Tetrahedral framework nucleic acid related to microRNA-200c as well as preparation method and application of tetrahedral framework nucleic acid

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to tetrahedral framework nucleic acid related to microRNA-200c as well as a preparation method and application of the tetrahedral framework nucleic acid. The tetrahedral framework nucleic acid delivery system related to the microRNA-200c is provided by combining the extremely strong cell entry performance and lysosome escape ability of the tetrahedral framework nucleic acid (tFNAs) and the gene targeting specificity of the microRNA-200c, and the system has good stability, biological safety, cell entry efficiency and tissue permeability. In the aspect of periodontitis treatment, tFNAs and miR-200c play a synergistic treatment role, inflammation can be effectively relieved, ROS generation can be inhibited, osteogenic differentiation and matrix mineralization can be promoted, alveolar bone resorption can be relieved, a new treatment strategy is provided for periodontitis, and the application prospect is good.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to a tetrahedral framework nucleic acid related to microRNA-200c and a preparation method and use thereof. Background Art

[0002] At present, the common methods for treating periodontal disease in clinic are basic treatment, drug treatment and surgical treatment, etc., which are mainly aimed at removing infection and controlling the development of lesions, but it is difficult to regenerate and repair the lost periodontal tissue, especially bone tissue. MicroRNA (miRNA) is a type of non-coding RNA with a length of 18-25 amino acids encoded by endogenous genes. It can regulate the expression of mRNA after transcription and affect a variety of physiological phenomena, such as cell proliferation and differentiation, adaptive immunity, tumor growth, etc., and participate in the occurrence and development of diseases including periodontal disease. Therefore, miRNA-based treatment methods can be considered as a new treatment for periodontitis. However, the targeting, stability and delivery efficiency of RNA drugs in complex biological environments still face many problems. The lack of safe and effective nucleic acid delivery vectors is a key factor restricting the further clinical transformation of RNA drugs. Current RNA therapies are mainly based on RNA delivery systems of lipids, exosomes, polymers and viruses. However, the current nano-delivery systems are heterogeneous in composition and surface chemistry, which often lead to problems such as biological toxicity, uneven encapsulation and poor targeting, limiting their large-scale production and clinical application. Therefore, finding a highly controllable and reproducible way to achieve efficient delivery of RNA drugs is a bottleneck for RNA therapy. Currently, potential toxicity and lack of tissue specificity have caused most RNA therapies to remain in the experimental stage.

[0003] microRNA-200c (miR-200c) is a member of the miR-200 family and has the function of regulating inflammatory response and osteoblast differentiation. Studies have shown that miR-200c can improve the inflammatory response in periodontitis mouse models and reduce alveolar bone resorption. Its mechanism of action is related to the RANKL / RANK / OPG axis regulated by SOX2, providing new molecular targets and therapeutic strategies for the treatment of periodontitis.

[0004] Tetrahedral framework nucleic acids (tFNAs) are a new type of nucleic acid nanomaterials, which are self-assembled into a tetrahedral structure by four prefabricated single-stranded DNAs. They have the advantages of excellent cell entry properties, good biocompatibility, easy editing, excellent biodegradability, etc. They have shown great potential in drug delivery and biomedical therapeutic carriers.

[0005] In summary, the current treatment of periodontitis with microRNA-200c has problems such as poor targeting, low stability and low delivery efficiency. Therefore, there is an urgent need to develop a new miRNA-200c drug delivery system in this field to enhance the intracellular uptake of miRNA and the delivery efficiency into the cytoplasm, so as to provide a more effective treatment strategy for the treatment of periodontitis. Summary of the invention

[0006] In view of the problems of the prior art, the present invention provides a tetrahedral framework nucleic acid related to microRNA-200c and a preparation method and use thereof.

[0007] A functionalized tetrahedral framework nucleic acid, wherein the functionalized tetrahedral framework nucleic acid is modified with microRNA-200c.

[0008] Preferably, it is assembled by four DNA-microRNA chains through complementary base pairing; the DNA-microRNA chain is composed of four single-stranded DNAs with sticky ends combined with microRNA-200c with sticky ends.

[0009] Preferably, the nucleotide sequences of the four single-stranded DNAs with sticky ends are shown as SEQ ID NO.1 to SEQ ID NO.4.

[0010] Preferably, the microRNA-200c with sticky ends is composed of SEQ ID NO.5 and SEQ ID NO.10 through base complementary pairing.

[0011] The nucleotide sequence of microRNA-200c having sticky ends is shown in SEQ ID NO.5.

[0012] The present invention also provides a method for preparing the functionalized tetrahedral framework nucleic acid, comprising the following steps:

[0013] Step 1: Mix four single-stranded DNAs with sticky ends and incubate them to obtain a DNA tetrahedral framework nucleic acid with sticky ends;

[0014] Step 2: Mix the microRNA-200c with sticky ends and the DNA tetrahedral framework nucleic acid with sticky ends, and incubate them to obtain.

[0015] Preferably, in step 1, the molar ratio of the four single-stranded DNAs is 1:1:1:1;

[0016] And / or, in step 2, the molar ratio of the microRNA-200c with sticky ends to any one single-stranded DNA is 1:1.

[0017] The present invention also provides use of the functionalized tetrahedral framework nucleic acid in preparing a drug for treating periodontitis.

