Convergent liquid phase synthesis of oligonucleotides

Abstract

The present disclosure describes a converged liquid phase method of making oligonucleotides by coupling two or more oligonucleotide fragments, each oligonucleotide fragment having two or more nucleotides. The invention further provides reaction steps involved in the liquid phase converging method.

Description

[0001] This application is a divisional application based on a patent application filed on May 8, 2020, with application number 202080044020.2 (PCT / US2020 / 032070), and invention name: "Convergent liquid phase synthesis of oligonucleotides".

[0002] Related applications

[0003] This application claims the benefit under 35 U.S.C. §119(e) of the filing date of U.S. Provisional Application No. 62 / 856,160, filed May 8, 2019, the entire contents of which are incorporated herein by reference. Background Art

[0004] Oligonucleotides are short DNA or RNA oligomers that can be chemically synthesized for use in a wide range of applications. Recent developments in the use of synthetic oligonucleotides as therapeutic agents have increased the demand for synthetic methods that can produce large quantities of oligonucleotides with high efficiency and purity.

[0005] Traditionally, oligonucleotides are synthesized using phosphoramidite chemistry using solid phase automated synthesizers, which are limited to a scale of less than 2 moles. Therefore, solid phase synthesis is insufficient to produce the materials required for clinical development and commercialization of oligonucleotide drugs for a large number of indications. In addition, solid phase synthesis typically requires the use of excess reagents, and therefore increases the cost associated with producing target oligonucleotides.

[0006] Therefore, there is a need for a robust method to synthesize oligonucleotides that is suitable for large-scale manufacturing processes with high efficiency and purity. Summary of the Invention

[0007] The present disclosure describes a kind of convergent liquid phase method of manufacturing oligonucleotide by coupling two or more (for example, three, four, five, six etc.) oligonucleotide fragments, each oligonucleotide fragment has two or more (for example, three, four, five, six etc.) nucleotides.It is surprising to find that the convergent liquid phase method of the present disclosure can be used for synthesizing highly purified protected oligonucleotides without the need for purification by chromatography (for example column chromatography), which makes the method suitable for large-scale manufacturing process.After deprotection and standard downstream purification, high-purity ASO oligonucleotides suitable for therapeutic use can be obtained.The present disclosure also provides the reactions steps related to the convergent liquid phase method. BRIEF DESCRIPTION OF THE DRAWINGS

[0008] Figure 1 Reverse phase HPLC and MS of compound 1-7-a obtained after aminolysis of the product compound 1-7 are shown.

[0009] Figure 2HPLC and MS of the product compound 2-9 obtained after precipitation are shown.

[0010] Figure 3 HPLC and MS of the product compound 3-5 obtained after precipitation are shown.

[0011] Figure 4 HPLC and MS of the product compound 4-9 obtained after precipitation are shown.

[0012] Figure 5 The HPLC and MS of compound 5-2-a obtained after aminolysis of the product compound 5-2 are shown.

[0013] Figure 6 HPLC and MS of compound 5-3-a obtained after aminolysis of the product compound 5-3 are shown.

[0014] Figure 7 HPLC and MS of compound 5-5-a obtained after aminolysis of the product compound 5-5 are shown.

[0015] Figure 8 HPLC and MS of compound 5-6-a obtained after aminolysis of the product compound 5-6 are shown.

[0016] Figure 9 HPLC and MS of compound 1-a obtained after aminolysis of product compound 1 are shown.

[0017] Figure 10 Shown is an HPLC comparison of the deaminated products obtained during the detritylation reaction of the UCC trimer.

[0018] Figure 11 Shown is an HPLC comparison of the deaminated products obtained during the detritylation reaction of the CC dimer.

[0019] Figure 12 HPLC-MS of the product ASO 9 is shown.

[0020] Figure 13 The MS of the 6-mer DMT-dG-dT-dT-dG-dT-dT-OTBDPS is shown.

[0021] Figure 14 MS of 10-mer DMT-Moe G-Moe U-Moe U-Moe U-Moe U-dT-dT-dG-dT-dT-OTBDPS is shown.

[0022] Figure 15 MS of compounds 1-3A-H are shown.

[0023] Figure 16MS of compounds 4-3A-H are shown.

[0024] Figure 17 MS of compounds 5-3A-H are shown.

[0025] Figure 18 HPLC and MS of the 15-mer 5'-ACoAGATATTTTTGTT-3'-OTBDPS are shown.

[0026] Figure 19 HPLC and MS of the product ASO 8 are shown.

[0027] Figure 20 The MS of 5'-DMT-GUUUUUGCAA-NO2-benzoyl is shown.

[0028] Figure 21 HPLC and MS of LHPG-deprotected compound 7-a are shown.

[0029] Figure 22 HPLC and MS of LHPG-deprotected compound 7-b are shown.

[0030] Figure 23 HPLC and MS of LHPG-deprotected compound 7-c are shown.

[0031] Figure 24 HPLC and MS of LHPG-deprotected 7-d compound are shown.

[0032] Figure 25 HPLC and MS of ASO-9-1 are shown.

[0033] Figure 26 HPLC and MS of LHPG-deprotected 7-e compound are shown.

[0034] Figure 27 HPLC and MS of ASO-9-2 are shown.

[0035] Figure 28 Chiral SFC-MS of compound 8.4 is shown.

[0036] Figure 29 Shown is SFC-MS of the racemic mixture of compound 8.4.

[0037] Figure 30 HPLC and MS of compound 8A are shown.

[0038] Figure 31 HPLC and MS of compound 8.2.12 are shown.

[0039] Figure 32HPLC and MS of compound 8B are shown.

