A fluorescent quantitative PCR reference dye and its preparation method and application

Abstract

The present invention belongs to the field of chemical synthesis and biotechnology, and specifically relates to a synthesis process scheme and application method for a fluorescent quantitative PCR reference dye. If an accurate Ct value is to be obtained in real-time fluorescent quantitative PCR, the fluorescent signal generated during the PCR thermal cycle needs to be combined with the reference dye, and the signal of the sample needs to be normalized before data analysis. At present, the best effect in the existing technology is the ROX mixed dye, but it objectively has the problem that the two reagents are inconvenient to mix and the mixing ratio affects the result. In order to solve this problem, the present invention develops a new dye that does not interact with the components of the nucleic acid amplification reaction, does not participate in DNA amplification, and does not affect the efficiency of the amplification reaction. In particular, it can directly replace ROX on instruments that require a reference dye, without the need to be mixed with other dyes, thereby solving the problem that the existing technology can only use ROX mixed dyes.

Description

Technical Field

[0001] The invention belongs to the field of chemical synthesis and biotechnology, and particularly relates to a synthesis process scheme and an application method for a fluorescent quantitative PCR reference dye. Background Art

[0002] Polymerase chain reaction (PCR) technology leverages the denaturation and renaturation principles of DNA, employing thermophilic extension, high-temperature denaturation, and low-temperature renaturation to achieve in vitro amplification of nucleic acid fragments. This allows for the specific amplification of minute amounts of target DNA by millions of fold, thereby enhancing the analysis and detection of DNA molecules. Real-time fluorescence quantitative polymerase chain reaction (Q-PCR) technology incorporates fluorescent groups into the PCR amplification reaction system, utilizing the accumulation of fluorescent signals to monitor the entire PCR process in real time. By accurately detecting Ct values, the number of target sequences can be determined. This technology has enabled a leap from qualitative to quantitative PCR, significantly advancing the development of molecular diagnostics.

[0003] To obtain accurate Ct values ​​in real-time fluorescence quantitative PCR, the fluorescent signal generated during PCR thermal cycling must be combined with a reference dye to normalize the sample signal before data analysis. Reference dyes are fluorescent dyes that do not interact with components of the nucleic acid amplification reaction. They do not participate in DNA amplification and do not affect amplification efficiency, but they serve to normalize the dye's fluorescence signal, improving data accuracy and reproducibility between replicate reactions. Due to differences in excitation optics design between different instrument platforms, some instruments use high concentrations of reference dye for normalization, while others use low concentrations. Instruments using high-concentration reference dyes, such as the ABI Stepone, use a laser-based light source with an excitation wavelength of 480 nm. When using the ROX reference dye, which has a maximum absorbance at 580 nm, for signal normalization, a laser excitation wavelength of 480 nm cannot effectively excite it. To compensate for the low excitation efficiency of the ROX reference dye, very high concentrations of ROX reference dye must be used to collect sufficient signal for normalization. Instruments using low-concentration reference dyes, such as the ABI 7500, employ a broad-spectrum light source, which is then divided into four excitation wavelengths using filters for the corresponding channels. The collected emission signal is then normalized to the appropriate channel for detection and analysis using the calibration file corresponding to the ROX reference dye. This allows the ROX reference dye to be maximally excited in the "ROX" channel and generate sufficient signal for normalization, eliminating the need for a high concentration of ROX reference dye. This results in the need to prepare different concentrations of the reference dye ROX solution for different instruments, and these solutions need to be stored separately from the original reagent kit's mix, making them very inconvenient to use.

[0004] To solve this problem, Bio-Rad proposed the use of a class of fluorescent dyes in 2011. These long-Stokes-shift fluorescent dyes have an excitation wavelength of 470-560 nm and an emission wavelength of 590-620 nm. These fluorescent dyes need to be mixed with a low-concentration ROX reference dye. When used on an instrument with a low-concentration reference dye, the fluorescence signals generated by these dyes and the ROX reference dye are normalized to the ROX channel for detection and analysis using the calibration file corresponding to the ROX reference dye. When used on an instrument with a high-concentration reference dye, the dye is effectively excited, generating sufficient signal for normalization.