[0018] Preferably, the drug is capable of inhibiting cellular inflammation.

[0019] Preferably, the drug is capable of promoting osteogenic differentiation.

[0020] The present invention also provides a medicine for treating periodontitis, which is prepared by using the functionalized tetrahedral framework nucleic acid as an active ingredient and adding pharmaceutically acceptable auxiliary materials.

[0021] The present invention designs a tetrahedral framework nucleic acid (tFNAs) related to microRNA-200c (miR-200c), called "T-200c". By utilizing the extremely strong cell entry performance and lysosomal escape ability of tFNAs and the gene targeting specificity of miR200c, tFNAs and miR-200c play a synergistic therapeutic role in the treatment of periodontitis. T-200 can effectively reduce inflammation, inhibit the production of ROS, promote osteogenic differentiation and matrix mineralization, and effectively reduce alveolar bone resorption, providing a new treatment strategy for periodontitis with good application prospects.

[0022] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0023] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The results of synthesis, verification, characterization, stability and cell uptake of T-200c are shown in Figure 2. (a) Schematic diagram of the synthesis process of T-200c. (b) Agarose gel electrophoresis experiment verifies the successful synthesis of T-200c. (c) The molecular weight of the synthesized T-200c is detected by HPCE. (d, e) AFM and TEM images show the tetrahedral structure of the synthesized T-200c. (f) The size of tFNA and T-200c is detected by potentiometry.

[0025] Figure 2The results of synthesis, verification, characterization, stability and cell uptake of T-200c are shown in Figure 2. (g) The zeta potential distribution of tFNA and T-200c was detected by potentiometry. (h,i) Stability evaluation of T-200c during culture with 2% and 10% FBS at 37°C. (j) Stability evaluation of T-200c after incubation at 4°C for 0-7 days. (k) RNase H cleavage experiment of T-200c.

[0026] Figure 3 The synthesis, validation, characterization, stability and cellular uptake results of T-200c. (l) Cellular uptake of T-200c, stFNA and miRNA during a 12-hour culture period. Fluorescence signals corresponding to Cy5-labeled T-200c, stFNA and miRNA preparations were detected. (m) Quantitative evaluation of relative fluorescence intensity of cellular uptake experiments. (n) Flow cytometry was used to detect the uptake of miR-200c, stFNA and T-200c by cells.

[0027] Figure 4 T-200c can target MyD88, inhibit the phosphorylation of the NF-κB signaling pathway and the expression of proinflammatory cytokines in PDLSCs under inflammatory conditions, and reduce the expression of cellular ROS. (a) Schematic diagram of the effect of T-200c on the NF-κB pathway in PDLSCs drawn by Figdraw. (b) Western blot results of the expression of MyD88, IRAK1, TRAF6, NF-κB p65, NF-κBp-p65, IL-1β, TNF-α, IL-6 and IL-8 in PDLSCs after different treatments for 48 hours. (c) Western blot quantitative analysis results.

[0028] Figure 5 T-200c can target MyD88, inhibit the phosphorylation of the NF-κB signaling pathway and the expression of proinflammatory cytokines in PDLSCs under inflammatory conditions, and reduce the expression of cellular ROS. (d) Immunofluorescence images of the expression of MyD88, IRAK1, TRAF6, NF-κB p65, IL-1β, and IL-6 in PDLSCs after 48 hours of different treatments. (e) Quantitative analysis of immunofluorescence results.

[0029] Figure 6 T-200c can target MyD88, inhibit the phosphorylation of NF-κB signaling pathway and the expression of proinflammatory cytokines in PDLSCs under inflammatory conditions, and reduce the expression of cellular ROS. (f) Inverted fluorescence microscopy was used to analyze the production of cellular ROS induced by LPS. (g) Immunofluorescence quantitative analysis of ROS results. (h) Flow cytometry was used to detect the production of cellular ROS.

[0030] Figure 7The effect of T-200c on the migration and proliferation of PDLSCs under inflammatory conditions. (a) Western blot results of p-Akt, p-GSK-3β and β-catenin expression in PDLSCs after 48 hours of different treatments. (b) Quantitative analysis of Western blot results. (c) Immunofluorescence images of p-Akt and β-catenin expression in PDLSCs after 48 hours of different treatments. (d) Quantitative analysis of immunofluorescence results. (ef) Effects of different treatments on the cell migration ability of inflammatory PDLSCs, statistical analysis of cell migration results at 0h, 12h, 24h and 48h.

[0031] Figure 8 The effect of T-200c on the osteogenesis of PDLSCs under inflammatory microenvironment. (a) Schematic diagram of T-200c promoting the osteogenic differentiation of PDLSCs drawn by Figdraw (b) Western blotting results of ALP, RUNX2, OCN, OPN and COL-1 expression in PDLSCs after different treatments. (c) Quantitative analysis of Western blotting results.

[0032] Fig. 9 The promoting effect of T-200c on osteogenesis of PDLSCs under inflammatory microenvironment. (df) Immunofluorescence images of ALP, RUNX2 and OCN expression in PDLSCs after different treatments and osteogenesis induction. (g) Quantitative analysis of immunofluorescence results.