[0040] Figure 33 HPLC and MS of compound 8C are shown. DETAILED DESCRIPTION

[0041] The inventor of the present disclosure has developed a kind of convergent liquid phase method for the preparation of target oligonucleotide for the first time.Surprisingly, the convergent liquid phase method can be mass-produced highly purified protected target oligonucleotide, without the need for chromatographic purification from the assembling of oligonucleotide fragments.The convergent liquid phase method can produce target oligonucleotide by extension from 3'-end to 5'-end (i.e. 3'-5' extension) or from 5'-end to 3'-end (i.e. 5'-3' extension) direction.The disclosure also provides the selective deprotection method of 3'-hydroxy protecting group, which does not affect other sensitive groups, so that the generation of by product is minimum.The inventor of the present disclosure has found that the presence of water in the detritylation reaction can cause deamination side reaction (for example, the deamination of cytosine or 5-methylcytosine or its derivatives commonly used in oligonucleotide synthesis).In order to reduce or prevent the formation of deamination by-product, the reaction conditions of control and minimization of water level have been developed to minimize the deamination during the detritylation step. In addition, it has also been found that in the detritylation reaction, cation scavengers (e.g., RSH) are used to promote the completion of the detritylation reaction (i.e., the reaction is more easily completed). The presence of cation scavengers also makes the reaction less prone to reverse detritylation (i.e., the DMT protecting group is added back on the deprotected 5'-OH group). It has also been shown that the phosphitylation of 3'-hydroxyl can be carried out in liquid phase without the need for purification by chromatography. The disclosed method has been used to successfully synthesize oligonucleotide fragments with four or five nucleotides and coupled with fully protected target oligonucleotides in liquid phase. Typically, the liquid phase method described in the disclosure can be used for synthesizing a large amount of required protected nucleotides or oligonucleotide products without the need for chromatographic purification. After deprotection and standard downstream purification, high-purity ASO oligonucleotides suitable for therapeutic use are obtained.

[0042] definition

[0043] The term "nucleobase" refers to the heterocyclic base portion of a nucleoside. A nucleobase may be naturally occurring or modified. In certain embodiments, a nucleobase may include any atom or group of atoms capable of hydrogen bonding to a nucleobase of another nucleic acid. Specifically, a nucleobase is a heterocyclic base, typically a purine and a pyrimidine. In addition to "unmodified" or "natural" nucleobases, such as the purine nucleobases adenine (A) and guanine (G), and the pyrimidine nucleobases thymine (T), cytosine (C) and uracil (U), many modified nucleobases or nucleobase mimetics known to those skilled in the art are also easily incorporated into compounds synthesized by the methods described herein. In certain embodiments, the nucleobase of modification is a nucleobase that is structurally similar to the parent nucleobase, such as 7-deazapurine, 5-methylcytosine or G-clamps. In certain embodiments, nucleobase mimetics include more complex structures, such as tricyclic phenoxazine nucleobase mimetics. Methods for preparing the above-mentioned modified nucleobases are well known to those skilled in the art.

[0044] The term "nucleoside" refers to a compound comprising a heterocyclic base moiety and a sugar moiety, which may be modified at the 2'-terminus.

[0045] The term "nucleotide" refers to a nucleoside containing a phosphate or phosphorothioate or phosphorodithioate linkage group.

[0046] The term "oligonucleotide" refers to a compound comprising a plurality of linked nucleosides. In certain embodiments, one or more of the plurality of nucleosides are modified. In certain embodiments, the oligonucleotide comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA).

[0047] As used herein, "target oligonucleotide" refers to an oligonucleotide product that can be prepared by the convergent liquid phase method of the present disclosure. In certain embodiments, the target oligonucleotide comprises at least 10 or at least 15 nucleotides. In certain embodiments, the target oligonucleotide has 10 to 500, 15 to 500, 15 to 200, 15 to 100, 15 to 50, 15 to 40, 15 to 30, or 16 to 30 nucleotides.

[0048] As used herein, "convergent synthesis" refers to a synthetic process for preparing a target oligonucleotide in which two or more oligonucleotide fragments are assembled from the 5'-3' direction or the 3'-5' direction.

[0049] As used herein, "oligonucleotide fragments" refer to short oligonucleotides that are assembled to make a target oligonucleotide. In certain embodiments, the oligonucleotide fragments have 3 to 10, 3 to 8, 3 to 6, or 4 to 6 nucleotides. In certain embodiments, the oligonucleotide fragments have 4 or 5 nucleotides.

[0050] The term "internucleoside linkage" means a covalent linkage between adjacent nucleosides of an oligonucleotide.

[0051] The term "gapmer" refers to a chimeric antisense compound in which an interior region having multiple nucleosides that support RNase H cleavage is positioned between exterior regions having one or more nucleosides, wherein the nucleosides comprising the interior region are chemically distinct from the nucleosides comprising the exterior regions.

[0052] As used herein, the term "alkyl" refers to a fully saturated branched or unbranched hydrocarbon moiety. Preferably, the alkyl group contains 1 to 20 carbon atoms, more preferably 1 to 16 carbon atoms, 1 to 10 carbon atoms, 1 to 6 carbon atoms, or 1 to 4 carbon atoms. In some embodiments, the alkyl group contains 6 to 20 carbon atoms. Representative examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, 3-methylhexyl, 2,2-dimethylpentyl, 2,3-dimethylpentyl, n-heptyl, n-octyl, n-nonyl, or n-decyl.

[0053] The term "aryl" refers to a monocyclic, bicyclic, or tricyclic aromatic hydrocarbon group having 6 to 14 carbon atoms in the ring portion. In one embodiment, the term aryl refers to a monocyclic and bicyclic aromatic hydrocarbon group having 6 to 10 carbon atoms. Representative examples of aryl include phenyl, naphthyl, fluorenyl, and anthracenyl.

[0054] The term "aryl" also refers to a bicyclic or tricyclic group in which at least one ring is aromatic and is fused to one or two non-aromatic hydrocarbon rings. Non-limiting examples include tetrahydronaphthalene, dihydronaphthyl, and indanyl.

