aNeut@pMn@iSyk on macrophages in the lung perfusate of ALI mice. Figure 5 It can be seen that compared with group C, the proportion of M1 macrophages in group M increased significantly, but after treatment with aNeut@pMn@iSyk, the proportion of M1 cell polarization in lung perfusate decreased significantly, indicating that aNeut@pMn@iSyk has a strong inhibitory effect on the polarization of macrophages to pro-inflammatory M1.

[0045] In summary, apoptotic neutrophils @ MnO2 nanoparticles @ Syk siRNA (aNeut@pMn@iSyk) were prepared by the method of Example 1, which has triple anti-inflammatory effects. First, the Syk siRNA loaded by the MnO2 nanomaterial itself exerts an anti-inflammatory effect, and secondly, the nanomaterial MnO2 exerts an anti-inflammatory effect through redox action and scavenging ROS, and finally, apoptotic neutrophils exert anti-inflammatory effects through cell burial and release of anti-inflammatory substances. Examples 2 to 4 prove that apoptotic neutrophils @ MnO2 nanoparticles @ Syk siRNA prepared by the method of Example 1 have anti-inflammatory effects and can be used in anti-inflammatory drugs.

[0046] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. An apoptotic neutrophil loaded with nucleic acid nanomaterials, characterized in that: It includes MnO2 nanoparticles, siRNA and apoptotic neutrophils, wherein the MnO2 nanoparticles, siRNA and apoptotic neutrophils are connected by chemical bonds; The apoptotic neutrophils are neutrophils in the apoptosis stage.

2. The apoptotic neutrophils loaded with nucleic acid nanomaterials according to claim 1, characterized in that: The siRNA is a nucleic acid Syk siRNA, and the nucleotide sequence of the nucleic acid Syk siRNA is as follows: F: 5'-CCAGAGATGAATCAGAGCAGAC-3'; R: 5'-GCAGGCACAGAGCATAGGA-3'.

3. The apoptotic neutrophils loaded with nucleic acid nanomaterials according to claim 2, characterized in that: The mass ratio of the MnO2 nanoparticles to the nucleic acid Syk siRNA is 1-3:1; The concentration of apoptotic neutrophils was 1×10 5 / mL~1×10 6 Pieces / mL.

4. The apoptotic neutrophils loaded with nucleic acid nanomaterials according to claim 2, characterized in that: The apoptosis rate of the apoptotic neutrophils is greater than 40%; the particle size of the MnO2 nanoparticles ranges from 150nm to 300nm.

5. The method for preparing apoptotic neutrophils loaded with nucleic acid nanomaterials according to any one of claims 1 to 4, characterized in that: The following steps are involved: Adding MnO2 crystals into water to dissolve to obtain a MnO2 solution; adding polyethyleneimine solution into the MnO2 solution, mixing, and obtaining a mixed solution; The mixed solution is incubated with siRNA, and after centrifugation, it is washed with nuclease-free water to obtain a nanomaterial loaded with nucleic acid; The centriole cells were irradiated under ultraviolet light, centrifuged and washed with cell culture medium to obtain apoptotic neutrophils; The nucleic acid-loaded nanomaterial is co-incubated with the apoptotic neutrophils to obtain apoptotic neutrophils loaded with the nucleic acid nanomaterial.

6. The preparation method according to claim 5, characterized in that: The method for preparing the MnO2 crystal comprises the following steps: Dissolve potassium permanganate in water and stir to obtain a potassium permanganate solution; Add oleic acid dropwise to the potassium permanganate solution and stir to obtain a reaction solution; The reaction solution is centrifuged, and the precipitate is washed with anhydrous ethanol until the supernatant is transparent; the ethanol is further removed by washing with deionized water to obtain MnO2 crystals; Wherein, the addition ratio of potassium permanganate to oleic acid is 0.1g:0.5~1.5mL.

7. The preparation method according to claim 5, characterized in that: The concentration of the MnO2 solution is 0.5-1.5 mg / mL, the concentration of the polyethyleneimine solution is 15-25 mg / mL, and the added volume ratio of the MnO2 solution to the polyethyleneimine solution is 1-2:1-2.

8. The preparation method according to claim 5, characterized in that: The mass ratio of the MnO2 crystal to the siRNA is 1-3:1, the incubation temperature is 3-5°C, and the incubation time is 25-35 min; The concentration of apoptotic neutrophils was 1×10 5 / mL~1×10 6 / mL, the irradiation time is 5-15min, the co-incubation temperature is 35-39°C, and the co-incubation time is 1.5-2.5 hours.

9. Use of the apoptotic neutrophils loaded with nucleic acid nanomaterials according to any one of claims 1 to 4 in the preparation of anti-inflammatory drugs.

10. An anti-inflammatory drug, characterized in that: The invention comprises apoptotic neutrophils loaded with nucleic acid nanomaterials according to any one of claims 1 to 4.

Images