[0033] Fig.10 The promoting effect of T-200c on the osteogenesis of PDLSCs under inflammatory microenvironment. (h) ALP staining was used to observe the osteogenic differentiation of PDLSCs on the 7th day of osteogenic induction, and ARS staining was used to monitor calcium nodules on the 21st day of osteogenic induction. (i) Quantitative analysis of ALP staining and ARS staining results.

[0034] Fig.11 T-200c can inhibit inflammatory bone resorption in the rat periodontitis model. (a) Figdraw's in vivo experimental scheme, including the establishment of the rat periodontitis model, drug injection, tissue sample collection, and data analysis. (b) Three-dimensional reconstruction of the rat right maxilla. (c) Quantitative analysis of trabecular bone parameters (BV / TV, Tb.Th, Tb.N, and Tb.Sp in the rat right maxilla ROI).

[0035] Fig.12 T-200c can inhibit inflammatory bone resorption in the rat periodontitis model. (d) Statistical analysis of the degree of alveolar bone resorption on the buccal and palatal sides of the right maxillary second molar of the rat. (e) HE staining images of the alveolar ridge at 5x and 20x magnification. (f) Masson trichrome staining images of the periodontal ligament at 5x and 20x magnification.

[0036] Fig.13 T-200c can inhibit alveolar bone inflammation and promote osteogenesis in rats with periodontitis. (a) Immunofluorescence staining of NF-κB in alveolar bone of rats with periodontitis. (b, c) Immunohistochemical staining of IL-1β and IL-6 in alveolar bone of rats with periodontitis after different treatments. (d) Immunofluorescence staining of β-catenin in alveolar bone of rats with periodontitis. (e, f) Immunohistochemical staining of RUNX2 and OCN in alveolar bone of rats with periodontitis after different treatments. Purple arrows indicate cells expressing RUNX2 and OCN proteins. (g) Quantification of immunofluorescence and immunohistochemical results. DETAILED DESCRIPTION

[0037] In the following examples and experimental examples, reagents and raw materials not specifically described are all commercially available products.

[0038] Example 1: Functionalized tetrahedral framework nucleic acid (T-200c) and its preparation method

[0039] The present embodiment provides a tetrahedral framework nucleic acid related to microRNA-200c, referred to as T-200c; the oligonucleotide chain sequences of the present invention are all manufactured by Sangon (Sangon Biotechnology, Shanghai). Four ssDNA sequences (sS1, sS2, sS3, sS4) with sticky DNA ends were dissolved in TM Buffer (10mM Tris-HCl, 50mM MgCl2, pH=8.0), and the final concentration of the four DNA single strands was 1000nM. They were fully mixed, quickly heated to 95°C and maintained for 10 minutes, and then quickly cooled to 4°C and maintained for more than 20 minutes. Tetrahedral framework nucleic acids (stFNAs) with sticky ends were synthesized by self-assembly. Next, 4mM miR-200c with sticky ends was fully mixed with 1mM stFNA, and then incubated at room temperature for 30 minutes to synthesize 1mM T-200c ( Figure 1 a). The miR-200c with sticky ends is composed of SEQ ID NO.5 and SEQ ID NO.10 through base complementary pairing. The nucleotide sequence of the present invention is shown in Table 1, wherein S1-S4 are 4 DNA single strands without sticky ends, and miR-200c antisense is an RNA antisense strand without sticky ends.

[0040] Table 1 Nucleotide sequence table

[0041]

[0042]

[0043] Note: Capital letters in the table represent DNA monomers, and lowercase letters represent RNA monomers

[0044] This comparative example provides the control samples used in the experiment:

[0045] Comparative Example 1: microRNA-200c (miR-200c)

[0046] This sample is miR-200c.

[0047] The nucleotide sequence of miR-200c is:

[0048] sense(5'-3')uaauacugccggguaaugaugga;

[0049] antisense(5'-3')uccaucauuacccggcaguauua.

[0050] Comparative Example 2: Tetrahedral DNA Framework Nucleic Acids (stFNAs) with Sticky Ends

[0051] The sample was prepared according to the method of Example 1, and four ssDNA sequences (sS1, sS2, sS3, sS4) with sticky ends of DNA were dissolved in TM Buffer (10mM Tris-HCl, 50mM MgCl2, pH=8.0), and the final concentration of the four DNA single strands was 1000nM, and the mixture was fully mixed, and quickly heated to 95°C for 10 minutes, and then quickly cooled to 4°C and maintained for more than 20 minutes, and self-assembled to synthesize DNA tetrahedral framework nucleic acids (stFNAs) with sticky ends. The nucleotide sequences of the four ssDNAs (sS1, sS2, sS3, sS4) are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4, as shown in Table 1.

[0052] The technical solution of the present invention is further illustrated by experiments below.

[0053] Experimental Example 1 Physical and Chemical Characterization of T-200c

[0054] 1. Experimental Methods

[0055] Agarose gel electrophoresis (AGE) and high performance capillary electrophoresis (HPCE) were used to analyze T-200c. Atomic force microscopy (AFM) and transmission electron microscopy (TEM) were used to observe the morphology of the prepared T-200c. Zetasizer NanoZS90 was used to measure the size and potential of the prepared tFNA and T-200c.