[0055] The optional substituents of the alkyl or aryl groups are independently selected at each occurrence from C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, 3- to 7-membered carbocyclyl, 3- to 7-membered heterocyclyl, halo, -CN, -C(O)R a 、-C(O)2R a 、-C(O)N(R a )2、-OR a 、-N(R a )2、-N(R a )C(O)R a 、-N(R a )N(R a )2、-NO2、-N(R a )C(O)2R a 、-N(R a )C(O)N(R a )2、-N(R a)S(O)2R a 、-SR a 、-S(O)R a 、-S(O)2R a 、-S(O)N(R a )2 and -S(O)2N(R a )2; and

[0056] R a independently selected at each occurrence from H, C 1-6 alkyl, 3- to 6-membered monocyclic carbocyclic group, and 3- to 6-membered monocyclic heterocyclic group.

[0057] As used herein, the term "cycloalkyl" refers to a saturated or unsaturated monocyclic or bicyclic hydrocarbon radical of 3-7 carbon atoms, 3-6 or 5-7 carbon atoms. The term "carbocyclyl" includes cycloalkyl and aromatic groups. The term "cycloalkyl" refers to a fully saturated monocyclic or bicyclic hydrocarbon radical of 3-7 carbon atoms, 3-6 carbon atoms or 5-7 carbon atoms. Exemplary monocyclic carbocyclic groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclobutadienyl, cyclopentadienyl, cyclohexadienyl, cycloheptadienyl, phenyl and cycloheptatrienyl. Exemplary bicyclic carbocyclic groups include bicyclo[2.1.1]hexyl, bicyclo[2.2.1]heptyl, bicyclo[2.2.1]heptenyl, tricyclo[2.2.1.0 2,6 ]heptyl, 6,6-dimethylbicyclo[3.1.1]heptyl or 2,6,6-trimethylbicyclo[3.1.1]heptyl, spiro[2.2]pentyl and spiro[3.3]heptyl.

[0058] As used herein, the term "bridged ring system" is a ring system having a carbocyclyl or heterocyclyl ring in which two non-adjacent atoms of the ring are linked (bridged) by one or more (preferably one to three) atoms selected from C, N, O or S. A bridged ring system may have 6-7 ring members.

[0059] As used herein, the term "spiro ring system" is a ring system having two rings, each ring independently selected from carbocyclyl or heterocyclyl, wherein the two ring structures have one common ring atom. The spiro ring system has 5 to 7 ring members.

[0060] As used herein, the term "heterocyclyl" refers to a saturated or unsaturated monocyclic or bicyclic (e.g., bridged or spiro) ring system having 3 to 7 ring members, or in particular 3 to 6 ring members or 5 to 7 ring members, wherein at least one ring member is a heteroatom and up to 4 (e.g., 1, 2, 3, or 4) ring members may be heteroatoms, wherein the heteroatoms are independently selected from O, S, and N, and wherein C may be oxidized (e.g., C(O)), N may be oxidized (e.g., N(O)) or quaternized, and S may be optionally oxidized to sulfoxides and sulfones. Unsaturated heterocycles include heteroaromatic rings. As used herein, the term "heteroaryl" refers to an aromatic 5- or 6-membered monocyclic ring system having 1 to 4 heteroatoms independently selected from O, S, and N, and wherein N may be oxidized (e.g., N(O)) or quaternized, and S may be optionally oxidized to sulfoxides and sulfones. In one embodiment, the heterocyclyl group is a 3- to 7-membered saturated monocyclic ring, a 3- to 6-membered saturated monocyclic ring, or a 5- to 7-membered saturated monocyclic ring. In one embodiment, the heterocyclyl group is a 3- to 7-membered monocyclic ring, a 3- to 6-membered monocyclic ring, or a 5- to 7-membered monocyclic ring. In another embodiment, the heterocyclyl group is a 6- or 7-membered bicyclic ring. The heterocyclyl group may be attached at a heteroatom or a carbon atom. Examples of heterocyclic groups include aziridine, oxirane, thiirane, oxaziridine, dioxirane, azetidinyl, oxetanyl, thietanyl, pyrrolidinyl, tetrahydrofuranyl, thiolanyl, imidazolidinyl, pyrazolidinyl, oxazolidinyl, isoxazolidinyl, thiazolidinyl, isothiazolidinyl, dioxolanyl, dithiolanyl, thiolanyl, piperidinyl, tetrahydropyranyl, thianyl, piperazinyl, morpholinyl, thiomorpholinyl, dioxanyl, dithianyl, trioxanyl, trithianyl, azepanyl, oxetanyl, thiepanyl, dihydrofuranyl, imidazolinyl, dihydropyranyl, and heteroaryl rings including aziridine. thiazole, dithiophene, dithiocyanate ... Examples of bicyclic heterocyclic ring systems include 3-azabicyclo[3.1.0]hexyl, 3-azabicyclo[3.1.1]heptyl, 2-azaspiro[3.3]heptyl, 2-oxa-6-azaspiro[3.3]heptyl, and 5-azaspiro[2.3]hexyl.

[0061] "Halogen" or "halo" may be fluorine, chlorine, bromine or iodine.

[0062] As used herein, the term "substantially anhydrous" refers to a water content of about 1000 parts per million (ppm) or less, preferably 500 ppm or less, and more preferably 100 ppm or less. The water content is between 500-1000 ppm, between 100-500 ppm, between 50-100 ppm, or less than 50 ppm. An organic solution or solvent can be rendered substantially anhydrous by using a desiccant or by azeotropic removal of water (azeotropic distillation).

[0063] As used herein, the term "desiccant" refers to a chemical agent used to remove water from an organic solvent or an organic compound or a solution of an organic compound. Any suitable desiccant may be used. Exemplary desiccant agents include, but are not limited to, calcium chloride, potassium chloride, sodium sulfate, calcium sulfate, magnesium sulfate, or molecular sieves. In some embodiments, the molecular sieve is or

[0064] As used herein, "hydroxy protecting group" refers to a group suitable for protecting the hydroxyl -OH group from reaction with other reagents. Examples of hydroxy protecting groups can be found in Greene, TW et al., Protective Groups in Organic Synthesis, 4th edition, John Wiley and Sons (2007).