[0005] Currently, the most effective existing technology is the ROX mixed dye, but it has the objective problem of inconvenience in mixing the two reagents and the mixing ratio affecting the results. Therefore, it is necessary to develop new dyes that do not interact with the components of the nucleic acid amplification reaction, do not participate in DNA amplification, and do not affect the efficiency of the amplification reaction. In particular, they can directly replace ROX on instruments that require a reference dye without having to be mixed with other dyes. Summary of the Invention

[0006] In response to the above-mentioned technical problems, the present invention aims to provide a synthesis process and application method for a fluorescent quantitative PCR reference dye. The fluorescent quantitative PCR reference dye of the present invention is a long Stokes shift fluorescent dye with an excitation wavelength of 480° and a large Stokes shift. The dye of the present invention does not interact with components of the nucleic acid amplification reaction, does not participate in DNA amplification, and does not affect the efficiency of the amplification reaction. It can directly replace ROX in instruments requiring a reference dye, without the need for mixing with other dyes.

[0007] The present invention adopts the following technical solutions:

[0008] A fluorescent quantitative PCR reference dye, whose chemical structure is as follows:

[0009] ;

[0010] Among them, n is 1-20, preferably, n is 2-18, more preferably, n is 3-15, further preferably, n is 4-12, further preferably, n is 5-10, and most preferably, n is 6-8.

[0011] The dye of the present invention does not interact with components of nucleic acid amplification reactions, does not participate in DNA amplification, and does not affect the efficiency of amplification reactions. In particular, the dye can directly replace ROX on instruments that require a reference dye without being mixed with other dyes.

[0012] The invention discloses a preparation method of the fluorescent quantitative PCR reference dye. The fluorescent quantitative PCR reference dye is prepared by reaction using 5-carboxyfluorescein succinimidyl ester and intermediate II as raw materials.

[0013] In the above technical solution, the molar ratio of 5-carboxyfluorescein succinimidyl ester to intermediate II is 1: (0.8-1.2), preferably, the molar ratio is 1: (0.9-1.1), and the most preferred molar ratio is 1:1.

[0014] In the above technical solution, the reaction is carried out in the presence of an organic base; the organic base is an amine compound, such as an alkylamine compound.

[0015] In the above technical solution, the reaction time is 0.1 to 5 hours, preferably, the reaction time is 0.2 to 4 hours, further preferably, the reaction time is 0.3 to 3 hours, and most preferably, the reaction time is 0.4 to 2 hours, such as 0.5 to 1 hour.

[0016] In the above technical solution, the reaction temperature is -10°C to room temperature, preferably, the reaction temperature is -5 to 10°C, and more preferably, the reaction temperature is an ice bath.

[0017] In the present invention, intermediate I and an amine compound are used as raw materials to react and prepare intermediate II.

[0018] In the above technical solution, the molar ratio of intermediate I to the amine compound is 1:(0.8-1.2), preferably, the molar ratio is 1:(0.9-1.1), and the most preferred molar ratio is 1:0.9.

[0019] In the above technical solution, the reaction is carried out in the presence of an organic base; the organic base is an amine compound, such as an alkylamine compound.

[0020] In the above technical solution, the reaction time is 0.1 to 5 hours, preferably, the reaction time is 0.2 to 4 hours, further preferably, the reaction time is 0.3 to 3 hours, and most preferably, the reaction time is 0.4 to 2 hours, such as 0.5 to 1 hour.

[0021] In the above technical solution, the reaction temperature is -10°C to room temperature, preferably, the reaction temperature is -5 to 10°C, and more preferably, the reaction temperature is an ice bath.

[0022] In the present invention, raw material A and a succinimide compound are used as raw materials to react and prepare intermediate I. Preferably, the succinimide compound is N,N,N',N'-tetramethyl-O-(N-succinimide) uronium tetrafluoroborate.

[0023] In the above technical solution, the molar ratio of raw material A to succinimide compound is 1:(0.8-1.2), preferably, the molar ratio is 1:(1-1.1), and the most preferred molar ratio is 1:1.1.

[0024] In the above technical solution, the reaction is carried out in the presence of an organic base; the organic base is an amine compound, such as an alkylamine compound.