[0056] Drug-serum stability experiment: T-200c was mixed with different concentrations (2% or 10%) of FBS (corning, New York, USA) and incubated at 37°C for 0, 2, 4, 6, 8, 10, 12 and 24 hours. The products were analyzed by AGE.

[0057] Storage stability: T-200c was stored at 4°C for 1-7 days, and the results were also analyzed using AGE.

[0058] Enzyme activity stability experiment: T-200c was mixed with RNase H (Sangon Biotechnology, China) at 37°C for 1 hour, and the specific cleavage effect of RNase H on T-200c was observed using AGE.

[0059] Cell entry detection experiment: Cy5-stFNA was synthesized by fluorescently modifying Cy5 on the sS1 chain; Cy5-miR-200c was synthesized by fluorescently modifying Cy5 on miR-200c; Cy5-T-200c was synthesized by fluorescently modifying Cy5 on the sS1 chain and miR-200c. After starvation for 2 hours, human periodontal ligament stem cells (PDLSCs) were cultured in α-MEM medium with different concentrations of nucleic acid drugs (Cy5-miR-200c 1μM, Cy5-stFNA 250nM, Cy5-T-200c 250nM) for 12 hours.

[0060] Immunofluorescence: The cell nucleus and cytoskeleton are stained and then photographed.

[0061] Flow cytometer (FC500 Beckman, Illinois, USA): quantitative analysis of the efficiency of the three materials entering cells.

[0062] 2. Experimental Results

[0063] 2% agarose gel electrophoresis and capillary electrophoresis confirmed the molecular weight differences among miR-200c, sS1-sS4, stFNA, and T-200c ( Figure 1 b and 1c). To facilitate fluorescence observation, sulfo-cyano group 5 (Cy5) was modified on sS1 and miR-200c to visually demonstrate the successful preparation of T-200c. The morphology of T-200c was then evaluated using transmission electron microscopy (TEM) and atomic force microscopy (AFM). The results showed that T-200c had a uniform size distribution and a triangular structure with a small size ( Figure 1Dynamic light scattering (DLS) was used to evaluate the potential and size distribution of the produced T-200c. Characterization of T-200c showed that its structure was negatively charged and its size was 14.62 ± 2.64 nm, which was larger than that of tFNAs (8.253 ± 2.015 nm, Figure 1 f). The Zeta potential of T-200c (-8.05±3.00mV) and tFNAs (-6.99±2.58mV) were both close to 0 as measured by the nanoparticle potentiostat. Figure 2 g).

[0064] In order to verify the ability of T-200c to maintain proper stability in a serum environment, a drug-serum stability experiment was performed using agarose gel electrophoresis. The results showed that the higher the serum concentration, the easier it was for T-200c to separate from the system. T-200c remained stable for at least 24 hours in 2% FBS and for at least 12 hours in 10% FBS ( Figure 2 h and 2i). In addition, the storage stability of T-200c was evaluated and it was found that T-200c could be stored at 4°C for at least one week ( Figure 2 j). T-200c was mixed with RNase H (Sangon Biotechnology, China). The results showed that when the enzyme activity reached 12.5 U mL -1 When the enzyme activity increases, more miRNA is released ( Figure 2 k).

[0065] The results are as follows Figure 3 As shown in Figures 1 and 3, after 12 hours, a large number of stFNA and T-200c particles entered the cell membrane, while only a few miR-200c particles were absorbed by the cells. There was no significant difference in the efficiency of stFNA and T-200c, and the fluorescence intensity of Cy5 in the T-200c group was much higher than that in the miR-200c group. Flow cytometry analysis ( Figure 3 n) It was further verified that tFNA facilitates the entry of miRNA into cells. The efficiency of miR-200c entering cells (PDLSCs: 18.2%) was significantly lower than that of T-200c (PDLSCs: 94.8%). The above results show that T-200c is an effective miRNA delivery system that can improve the entry efficiency and stability of miRNA.

[0066] Experimental Example 2: In vitro study of the therapeutic effect of T-200c on periodontitis

[0067] 1. Experimental Methods

[0068] 1. Cell culture and grouping

[0069] Primary periodontal ligament stem cells were isolated and cultured. All operations followed ethical guidelines, obtained informed consent from the donors, and met the review requirements of the Medical Ethics Committee of West China Hospital of Stomatology, Sichuan University (ethics number: WCHSIRB-D-2024-231). The study samples were healthy teeth from adults aged 18 to 25 years who needed tooth extraction for orthodontic reasons. Immediately after tooth extraction, the teeth were immersed in Eagle-AlphaModified (α-MEM) (HyClone, Logan, USA) supplemented with 10% penicillin / streptomycin. They were then rinsed three times with sterile phosphate-buffered saline (PBS). The root periodontal ligament tissue was scraped with a sterile blade and digested with 1% type I collagenase (Sangon, Shanghai, China) in a 37°C constant temperature water bath for 30 min. The digested tissue was centrifuged (1000r, 5 minutes) to remove the supernatant, resuspended in α-MEM medium containing 20% ​​FBS and 1% penicillin-streptomycin solution, inoculated in a T25 culture flask, cultured at a constant temperature of 37°C and 5% carbon dioxide, and digested and passaged with trypsin when the cell density reached 80-90%. The first batch of PDLSCs was designated as P0, and the 3rd-5th generation cells were used for subsequent experiments. The experimental groups were Blank group, LPS group, LPS+miR-200c group, LPS+stFNA group, and LPS+T-200c group; except for the blank group, the remaining groups were exposed to 10ug / ml LPS for 24h to induce an inflammatory state, and then PDLSC cells were treated with miR-200c mimics, stFNA, and T-200c for 48 hours.