[0065] In certain embodiments, the hydroxy protecting group can be selected from, for example, acetyl (Ac); benzoyl (Bz); benzyl (Bn); β-methoxyethoxymethyl ether (MEM); methoxymethyl ether (MOM); methoxytrityl [(4-methoxyphenyl)diphenylmethyl, MMT); p-methoxybenzyl ether (PMB); methylthiomethyl ether; pivaloyl (Piv); tetrahydropyranyl (THP); tetrahydrofuran (THF); silyl ethers (including but not limited to trimethylsilyl (TMS), tert-butyldiphenylsilyl (TBDPS), tert-butyldimethylsilyl (TBDMS), triisopropylsiloxymethyl (TOM) and triisopropylsilyl (TIPS) ether); methyl ether and ethoxyethyl ether (EE).

[0066] In certain embodiments, the 3'-hydroxy protecting group of hydroxy protecting nucleosides is protected (being called 3'-hydroxy protecting group).In certain embodiments, 3'-hydroxy protecting group comprises silyl hydroxy protecting group, such as trimethylsilyl, triethylsilyl, triisopropylsilyl, dimethyl isopropyl silyl, diethyl isopropyl silyl, dimethyl tert-hexyl silyl (dimethylthexylsilyl), tert-butyldimethylsilyl, tert-butyldiphenylsilyl, tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl, di-tert-butylmethylsilyl, three (trimethylsilyl) silyl, tert-butylmethoxyphenylsilyl and tert-butoxydiphenylsilyl.In certain embodiments, 3'-hydroxy protecting group is TBDPS.In certain embodiments, 3'-hydroxy protecting group is large hydrophobic protecting group (LHPG), such as those described herein.

[0067] In certain embodiments, a hydroxy protecting group protects the 5'-hydroxyl group of a nucleoside (referred to as a 5'-hydroxy protecting group). Exemplary 5'-hydroxyl groups include, but are not limited to, those described herein (e.g., R in any aspect or embodiment). 15 In one embodiment, the 5'-hydroxy protecting group is an acid-labile 4,4'-dimethoxytrityl (or bis-(4-methoxyphenyl)phenylmethyl) (DMT or DMTr) protecting group. In certain embodiments, the 5'-hydroxy protecting group is a large hydrophobic protecting group (LHPG), such as those described herein.

[0068] As used herein, the term "azeotropic distillation" refers to the removal of water from an organic solution or solvent by distillation using a material separating agent. Material separating agents include, but are not limited to, benzene and toluene.

[0069] As used herein, "selective precipitation" refers to a purification method in which a desired product is separated from one or more impurities in a solution by adding a solution to a solvent that precipitates the product while leaving one or more impurities in the solution. Alternatively, a solvent can be added to a solution comprising a crude product and one or more impurities to precipitate the product. In certain embodiments, the desired compound or oligonucleotide of the present disclosure comprises a hydrophobic group (e.g., a hydrophobic 3'-hydroxyl protecting group or a hydrophobic 5'-hydroxyl protecting group (e.g., an LHPG group as described herein)) and a polar solvent (e.g., CH3CN), which is added to a solution containing the compound or oligonucleotide and one or more impurities to precipitate the desired oligonucleotide. In certain embodiments, the desired compounds or oligonucleotides of the present disclosure can be purified by adding a cosolvent or solvent mixture (e.g., heptane, tert-butyl methyl ether (TBME or MBTE), a heptane / MBTE mixture (e.g., a heptane to MBTE volume ratio ranging from 20:1 to 1:20, 9:1 to 1:9, or 4:1 to 1:4, or a heptane to MBTE volume ratio of 9:1, 4:1, 2:1, 1:1, 2:5, 1:2, 1:4, or 1:9) to a solution comprising the crude product and one or more impurities in an organic solvent (e.g., dichloromethane (DCM) or ethyl acetate (EtOAc)) to precipitate the product. Alternatively, the solution comprising the crude product and one or more impurities can be added to a non-polar or less polar solvent or solvent mixture to precipitate the product. The appropriate cosolvent can be determined based on the hydrophobicity of the product. In certain embodiments, the cosolvent has a lower polarity than the organic solvent in which the product is dissolved.

[0070] As used herein, "extraction" refers to a purification method in which the desired product is separated from one or more impurities in a solution by contacting the solution with a solvent in which the product is soluble; and the one or more impurities are insoluble. Alternatively, a solution containing the product and one or more impurities can be contacted with a solvent in which the one or more impurities are soluble; and the product is insoluble. In certain embodiments, a solution containing the product and one or more impurities (e.g., a reaction mixture or a solution of crude product) in an organic solvent (e.g., DCM, EtOAc, or THF) or a mixture of organic solvents can be contacted (extracted or washed) with water or an aqueous solution (e.g., NaHCO3 / H2O solution or NaCl / H2O solution) to remove hydrophilic impurities.

[0071] As used herein, the term "strong acid" refers to an acid that completely dissociates in solution, as shown below:

[0072]

[0073] S represents a solvent molecule. Exemplary strong acids include, but are not limited to, HCl, HBr, HI, trifluoromethanesulfonic acid, perchloric acid, CCl3COOH, CHCl2COOH, and CH2ClCOOH. In certain embodiments, the strong acid is a strong organic acid, such as CF3COOH, CHCl2COOH, and CH2ClCOOH.

[0074] As used herein, the term "base" refers to a base that can generate hydroxide ions (OH - ) or a substance that can donate a pair of non-bonding electrons. Exemplary bases include, but are not limited to, alkali metal hydroxides, alkaline earth metal hydroxides, alkylamines (e.g., tert-butylamine, sec-butylamine, trimethylamine, triethylamine, diisopropylethylamine, 2-methylpropan-2-amine), 8-diazabicyclo[5.4.0]undec-7-ene (DBU), imidazole, N-methylimidazole, pyridine, and 3-methylpyridine.

[0075] As used herein, the term "salt" refers to an organic or inorganic salt of a compound, nucleotide, or oligonucleotide as described herein. In certain embodiments, the salt is a pharmaceutically acceptable salt thereof. The phrase "pharmaceutically acceptable" indicates that the substance or composition must be chemically and / or toxicologically compatible with the other ingredients of the formulation and / or the mammal to be treated therewith. In certain embodiments, the salt of a compound, nucleotide, or oligonucleotide as described herein is a sodium salt, a potassium salt, or an ammonium salt. In certain embodiments, the salt is a sodium salt or an ammonium salt.