[0025] In the above technical solution, the reaction time is 0.1 to 5 hours, preferably, the reaction time is 0.2 to 4 hours, further preferably, the reaction time is 0.3 to 3 hours, and most preferably, the reaction time is 0.4 to 2 hours, such as 0.5 to 1 hour.

[0026] In the above technical solution, the reaction temperature is -10°C to room temperature, preferably, the reaction temperature is -5 to 10°C, and more preferably, the reaction temperature is an ice bath.

[0027] In the present invention, the chemical formula of the amine compound is H2N(CH2) n NH2; The chemical structures of raw material A, intermediate I, and intermediate II are as follows:

[0028]

[0029]

[0030]

[0031] The present invention aims to provide a synthesis process and application method for a fluorescent quantitative PCR reference dye. The fluorescent quantitative PCR reference dye of the present invention is a long Stokes shift fluorescent dye with an excitation wavelength of 480° and a large Stokes shift. The dye does not interact with components of the nucleic acid amplification reaction, does not participate in DNA amplification, and does not affect amplification reaction efficiency. It can directly replace ROX in instruments requiring a reference dye, without the need for mixing with other dyes. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the technical solution of the present invention in the prior art, some applications of the present invention will be briefly described below.

[0033] Figure 1 Schematic diagram of the dye reaction of the present invention.

[0034] Figure 2 This is the mass spectrum of the dye of the present invention.

[0035] Figure 3 The emission and excitation wavelength spectra of the dye of the present invention are shown in FIG.

[0036] Figure 4 The performance test results of Sybr Green Q-PCR mix mixed with reference dye on ABI 7500 are shown. Mix A contains Chromeo 494+ROX, and mix B contains the reference dye of the present invention.

[0037] Figure 5 The figure shows the performance test results of Sybr Green Q-PCR mix mixed with a reference dye on the ABI Stepone. Mix A contains Chromeo 494+ROX, and mix B contains the reference dye of the present invention.

[0038] Figure 6 The figure shows the performance test results of Sybr Green Q-PCR mix mixed with a reference dye on Roche LC96. Mix A contains Chromeo 494+ROX, and mix B contains the reference dye of the present invention. DETAILED DESCRIPTION

[0039] The present invention provides a synthesis process scheme and application method for a fluorescent quantitative PCR reference dye. The dye does not interact with components of the nucleic acid amplification reaction, does not participate in DNA amplification, and does not affect the efficiency of the amplification reaction. In particular, the dye can directly replace ROX on instruments requiring a reference dye without having to be mixed with other dyes.

[0040] The present invention first uses raw material A and a succinimide compound as raw materials to react and prepare intermediate I. Preferably, the succinimide compound is N,N,N',N'-tetramethyl-O-(N-succinimide) uronium tetrafluoroborate.

[0041] In the reaction, the molar ratio of raw material A and succinimide compound is 1: (0.8-1.2), preferably, the molar ratio is 1: (1-1.1), and the most preferred molar ratio is 1: 1.1; the reaction is carried out in the presence of an organic base, which is an amine compound, such as an alkylamine compound; the reaction time is 0.1-5 hours, preferably, the reaction time is 0.2-4 hours, further preferably, the reaction time is 0.3-3 hours, and most preferably, the reaction time is 0.4-2 hours, such as 0.5-1 hour; the reaction temperature is -10°C to room temperature, preferably, the reaction temperature is -5-10°C, and further preferably, the reaction temperature is an ice bath.

[0042] Secondly, intermediate I and amine compounds are used as raw materials to react and prepare intermediate II.

[0043] In the reaction, the molar ratio of intermediate I to the amine compound is 1:(0.8-1.2), preferably, the molar ratio is 1:(0.9-1.1), and the most preferred molar ratio is 1:0.9; the reaction is carried out in the presence of an organic base, which is an amine compound, such as an alkylamine compound; the reaction time is 0.1-5 hours, preferably, the reaction time is 0.2-4 hours, further preferably, the reaction time is 0.3-3 hours, and most preferably, the reaction time is 0.4-2 hours, such as 0.5-1 hour; the reaction temperature is -10°C to room temperature, preferably, the reaction temperature is -5-10°C, and further preferably, the reaction temperature is an ice bath.