[0070] 2. Western Blot Analysis

[0071] 3. Immunofluorescence staining

[0072] The samples were first fixed with 4% paraformaldehyde for 30 minutes and treated with 0.5% Triton X-100 for 10 minutes. The samples were blocked with 5% goat serum for 1 hour and then incubated with primary antibodies MyD88 (1:100), p-Akt (1:100), and β-catenin (1:100) at 4°C overnight. The next day, the samples were incubated with diluted fluorescent secondary antibodies (1:500, Invitgen, Carlsad, USA) for 1 hour, and then stained with fluorescein isothiocyanate (FITC) for 30 minutes for the cytoskeleton and DAPI for 10 minutes for the nucleus. Finally, confocal laser microscopy (FV3000; Olympus) was used to capture images of cell samples.

[0073] 4. Cell scratch test

[0074] PDLSCs were first co-cultured with 10ug / ml LPS for 24 hours, and then a cross was scratched on the bottom of all wells with a sterile pipette tip. After PBS washing, the cells were treated with TM buffer, miR-200c, stFNA and T-200c in 2% FBS α-MEM culture medium, and the migration degree of cells was observed using an Olympus microscope at 0, 12, 24, and 48h after administration.

[0075] 5. ROS detection

[0076] Except for the blank group, the PDLSC cells in the other groups were exposed to 10ug / ml LPS for 24h to induce an inflammatory state, and then the PDLSC cells were treated with miR-200c mimics, stFNA and T-200c for 12h, respectively. The ROS detection kit (Beyotime, Shanghai, China) was used to explore the protective effect of T-200c on PDLSCs under LPS-induced oxidative stress. After the cells were incubated with the fluorescent probe DCFH-DA at 37°C for 20 minutes, the reactive oxygen species in the cells could oxidize the non-fluorescent DCFH to generate fluorescent DCF, and the level of intracellular reactive oxygen species was detected by measuring the fluorescence intensity of DCF.

[0077] 6. Flow cytometry

[0078] 7. ALP and ARS staining

[0079] When the cell fusion rate of PDLSCs in the well plate reached about 80%, the cells of the control group and the experimental group were treated with 10ug / ml LPS for 24h, and then cultured in a culture medium containing different concentrations of nucleic acid drugs (miR-200c 1μM, stFNA 250nM, T-200c 250nM) for 48h, washed with PBS, and replaced with Oricell human stem cell osteogenic differentiation medium (Cyagen Biosciences Inc., Goleta, California, USA) for osteogenic induction. PDLSCs were fixed with 4% paraformaldehyde after 7 days and 21 days of osteogenic induction treatment, and stained with BCIP / NBT alkaline phosphatase colorimetric kit and osteoblast mineralized nodule staining kit (Alizarin Red S method) (Beyotime, Shanghai, China), respectively, and the alkaline phosphatase activity and mineralized nodules in the samples were observed under an optical microscope.

[0080] 2. Experimental Results

[0081] 1. T-200c inhibits PDLSC cell inflammation and ROS production

[0082] The 3'-UTR of myeloid differentiation factor 88 (MyD88) has a miR-200c binding site. Overexpression of miR-200c can target and inhibit the expression of MyD88, thereby inhibiting the TLR / MyD88 / NF-κB-related inflammatory pathway activated by LPS ( Figure 4 a). Western blot analysis showed that compared with the control group, the levels of IRAK1 and TRAF6 in PDLSCs exposed to LPS were increased, the expression of NF-κB p65 and NF-κBp-p65 was upregulated, and the levels of inflammatory factors such as IL-1β, TNF-α, IL-6 and IL-8 were significantly increased ( Figure 4 b and 4c). This indicates that LPS promotes MyD88 expression and activates the NF-κB inflammatory pathway. Compared with the LPS group, the LPS+miR-200c group and the LPS+stFNA group did not have a significant regulatory effect on the NF-κB pathway and its downstream inflammatory factors, but in the LPS+T-200c group, the expression of IRAK1, TRAF6 and NF-κB in PDLSCs was significantly reduced, and the levels of downstream inflammatory factors also decreased significantly. Immunofluorescence staining also showed the same results. Under LPS treatment, the expression of typical inflammatory factors such as IL-1β and IL-6 was significantly upregulated. Compared with the LPS group, the expression levels of inflammatory factors in the LPS+miR-200c group and the LPS+stFNA group decreased, but the decrease was not as obvious as that in the LPS+T-200c group ( Figure 5 d and 5e). In conclusion, T-200c effectively inhibited LPS-induced activation of the IRAK1 / TRAF6 / NF-κB pathway and reduced the expression of pro-inflammatory cytokines by targeting MyD88.