[0076] Methods of the present disclosure

[0077] I. Fragment synthesis:

[0078] Methods described herein include progressively adding nucleotides in a liquid (solution) phase to form desired oligonucleotide fragments. In certain embodiments, each nucleotide addition involves at least three reactions (coupling, sulfurization or oxidation and deprotection) to add nucleotides to the growing oligonucleotide. First, the 5' end of the first nucleoside is coupled to the 3' end of the second nucleotide to form a dimer. The dimer is then sulfurized or oxidized to form a thiophosphate (i.e., P=S bond) or a phosphodiester (i.e., P=O bond). The 5'-hydroxyl of the second nucleotide is then deprotected, and the process is repeated to add the next nucleoside.

[0079] a.5'-deprotection reaction:

[0080] In the first aspect, the present disclosure provides a kind of deprotection method of removing the 5'-hydroxy protecting group on nucleotide, nucleoside or oligonucleotide.In one embodiment, the deprotection method is the detritylation method for removing 5'-trityl.Find that when detritylation reaction is carried out under anhydrous or substantially anhydrous conditions, can significantly reduce side reaction (for example, be usually used in the deamination of the nuclear base cytosine or 5-methylcytosine or its derivatives of oligonucleotide synthesis) (referring to embodiment 3).Detritylation method of the present invention also comprises adding cation scavenger to promote the completion of reaction.Therefore, can obtain highly purified product without chromatography (for example column chromatography).The water content of detritylation reaction can be controlled by using desiccant (for example molecular sieve), component distillation or other suitable methods known in the art.Or, the solvent, acid and other reagents used in detritylation reaction, the substrate and reaction vessel to be carried out detritylation reaction can be dried to meet residual water content before being used for detritylation reaction.

[0081] The first embodiment of the first aspect is a method for preparing a a ) compound or its salt liquid phase method:

[0082]

[0083] It comprises the following steps: a ) compound or its salt deprotection:

[0084]

[0085] wherein the deprotection reaction is carried out in an anhydrous or substantially anhydrous solution, and wherein:

[0086] R 1 is independently at each occurrence a nucleobase, wherein the NH2 of the nucleobase (if present) is protected by an amine protecting group;

[0087] R 2 In each occurrence, independently selected from the group consisting of H, halo, and optionally C 1-6 Alkoxy-substituted C 1-6 a group consisting of alkoxy groups;

[0088] R 4 Each occurrence is independently H or R 2 The alkoxy groups form a ring;

[0089] R 15 is a hydroxyl protecting group;

[0090] R 16 Each occurrence is independently C 1-6 Alkyl, C 2-6alkenyl, phenyl or benzyl, each of which is optionally substituted with -CN, -NO2 or halogen; or

[0091] R 16 for

[0092] z is 0 or an integer from 1 to 200;

[0093] X is independently O or S at each occurrence;

[0094] W is H, Y or Z;

[0095] Y is a hydrophobic hydroxyl protecting group containing an alkyl chain; and

[0096] Z is a hydroxyl protecting group.

[0097] A first embodiment of the first aspect also includes a liquid phase process for preparing a compound of formula (AI) or a salt thereof:

[0098]

[0099] It comprises deprotecting compound (AII) or a salt thereof:

[0100]

[0101] wherein the deprotection reaction is carried out in an anhydrous or substantially anhydrous solution, and wherein the variables are as described above for formula (AI a ) and (AII a ) defined.

[0102] The first embodiment also includes a liquid phase process for preparing a compound of formula (AI') or a salt thereof:

[0103]

[0104] It comprises the following steps: ’ ) compound or its salt deprotection:

[0105]

[0106] wherein the deprotection reaction is carried out in an anhydrous or substantially anhydrous solution, and wherein W is H or Z; Z is a silyl hydroxy protecting group; and the remaining variables are as described above for formula (AI a ) and (AII a ) defined.

[0107] In a particular embodiment, R 16 One of the following:

[0108]

[0109] See Nat Biotechnol. 2017 Sep; 35(9): 845-851; J. Org. Chem. 1999, 64, 7515-7522; Biopolymers (Peptide Science), 2001, 60, 3, each of which is incorporated herein by reference.

[0110] In a second embodiment, the deprotection reaction is carried out in the presence of a desiccant. Any suitable desiccant can be used in the deprotection reaction. In some embodiments, the desiccant is selected from calcium chloride, potassium chloride, sodium sulfate, calcium sulfate, magnesium sulfate, and molecular sieves.

[0111] In a third embodiment, the desiccant used in the second embodiment is a molecular sieve.

[0112] In a fourth embodiment, the size of the molecular sieve of the third embodiment is or In a preferred embodiment, the size of the molecular sieve is

[0113] In a fifth embodiment, an anhydrous or substantially anhydrous solution for the deprotection reaction is obtained by removing water using azeotropic distillation prior to the deprotection reaction.

[0114] Alternatively, the solvent, acid or acid solution and other reagents or solutions comprising reagents to be used in the detritylation reaction, the substrate or substrate solution to be detritylated and the reaction vessel may be dried individually or in combination prior to the detritylation reaction.

[0115] In a sixth embodiment, the deprotection reaction is carried out in the presence of a scavenger selected from the group consisting of: a cation scavenger containing a -SH group, a silane scavenger (eg, HSiPh3, HSiBu3, triisopropylsilane, etc.), siloxane, polystyrene, furan, pyrrole, and indole.