[0044] Finally, the fluorescent quantitative PCR reference dye was prepared by reaction using 5-carboxyfluorescein succinimidyl ester and intermediate II as raw materials.

[0045] In the reaction, the molar ratio of 5-carboxyfluorescein succinimide ester to intermediate II is 1:(0.8-1.2), preferably, the molar ratio is 1:(0.9-1.1), and the most preferred molar ratio is 1:1; the reaction is carried out in the presence of an organic base, which is an amine compound, such as an alkylamine compound; the reaction time is 0.1-5 hours, preferably, the reaction time is 0.2-4 hours, further preferably, the reaction time is 0.3-3 hours, and most preferably, the reaction time is 0.4-2 hours, such as 0.5-1 hour; the reaction temperature is -10°C to room temperature, preferably, the reaction temperature is -5-10°C, and further preferably, the reaction temperature is an ice bath.

[0046] Specifically, the preparation method of the fluorescent quantitative PCR reference dye is as follows:

[0047] (1) Mix the starting material A and the solvent, then add DIPEA (N,N-diisopropylethylamine), stir, and then add tstu (N,N,N′,N′-tetramethyl-O-(N-succinimidyl) uronium tetrafluoroborate) to react to obtain intermediate I as a purple solid;

[0048] (2) The intermediate I is mixed with a solvent, TEA is added, and after stirring, an amine compound is added to obtain the intermediate II as a purple solid.

[0049] (3) The intermediate II was mixed with a solvent, and TEA was added. After stirring, 5-FAM SE (5-carboxyfluorescein succinimidyl ester) was added to obtain the final product, a purple solid.

[0050] The above reaction was carried out in an ice bath.

[0051] In the above reaction, the solvent is an organic solvent, such as DMF.

[0052] After each step of the reaction is completed, the corresponding product is obtained through conventional purification steps.

[0053] For example, after the reaction in step (1) is completed, the reaction solution is dried by rotary evaporation, and EA / ACN (preferably a volume ratio of 10 / 1) solvent is added and slurried for 1 to 5 hours, centrifuged, the supernatant is discarded, and the slurrying is repeated. The product is dried to obtain intermediate I as a purple solid.

[0054] For example, after the reaction in step (2) is completed, the reaction solution is dried by rotary evaporation, and the liquid phase is lyophilized to obtain intermediate II as a purple solid.

[0055] For example, after the reaction in step (3) is completed, the reaction solution is dried by spin drying, and the liquid phase is freeze-dried to obtain the final product, a purple solid.

[0056] The invention discloses the application of a fluorescent quantitative PCR reference dye as a fluorescent dye.

[0057] The invention discloses a fluorescent quantitative PCR system, comprising the fluorescent quantitative PCR reference dye.

[0058] The present invention discloses a fluorescence quantitative PCR detection method, which amplifies the fluorescence quantitative PCR system and then detects the Ct value to complete the fluorescence quantitative PCR detection.

[0059] The invention discloses application of the fluorescent quantitative PCR reference dye in fluorescent quantitative PCR.

[0060] The present invention discloses the application of the fluorescent quantitative PCR reference dye in replacing ROX and its mixed dye, in particular the application of the fluorescent quantitative PCR reference dye in replacing ROX and its mixed dye in fluorescent quantitative PCR detection.

[0061] The present invention will be further described in detail below in conjunction with specific examples, which are only used to illustrate the present invention. The raw materials involved in the present invention are all conventional commercially available raw materials, and the methods for preparing the buffer solution and the reagents are conventional techniques.

[0062] Example 1 Preparation of Fluorescence Quantitative PCR Reference Dye Figure 1 , the products are as follows:

[0063]

[0064] The specific preparation method is as follows:

[0065] To a 100 ml single-necked flask were added starting material A (5.9 g) and 50 ml of DMF solvent. After an ice bath for 15 minutes, 5 equivalents of DIPEA (N,N-diisopropylethylamine) were added. After stirring for 15 minutes, 1.1 equivalents of tstu (N,N,N′,N′-tetramethyl-O-(N-succinimidyl)uronium tetrafluoroborate, 3.3 g) were added. The reaction was completed in one hour. The reaction solution was spin-dried and 220 mL of a 10 / 1 EA / ACN (EA: ethyl acetate; ACN: acetonitrile) mixed solvent was added and slurried for two hours. The mixture was centrifuged, the supernatant was discarded, and the slurrying was repeated once. The product was vacuum-dried at room temperature overnight to constant weight to obtain 4.1 g of intermediate I as a purple solid in a yield of 59%.