[0083] The high reactive oxygen species (ROS) microenvironment of periodontitis can aggravate periodontal tissue damage and cause alveolar bone resorption. Therefore, proper removal of excessive reactive oxygen species is beneficial to protect stem cells from the influence of the inflammatory microenvironment. The experimental results showed that the fluorescence intensity of cells treated with LPS was significantly higher than that of the blank group. After treatment with stFNA and T-200c, the intracellular ROS level was significantly downregulated, but the fluorescence intensity of the LPS+T-200c group was the lowest ( Figure 6 f-6h). The above results indicate that T-200c can effectively inhibit the production of ROS in PDLSCs, thereby alleviating LPS-induced oxidative stress damage.

[0084] 2. T-200c promotes the proliferation activity of inflammatory PDLSC cells

[0085] Akt, also known as protein kinase B, can activate β-catenin by phosphorylating serine / threonine kinase GSK-3β, which enters the nucleus. Western blot results showed that ( Figure 7 a and 7b). Compared with the blank group, the expression of p-Akt, p-GSK-3β and β-catenin in the LPS group was significantly inhibited. The expression of p-Akt, p-GSK-3β and β-catenin in the LPS+T-200c group was the highest, and the effect was significantly stronger than that in the LPS+miR-200c group and the LPS+stFNA group. The immunofluorescence results further confirmed this ( Figure 7 c and 7d). The results showed that T-200c could inhibit the inflammatory pathway, then activate the phosphorylation expression of the Akt / β-catenin pathway and promote the proliferation of PDLSCs in the inflammatory microenvironment.

[0086] Four time points (0h, 12h, 24h, 48h) were used to explore the PDLSCs scratch experiment induced by LPS. By analyzing the cell migration rate, the results showed that the cell migration speed was significantly reduced under the in vitro inflammatory environment, while T-200c significantly restored the cell migration ability ( Figure 7 e and 7f).

[0087] Based on the above results, T-200c can increase the phosphorylation expression of the Akt / β-catenin pathway, promote the proliferation activity of PDLSCs in the inflammatory microenvironment, and restore the migration ability of cells in an in vitro inflammatory environment.

[0088] 3. T-200c promotes osteogenic differentiation of PDLSC cells

[0089] First, the protein levels of ALP, COL-1, RUNX2, OCN, and OPN were measured by WB. In the inflammatory environment, the expression of these osteogenic proteins was significantly reduced in the control group. However, the protein expression levels in the LPS+T-200c group were significantly increased ( Figure 8 b and 8c). The cell immunofluorescence staining also showed the same results. Compared with the LPS group, LPS+miR-200c group and LPS+stFNA group, the fluorescence intensity of ALP, RUNX2 and OCN proteins in the LPS+T-200c group was more obvious ( Fig. 9 d-9g).

[0090] To verify the early osteogenic differentiation status of PDLSCs, ALP staining was used 7 days after osteogenic induction ( Fig.10h and 10i), insoluble blue precipitates appeared in all five groups. Compared with the other groups, the staining of the control group was lighter, reflecting the impaired osteogenic ability of PDLSCs in the inflammatory microenvironment. In contrast, the staining of the LPS+T-200c group was the darkest, similar to that of the blank group, indicating stronger ALP activity, which suggests that T-200c can effectively restore the osteogenic ability of PDLSCs damaged by inflammation. In order to further evaluate the long-term osteogenic differentiation ability of PDLSCs, Alizarin Red S staining was used to observe the mineralized nodules on the surface of PDLSCs after 21 days of osteogenic induction, which is an important marker of osteoblast differentiation and maturation. The above results are consistent with the results of ALP staining, showing that the aggregation of calcified nodules in the LPS+T-200c group was significantly higher than that in the LPS group, LPS+miR-200c group and LPS+stFNA group. These results indicate that T-200c can not only enhance early osteogenic differentiation markers, but also significantly promote the long-term maturation of osteoblasts, demonstrating its potential role in osteoblast differentiation. The mechanism diagram is shown in Figure 8 a.

[0091] In conclusion, these results suggest that T-200c can enhance osteogenic differentiation and matrix mineralization by promoting the proliferation of PDLSCs and reversing inflammatory and oxidative stress damage.

[0092] Experimental Example 3: In vivo, T-200c can inhibit periodontal inflammation and promote osteogenesis

[0093] 1. Experimental Methods

[0094] 1. Animal modeling and treatment

[0095] 7-8 week old SD female rats were used for the animal experiment, and all operations were carried out in accordance with the guidelines of the Animal Ethics Committee of Sichuan University (Ethics Number: WCHSIRB-D-2024-328). Rats aged 7-8 weeks were randomly divided into 5 groups: blank group (injection of normal saline), control group (ligation + injection of normal saline), miR-200c group (ligation + injection of miR-200c), stFNA group (ligation + stFNA) and T-200c group (ligation + injection of T-200c), with 5 rats in each group. After 7 days of adaptive feeding, except for the blank group, the other groups used 5-0 silk thread to ligate the second molar of the right maxillary bone of the rats for 2 weeks. After 2 weeks, normal saline or drugs (25ul) were injected into the gingival sulcus of the second molar of the rats in the corresponding group every other day. After 3 weeks of continuous injection, the rats were killed, dissected and the right maxillary bone was taken for corresponding examination ( Fig.11 a).