[0116] In a particular embodiment, the deprotection reaction is carried out in the presence of a scavenger selected from the group consisting of 1-dodecanethiol, cyclohexanethiol, 1-octanethiol, triisopropylsilane, indole, 2,3-dimethylfuran, diphenylsilane, 2-mercaptoimidazole, diphenylmethylsilane, phenylsilane, 5-methoxyindole, methylphenylsilane, chlorodimethylsilane, 1,1,3,3-tetramethyldisiloxane, 1-thioglycerol, triphenylsilane, tert-butyldimethylsilane, butylsilane, methyldiethoxysilane, 1,1,3,3,5,5-hexamethyltrisiloxane, hexylsilane, (mercaptomethyl)polystyrene, or dimethylphenylsilane.

[0117] In a seventh embodiment, the cation scavenger of the sixth embodiment is a compound of the formula RSH, wherein R is alkyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, each of which is optionally substituted.

[0118] In an eighth embodiment, the RSH group of the seventh embodiment is CH3(CH2)5SH, CH3(CH2) 11 SH, cyclohexanethiol (CySH) or CH3CH2OC(=O)CH2CH2SH.

[0119] A ninth embodiment of the present disclosure is a method as described in any one of the first to eighth embodiments, wherein R 15 is a 4,4'-dimethoxytrityl (DMT) group.

[0120] In a tenth embodiment, the deprotection reaction is carried out by reacting the compound of formula (AII) with a detritylating agent. Any suitable detritylating agent may be used.

[0121] In an eleventh embodiment, the detritylation agent of the tenth embodiment is a strong organic acid.

[0122] In the twelfth embodiment, the detritylation agent is selected from CF COOH, CCl COOH, CHCl COOH, CH ClCOOH, H PO , methanesulfonic acid (MSA), benzenesulfonic acid (BSA), CClF COOH, CHF COOH, PhSO H (phenylsulfinic acid) etc. In a preferred embodiment, the detritylation agent is CH ClCOOH. In another specific embodiment, the detritylation agent is CF COOH. In another specific embodiment, the detritylation agent is CHCl COOH.

[0123] In certain embodiments, the detritylating agent is citric acid. In certain embodiments, the detritylating agent is a saturated citric acid solution.

[0124] A thirteenth embodiment of the first aspect is a method as described in any one of the above disclosed embodiments, wherein W is Z.

[0125] In a fourteenth embodiment, the Z group is a silylhydroxy protecting group. Exemplary silyl protecting groups include, but are not limited to, trimethylsilyl, triethylsilyl, triisopropylsilyl, dimethylisopropylsilyl, diethylisopropylsilyl, dimethyl-tert-hexylsilyl, tert-butyldimethylsilyl, tert-butyldiphenylsilyl, tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl, di-tert-butylmethylsilyl, tris(trimethylsilyl)silyl, tert-butylmethoxyphenylsilyl, and tert-butoxydiphenylsilyl.

[0126] In a fifteenth embodiment, the silylhydroxy protecting group of the fourteenth embodiment is selected from the group consisting of TBDPS, TBoDPS, and TBDAS.

[0127]

[0128] wherein R5, R6 and R7 are each independently H, C 1-30 Alkyl or C 1-30 Alkoxy.

[0129] In a sixteenth embodiment, the silyl protecting group of the fourteenth embodiment is:

[0130]

[0131] Wherein s is an integer from 1 to 30.

[0132] In a seventeenth embodiment, the Z group of the fourteenth embodiment is TBDPS.

[0133] An eighteenth embodiment discloses the method as described in any one of the first to twelfth embodiments, wherein W is Y represented by the formula:

[0134]

[0135] Where X0 is C 1-10 Alkyl, wherein one or more CH2 groups are independently replaced by C(O), C(O)NH2, cycloalkyl or heterocyclyl; and X1 is C 1-25 Alkyl or C 1-25 In a particular embodiment, Y is represented by the formula:

[0136]

[0137] wherein p is an integer from 1 to 10; Het is a saturated heterocycle; and the remaining variables are as described above. In a more specific embodiment, Het is piperazine.

[0138] In the nineteenth embodiment, Y of the eighteenth embodiment is represented by the formula:

[0139]

[0140] The twentieth embodiment discloses the method of any one of the first to nineteenth embodiments, wherein the compound of formula (AI) or (AI') or a salt thereof is not purified by chromatography (eg, column chromatography).

[0141] The twenty-first embodiment discloses the method of the first to twentieth embodiments, wherein the compound of formula (AI) or (AI') or its salt is purified by selective precipitation and / or extraction. In certain embodiments, the compound of formula (AI) or its salt is purified by selective precipitation. In certain embodiments, selective precipitation of the compound of formula (AI) or its salt can be achieved by adding acetonitrile to a solution of the crude product in DCM. Alternatively, the crude product solution can be added to acetonitrile to precipitate the desired product.

[0142] In certain embodiments, the compound of formula (AI') or its salt is purified by selective precipitation. In certain embodiments, the compound of formula (AI') or its salt is purified by extracting the compound of formula (AI') or its salt contained in an organic solvent (MBTE, EtOAc, heptane / MBTE mixture, DCM, etc.) with an aqueous solution (e.g., NaHCO3 / H2O or NaCl / H2O) in addition to selective precipitation. In certain embodiments, the extraction is performed before the selective precipitation. Alternatively, the extraction is performed after the selective precipitation. In certain embodiments, the selective precipitation of the compound of formula (AI') or its salt can be achieved by adding heptane or a heptane / MBTE mixture to a solution of the crude product in DCM or EtOAc. Alternatively, the crude product solution can be added to heptane or a heptane / MBTE mixture to precipitate the desired product. A heptane / MBTE mixture having a suitable volume ratio (e.g., a volume ratio described herein) can be used.

[0143] In some embodiments, for the method of the first aspect or any embodiment described therein (e.g., the method described in any one of the first to twenty-first embodiments), z is 1 to 150, 1 to 100, 1 to 50, 1 to 20, 1 to 10, or 1 to 5.