[0066] The above intermediate I (0.69 g) was placed in a 100 ml single-necked flask and 25 ml of DMF was added. After ice-bathing for 15 minutes, 5 equivalents of TEA (triethylamine) were added. After stirring for 20 minutes, 0.9 equivalents of hexamethylenediamine (0.12 g) were added. The reaction was completed in half an hour. The reaction solution was spin-dried and lyophilized to obtain 0.35 g of intermediate II as a purple solid in a 51% yield.

[0067] The above intermediate II (0.35 g) was placed in a 100 ml single-necked flask and 10 ml of DMF was added. After ice-bathing for 15 minutes, 2 equivalents of TEA were added. After stirring for 20 minutes, an equivalent of 5-FAM SE (5-carboxyfluorescein succinimidyl ester, 0.24 g) was added. The reaction was completed in half an hour. The reaction solution was spin-dried and lyophilized to obtain the final product (fluorescence quantitative PCR reference dye) as a purple solid (0.36 g, yield 66%). Figure 2 is the mass spectrum of the product, C 62 H 57 N5O 11 Molecular weight 1047.40. Figure 3 The emission and excitation wavelength spectra of the above final product are shown below, with the excitation on the left and the emission on the right.

[0068] Example 2 Q-PCR test using the reference dye of the present invention

[0069] 1. Q-PCR amplification system:

[0070]

[0071] This is a conventional Sybr Green Q-PCR mix. DY-510XL + ROX (A) and the dye of the present invention (B) are prepared as mix A and mix B, respectively, according to the amplification system in the table above. Aside from the fluorescent dye, the formulations of the two mixes are identical. Aside from the dye of the present invention, all other reagents are commercially available. The ratio of DY-510XL to ROX is 5 (DY-510XL):1 (ROX). The forward primer is CACCCACACTGTGCCCATCTACGA, and the reverse primer is CAGCGGAACCGCTCATTGCCAATGG. The amount of DNA template added is typically less than 100 ng, and the amount of cDNA used as a template should not exceed 10% of the system.

[0072] 2. Q-PCR Reaction Conditions

[0073]

[0074] Briefly describe the test steps

[0075] Instruments and equipment: Fresco 17 high-speed refrigerated centrifuge, SPARK microplate reader, electrophoresis instrument, gene amplification instrument, LightCycler 96 fluorescence quantitative PCR instrument, 7500 real-time fluorescence quantitative PCR system, StepOnePlus real-time fluorescence quantitative PCR system (ABI), etc. are all conventional equipment.

[0076] Reagents: K562 human chronic myeloid leukemia cells (CL0130, Wuhan Punosai Life Science Technology Co., Ltd.), total RNA extraction kit (DP419, Tiangen Biotechnology Co., Ltd.), reverse transcription kit (R2020, Suzhou Youyi Landi Biotechnology Co., Ltd.); all reagents are domestically produced analytical grade and are conventional products.

[0077] K562 cell RNA was extracted according to the kit instructions and stored at -80°C. After obtaining total RNA, the extraction concentration of total RNA was detected using a SPARK microplate reader, and the integrity of total RNA fragments was detected using an electrophoresis device. The results showed that the quality of RNA extracted by the kit met the template quality requirements for the subsequent reverse transcription reaction. Then, cDNA reverse transcription was performed according to the reverse transcription kit instructions, with an RNA transcription amount of 1 μg / tube, and the synthesized cDNA was stored at -20°C.

[0078] When preparing the qPCR amplification system, the initial cDNA positive template concentration was controlled at 10-100 ng / ul. Before the reaction, the template was serially diluted 10-fold, 100-fold, 1000-fold, 10,000-fold, and 100,000-fold.