[0096] 2. Micro-CT analysis

[0097] The right maxillary alveolar bone was surgically removed and fixed in 4% paraformaldehyde. After immersion in 70% ethanol, the maxillary bone was scanned and analyzed using a μCT 50 micro-CT (SCANCO Medical AG, Switzerland) with the following scanning parameters: scanning voltage 55 kV, current 200 μA, and resolution 10 μm pixel. First, the three-dimensional reconstruction of the alveolar bone was performed using the SCANCO medical evaluation software, and the position of the cementoenamel junction to the alveolar crest (CEJ-ABC) on the buccal and palatal sides of the second molar was measured. Subsequently, the alveolar bone between the buccal roots of the second molar was drawn as a region of interest (ROI), with a total of 70 2D slices, and the bone volume and microscopic spatial structure of trabeculae were described using BV / TV, Tb.N, Tb.Th, and Tb.Sp.

[0098] 3. Histological analysis

[0099] The right maxillary bones of rats were decalcified with EDTA and embedded in paraffin. The sections were stained with H&E and Masson's trichrome to observe the degree of alveolar bone inflammatory infiltration and the morphology and density of collagen fibers. Immunofluorescence staining was used to detect the relative expression levels of NF-κB p65 and β-catenin to evaluate the improvement of local inflammatory infiltration and the effect of promoting cell proliferation in rats with periodontitis. Immunohistochemistry was used to detect the relative expression levels of IL-1β, IL-6, RUNX2, and OCN to analyze the degree of inflammation and osteogenesis in different groups. All samples were detected using a tissue scanner (Aperio ScanScope XT; Leica Biosystems, USA).

[0100] 2. Experimental Results

[0101] To investigate the alveolar bone resorption and bone quality in rats with periodontitis, micro-CT scanning was performed on the right maxillary alveolar bone. Fig.11 b is a 3D reconstruction of the right maxillary bone, showing the degree of alveolar bone resorption in each group. Compared with the blank group, the root exposure of the second molar in the control group was significantly increased, and the root bifurcation lesions were severe, indicating that the alveolar bone of the rats in the ligation group was severely damaged, resulting in vertical and horizontal bone loss, indicating that the periodontitis model was successfully established. After local injection of drugs, the effects of miR-200c and stFNA groups alone on preventing alveolar bone resorption were limited. On the contrary, alveolar bone resorption in the T-200c group was significantly inhibited, and osteogenesis below the root bifurcation was enhanced.

[0102] Among the bone analysis parameters of Micro-CT, the bone volume fraction BV / TV (bone volume / total bone volume) is a commonly used indicator to evaluate the volume of cortical bone and cancellous bone in the region of interest (ROI). This ratio reflects the volume of trabecular bone in different samples. Fig.11As shown in Figure c, the BV / TV value of the alveolar bone around the maxillary second molar in the control group was significantly lower than that in the blank group, indicating that the alveolar bone resorption was more. However, after T-200c treatment, the BV / TV value increased significantly, exceeding that of the miR-200c and stFNA groups, indicating that miR-200c was effectively delivered to the periodontal tissue through stFNA and could significantly slow down alveolar bone resorption. Trabecular number (Tb.N), trabecular thickness (Tb.Th) and trabecular separation (Tb.Sp) are important indicators for evaluating the spatial morphological structure of trabecular bone. In the control group, bone resorption was greater than bone synthesis, Tb.N and Tb.Th decreased, and Tb.Sp increased, indicating that osteoporosis occurred in rats with periodontitis. Compared with the control group and other treatment groups, all bone parameters in the T-200c group were significantly improved, especially the trabecular separation was significantly reduced, while there was no significant difference in Tb.Th and Tb.N between the stFNA group and the T-200c group.

[0103] To quantify the extent of alveolar bone resorption, we measured the distance between the cementoenamel junction (CEJ) and the alveolar bone crest (ABC) on the buccal and palatal sides of the mesiodistal roots of the second molars. Fig.12 As shown in Figure d, the CEJ-ABC distance of the control group was significantly greater than that of the blank group, both on the buccal and palatal sides. Although the T-200c group also showed some bone resorption relative to the blank group, the alveolar ridge height was significantly restored compared with the miR-200c and stFNA groups, which was significantly different from the control group (p<0.01). In conclusion, T-200c significantly improved various bone resorption-related parameters in rats with periodontitis. stFNA effectively delivered miR-200c to the periodontal tissue, enhanced its therapeutic effect, and effectively alleviated alveolar bone resorption.

[0104] To determine the severity of periodontitis, H&E staining was used to observe the degree of inflammatory cell infiltration. Fig.12 As shown in Figure e, there was almost no inflammatory cell infiltration at the top of the alveolar ridge in the blank group, while obvious inflammatory cell infiltration was found in the gingival tissue of the control group, indicating that the number of inflammatory cells continued to increase with the progression of periodontitis. The gingival tissue of the T-200c group was similar to that of the blank group, with almost no inflammatory cell infiltration. There was no significant difference in the degree of inflammatory infiltration between the miR-200c group and the control group. The inhibitory effect of the stFNA group on inflammatory infiltration was better than that of the miR-200c group, but still lower than that of the T-200c group. These results indicate that T-200c can inhibit inflammatory infiltration around the alveolar bone of rats, alleviate periodontitis symptoms, and reduce the degree of tissue damage caused by inflammation.