[0144] In some embodiments, for the method of the first aspect or any embodiment described therein (eg, the method described in any one of the first to twenty-first embodiments), R 16 C independently at each occurrence 1-6 Alkyl, C 2-6 alkenyl, phenyl or benzyl, each of which is optionally substituted with -CN, -NO2 or halogen; or R16 for In a particular embodiment, R 16 One of the following:

[0145]

[0146] In some embodiments, for the method of the first aspect or any embodiment described therein (e.g., the method described in any one of the first to twenty-first embodiments):

[0147] Each R 2 are independently selected from H, halogen or optionally C 1-4 Alkoxy-substituted C 1-4 alkoxy;

[0148] R 4 is H; and

[0149] R 16 It is -CH2CH2CN.

[0150] In a particular embodiment, R 2 It is -OCH2CH2OMe.

[0151] b.3'-deprotection reaction:

[0152] In a second aspect, the present disclosure describes a liquid phase deprotection method for removing the 3'-hydroxyl protecting group on an oligonucleotide. In one embodiment, the deprotection method is a desilylation process. It has been found that the desilylation process of the present disclosure can selectively remove the silyl protecting group of the 3'-hydroxyl without affecting other sensitive groups on the oligonucleotide, such as the various protecting groups of the 5'-trityl group, the nucleobase (e.g., benzoyl or isobutyryl), the cyanoethyl group, and -OCH2CHOMe (also known as methoxyethyl (MOE)).

[0153] In a twenty-second embodiment, a second aspect of the present disclosure relates to a liquid phase process for preparing a compound of formula (BI) or a salt thereof:

[0154]

[0155] It comprises the compound of formula (BII) or a salt thereof:

[0156]

[0157] Deprotection to form a compound of formula (BI) or a salt thereof, wherein:

[0158] R 1is independently at each occurrence a nucleobase, wherein the NH2 of the nucleobase (if present) is protected by an amine protecting group;

[0159] R 2 In each occurrence, independently selected from the group consisting of H, halo, and optionally C 1-6 Alkoxy-substituted C 1-6 a group consisting of alkoxy groups;

[0160] R 4 Each occurrence is independently H or R 2 The alkoxy groups form a ring;

[0161] R 15 is a hydroxyl protecting group;

[0162] R 16 C independently at each occurrence 1-6 Alkyl, C 2-6 alkenyl, phenyl or benzyl, each of which is optionally substituted with -CN, -NO2 or halogen; or

[0163] R 16 for

[0164] q is an integer from 1 to 200;

[0165] X is independently O or S at each occurrence; and

[0166] Z is a hydroxy protecting group (eg, a silyl hydroxy protecting group).

[0167] In a twenty-third embodiment, the second aspect of the present disclosure relates to a liquid phase method for preparing a compound of formula (B2I) or a salt thereof:

[0168]

[0169] It comprises deprotecting a compound of formula (B2II) or a salt thereof:

[0170]

[0171] To form a compound of formula (B2I) or a salt thereof, wherein:

[0172] R 1 is independently at each occurrence a nucleobase, wherein the NH2 of the nucleobase (if present) is protected by an amine protecting group;

[0173] R 2 In each occurrence, independently selected from the group consisting of H, halo, and optionally C 1-6 Alkoxy-substituted C 1-6 a group consisting of alkoxy groups;

[0174] R 4 Each occurrence is independently H or R 2 The alkoxy groups form a ring;

[0175] R 16 C independently at each occurrence 1-6 Alkyl, C 2-6 alkenyl, phenyl or benzyl, each of which is optionally substituted with -CN, -NO2 or halogen; or

[0176] R 16 for

[0177] q is an integer from 1 to 200;

[0178] X is independently O or S at each occurrence;

[0179] Y is a hydrophobic hydroxyl protecting group containing an alkyl chain; and

[0180] Z is a hydroxyl protecting group.

[0181] In the twenty-fourth embodiment, Y of the twenty-third embodiment is represented by the formula:

[0182]

[0183] where X a C 1-10 Alkyl, wherein one or more CH2 groups are independently replaced by C(O), C(O)NH2, cycloalkyl or C 1-6 Heterocyclic substitution, and X1 is C 1-25 Alkyl or C 1-25 In a particular embodiment, Y is represented by the formula:

[0184]

[0185] wherein p is an integer from 1 to 10; Het is a saturated heterocycle; and the remaining variables are as described above. In a more specific embodiment, Het is piperazine.

[0186] In a twenty-fifth embodiment, Y of the twenty-third embodiment is represented by the formula:

[0187]

[0188] In a twenty-sixth embodiment, the deprotection reaction is carried out by reacting the compound of formula (BII) or (B2II) or a salt thereof with HF in the presence of a base.

[0189] In a twenty-seventh embodiment, the base of the twenty-sixth embodiment is imidazole or pyridine, wherein the imidazole or pyridine is optionally substituted.

[0190] The twenty-eighth embodiment discloses the method as described in any one of the twenty-second to twenty-seventh embodiments, wherein an excess of base relative to HF is used.

[0191] In a twenty-ninth embodiment, the deprotection reaction is carried out by reacting the compound of formula (BII) or (B2II) or a salt thereof with HF in the presence of pyridine and imidazole.

[0192] In a thirtieth embodiment, the molar ratio of imidazole to HF of the twenty-ninth embodiment is in the range of 1.1: 1 to 5: 1. In some embodiments, the molar ratio of imidazole to HF is in the range of 1.1: 1 to 3: 1, 1.5: 1 to 3: 1, or 1.5: 1 to 2.5: 1.

[0193] In a thirty-first embodiment, the molar ratio of imidazole to HF in the thirtieth embodiment is 2:1.

[0194] In a thirty-second embodiment, for the process of any one of embodiments twenty-ninth through thirty-first, the molar ratio of pyridine to HF is in the range of 1.1: 1 to 20: 1. In some embodiments, the molar ratio of pyridine to HF is in the range of 5: 1 to 20: 1 or 5: 1 to 15: 1. In a specific embodiment, the molar ratio of pyridine to HF is 10: 1.

[0195] The thirty-third embodiment discloses the method as described in any one of the twenty-second to thirty-second embodiments, wherein Z is a silylhydroxy protecting group. In certain embodiments, the silyl protecting groups include but are not limited to those described above in the fourteenth embodiment.