[0079] Take 1 mg of DY-510XL and add it to 0.1 mL of anhydrous DMSO, vortex to dissolve, add 3.5 mL of diH2O, vortex to mix, and prepare a stock solution; take 1 mg of ROX and add it to 0.6 mL of anhydrous DMSO, vortex to dissolve, add 67 mL of diH2O, vortex to mix, and prepare a stock solution.

[0080] Specific test results such as Figure 4 、 Figure 5 as well as Figure 6 shown.

[0081] According to the Q-PCR reaction amplification system, template cDNA / DNA, PCR Buffer, Sybr green, dNTP, Taq enzyme, fluorescent dye: (A) DY-510XL+ROX / (B) the present invention, primer-F, primer-R, and water were added for preparation.

[0082] Aliquot the prepared qPCR system into a 96-well plate. For each sample, add 18 μl per well, and finally add 2 μl of cDNA per well. Mark the wells in the gradient order and centrifuge at 2000 rpm for 2 minutes.

[0083] Turn on the qPCR instrument and set the reaction program according to the table above to perform real-time fluorescence quantitative PCR amplification reaction. After amplification, analyze the amplification curve and melting curve and other information.

[0084] Figure 4 The following table shows the performance test results of Sybr Green Q-PCR mix mixed with two reference dyes on ABI 7500. Mix A (blue) contains DY-510XL+ROX, and mix B (red) contains the reference dye of the present invention.

[0085] Figure 5 The following table shows the performance test results of Sybr Green Q-PCR mix mixed with two reference dyes on the ABI Stepone. Mix A (purple) contains DY-510XL+ROX, and mix B (green) contains the reference dye of the present invention.

[0086] Figure 6 The figures show the performance test results of Sybr Green Q-PCR mix mixed with a reference dye on a Roche LC 96. Mix A (red) contains DY-510XL+ROX, and mix B (blue) contains the reference dye of the present invention.

[0087] The test results show that the technical performance of the fluorescent dye produced by the present invention is comparable to, or even slightly superior to, DY-510XL+ROX, considered the best in the prior art. Furthermore, neither DY-510XL nor ROX is suitable for single use. This demonstrates that the present invention has synthesized a new dye compound that, when used in real-time fluorescence quantitative PCR, achieves technical performance comparable to or even superior to that of dyes considered superior in the prior art. In particular, the present invention overcomes the prior art bias that only mixed dyes can achieve universally applicable technical results. By employing a single dye, the present invention achieves excellent results in multiple test scenarios, demonstrating superior results across all test scenarios.

Claims

1. A fluorescent quantitative PCR reference dye, whose chemical structure is as follows: ； in, n is 1 to 20.

2. The method for preparing the fluorescent quantitative PCR reference dye according to claim 1, characterized in that: The fluorescent quantitative PCR reference dye was prepared by reaction using 5-carboxyfluorescein succinimidyl ester and intermediate II as raw materials; the intermediate II is as follows: 。 3. The method for preparing a fluorescent quantitative PCR reference dye according to claim 2, wherein: Intermediate I and amine compounds are used as raw materials to react and prepare intermediate II; the chemical formula of the amine compound is H2N(CH2) n NH2; the intermediate I is as follows: 。 4. The method for preparing a fluorescent quantitative PCR reference dye according to claim 3, wherein: Using raw material A and succinimide compound as raw materials, intermediate I is prepared by reaction; the raw material A is as follows: 。 5. The method for preparing the fluorescent quantitative PCR reference dye according to claim 2, claim 3 or claim 4, characterized in that: The reaction time is 0.1 to 5 hours; the reaction temperature is -10°C to room temperature.

6. Use of the fluorescent quantitative PCR reference dye according to claim 1 as a fluorescent dye.

7. A fluorescent quantitative PCR system, characterized in that: The invention comprises the fluorescent quantitative PCR reference dye according to claim 1.

8. A fluorescent quantitative PCR detection method, characterized in that: Amplify the fluorescent quantitative PCR system according to claim 7, and then detect the Ct value to complete the fluorescent quantitative PCR detection.

9. Use of the fluorescent quantitative PCR reference dye according to claim 1 in fluorescent quantitative PCR.

10. Use of the fluorescent quantitative PCR reference dye according to claim 1 in replacing ROX and its mixed dye.

Images