[0105] When the number of inflammatory cells in the periodontal tissue increases, the collagenase released by them will destroy the fibrous connective tissue in the periodontal ligament, causing the collagen fibers to degenerate, dissolve, and even fall off. Fig.12f) showed that the collagen content of periodontal tissue in the control group decreased and the collagen fibers were sparse due to inflammation, while the collagen fiber structure of the miR-200c group and stFNA group was improved after treatment compared with the control group. The collagen fiber content of periodontal tissue treated with T-200c was significantly higher than that of other treatment groups, and the structure was dense and neatly arranged, indicating that T-200c can effectively restore the fiber structure of periodontal tissue by inhibiting the infiltration of inflammatory cells.

[0106] In order to further verify the mechanism of action of T-200c in the treatment of periodontitis, immunofluorescence staining experiments were used to detect the expression levels of genes related to inflammation and cell proliferation pathways, and immunohistochemistry staining experiments were further used to detect the release of inflammatory factors and the expression levels of osteogenic markers. After 5 weeks of silk ligation accompanied by 3 weeks of drug or saline treatment, the NF-κB fluorescence intensity in the control group was the highest compared with the blank group, indicating that the pro-inflammatory pathway in the periodontal supporting tissue was activated when periodontitis occurred. Compared with the simple miR-200c group and the stFNA group, the red fluorescence intensity of the T-200c group was the lowest, indicating that T-200c effectively blocked the NF-κB pathway ( Fig.13 a, 13d). In addition, the results of IL-1β and IL-6 immunohistochemical staining showed ( Fig.13 b, 13c), the accumulation of brown-yellow staining was the least in the T-200c group, followed by the stFNA group, and there was no significant difference in the accumulation of brown-yellow staining between the control group and the miR-200c group. The β-catenin fluorescence intensity of the control group was the lowest compared with the blank group, and the red fluorescence intensity of the T-200c group was the highest compared with the simple miR-200c group and the stFNA group ( Fig.13 d). Immunohistochemical staining ( Fig.13 e, 13f), the cytoplasm or nucleus of cells with positive expression of RUNX2 and OCN was stained yellow-brown. Except for the control group, the expression of RUNX2 and OCN in the T-200c group was upregulated, and the positive staining area was the largest. At the same time, the expression of RUNX2 and OCN in the miR-200c group and the stFNA group was lower than that in the T-200c group, Fig.13 g is the quantitative result of the above experiment. These results show that T-200c can promote cell proliferation, migration and osteogenic differentiation to offset the adverse effects of inflammation on cells, and the effect of T-200c is significantly stronger than miR-200c and stFNA, which is consistent with the results of in vitro experiments. T-200c can promote the proliferation and differentiation of osteoblasts by regulating the NF-κB and β-catenin signaling pathways, thereby inhibiting the release of inflammatory factors and significantly delaying the occurrence and development of periodontitis.

[0107] In summary, the T-200c of the present invention is an effective miR-200c delivery system that can improve the entry efficiency and stability of miR-200c; it enhances osteogenic differentiation and matrix mineralization by promoting the proliferation of PDLSCs and reversing inflammation and oxidative stress damage, effectively alleviating alveolar bone resorption, and provides a new treatment strategy for periodontitis.

Claims

1. A functionalized tetrahedral framework nucleic acid, characterized in that: The functionalized tetrahedral framework nucleic acid is modified with microRNA-200c.

2. The functionalized tetrahedral framework nucleic acid according to claim 1, characterized in that: It is assembled by four DNA-microRNA chains through complementary base pairing; the DNA-microRNA chain is formed by combining four single-stranded DNAs with sticky ends and microRNA-200c with sticky ends.

3. The functionalized tetrahedral framework nucleic acid according to claim 2, characterized in that: The nucleotide sequences of the four single-stranded DNAs with sticky ends are shown as SEQ ID NO.1 to SEQ ID NO.

4.

4. The functionalized tetrahedral framework nucleic acid according to claim 2, characterized in that: The nucleotide sequence of the microRNA-200c with sticky ends is shown in SEQ ID NO.

5.

5. The method for preparing a functionalized tetrahedral framework nucleic acid according to any one of claims 1 to 4, characterized in that: The steps include: Step 1: Mix four single-stranded DNAs with sticky ends and incubate them to obtain a DNA tetrahedral framework nucleic acid with sticky ends; Step 2: Mix the microRNA-200c with sticky ends and the DNA tetrahedral framework nucleic acid with sticky ends, and incubate them to obtain.

6. The preparation method according to claim 5, characterized in that: In step 1, the molar ratio of the four single-stranded DNAs is 1:1:1:1; And / or, in step 2, the molar ratio of the microRNA-200c with sticky ends to any one single-stranded DNA is 1:

1.

7. Use of the functionalized tetrahedral framework nucleic acid according to any one of claims 1 to 4 in the preparation of a drug for treating periodontitis.

8. The use according to claim 7, characterized in that: The drug is capable of inhibiting cellular inflammation.

9. The use according to claim 7, characterized in that: The drug is capable of promoting osteogenic differentiation.

10. A drug for treating periodontitis, characterized in that: The invention is prepared by taking the functionalized tetrahedral framework nucleic acid as any one of claims 1 to 4 as an active ingredient and adding pharmaceutically acceptable auxiliary materials.

Images