[0196] In a thirty-fourth embodiment, the silylhydroxy protecting group is TBDPS, ToBDPS, or TBDAS as described in the fifteenth, sixteenth, or seventeenth embodiment. In certain embodiments, the silyl protecting group is TBDPS.

[0197] In certain embodiments, the deprotection reaction described above (eg, in any one of the twenty-third to thirty-fourth embodiments) is carried out in a suitable organic solvent such as THF.

[0198] A thirty-fifth embodiment discloses the method as described in any one of the twenty-second to thirty-fourth embodiments, wherein the compound of formula (BI) or (B2I) or a salt thereof is not purified by chromatography (eg, column chromatography).

[0199] In the thirty-sixth embodiment, the compound of formula (B1) or (B2I) or its salt is purified by selective precipitation and / or extraction. In certain embodiments, the compound of formula (B2I) or its salt is purified by selective precipitation. In certain embodiments, the selective precipitation of the compound of formula (B2I) or its salt can be achieved by adding acetonitrile to a DCM solution of the crude product. Alternatively, the crude product solution can be added to acetonitrile to precipitate the desired product.

[0200] In certain embodiments, the compound of formula (BI) or its salt is purified by selective precipitation. In certain embodiments, the compound of formula (BI) or its salt is purified by extracting the compound of formula (BI) or its salt contained in an organic solvent (MBTE, EtOAc, heptane / MBTE mixture, DCM, etc.) with an aqueous solution (e.g., NaHCO / H2O or NaCl / H2O) in addition to selective precipitation. In certain embodiments, extraction is performed before selective precipitation. Alternatively, extraction is performed after selective precipitation. In certain embodiments, the selective precipitation of the compound of formula (BI) or its salt can be achieved by adding heptane or heptane / MBTE mixture to a solution of the crude product in DCM or EtOAc. Alternatively, the crude product solution can be added to heptane or heptane / MBTE mixture to precipitate the desired product. A heptane / MBTE mixture with a suitable volume ratio (e.g., volume ratio as described herein) can be used.

[0201] In some embodiments, for the method described in the second aspect or any embodiment described therein (e.g., the twenty-second, twenty-sixth to thirty-sixth embodiments), R 15 is a 4,4'-dimethoxytrityl (DMT) group.

[0202] In some embodiments, for the method described in the second aspect or any embodiment described therein (e.g., the twenty-second to thirty-sixth embodiments), each R 2 are independently selected from H or optionally replaced by C 1-4 Alkoxy-substituted C 1-4 Alkoxy; R 4 is H; and R 16 It is -CH2CH2CN.

[0203] In some embodiments, for the method described in the second aspect or any embodiment described therein (e.g., the twenty-second, twenty-sixth to thirty-sixth embodiments), each R 2 are independently selected from H, halo or optionally C 1-4 Alkoxy-substituted C 1-4 Alkoxy; R 4 H; R 15is 4,4'-dimethoxytrityl; and R 16 In a particular embodiment, R 2 For MOE.

[0204] In some embodiments, for the method described in the second aspect or any embodiment described therein (e.g., the twenty-second to thirty-sixth embodiments), each R 2 are independently selected from H, halo (eg F) or optionally substituted by C 1-4 Alkoxy-substituted C 1-4 Alkoxy; R 4 is H; and R 16 In a particular embodiment, R 2 is -OCH2CH2OCH3(MOE).

[0205] c. Phosphitylation reaction

[0206] A third aspect of the present disclosure provides a liquid phase phosphitylation method for oligonucleotides as described herein. The method comprises reacting a 3'-OH group with a phosphorodiamidite or an H-phosphonate (HO)P(O)H. The phosphitylation method of the present disclosure can be used to synthesize high-purity oligonucleotide fragments having three or more nucleotides without the need for chromatographic purification.

[0207] The thirty-seventh embodiment discloses a liquid method for preparing a compound of formula (CI) or (CI') or a salt thereof:

[0208]

[0209]

[0210] It comprises making a compound of formula (CII) or a salt thereof:

[0211]

[0212] with phosphoramidite (R 16 O)P(NR 17a R 17b )2 or H-phosphonate (HO)P(O)H to form a compound of formula (CI) or (CI'), wherein:

[0213] R 1 is independently at each occurrence a nucleobase, wherein the NH2 of the nucleobase (if present) is protected by an amine protecting group;

[0214] R 2 is independently selected at each occurrence from H, halo and optionally substituted by halo or C 1-6 Alkoxy-substituted C1-6 a group consisting of alkoxy groups;

[0215] R 4 Each occurrence is independently H or R 2 The alkoxy groups form a ring;

[0216] R 15 is a hydroxyl protecting group;

[0217] R 16 C independently at each occurrence 1-6 Alkyl, C 2-6 alkenyl, phenyl or benzyl, each of which is optionally substituted with -CN, -NO2 or halogen; or

[0218] R 16 for

[0219] R 17a and R 17b Independently C 1-6 alkyl

[0220] q1 is an integer from 2 to 200;

[0221] X is independently O or S at each occurrence; and

[0222] Z is a silylhydroxy protecting group.

[0223] The thirty-eighth embodiment discloses a liquid method for preparing a compound of formula (C2I) or a salt thereof:

[0224]

[0225] It comprises making a compound of formula (C2II) or a salt thereof:

[0226]

[0227] With phosphoramidite (R 16 O)P(NR 17a R 17b )2 to form a compound of formula (C2I) or a salt thereof, wherein:

[0228] R 1 is independently at each occurrence a nucleobase, wherein the NH2 of the nucleobase (if present) is protected by an amine protecting group;

[0229] R 2 is independently selected at each occurrence from H, halo and optionally substituted by halo or C 1-6 Alkoxy-substituted C 1-6 a group consisting of alkoxy groups;

[0230] R4 Each occurrence is independently H or R 2 The alkoxy groups form a ring;

[0231] R 16 C independently at each occurrence 1-6 Alkyl, C 2-6 alkenyl, phenyl or benzyl, each of which is optionally substituted with -CN, -NO2 or halogen; or

[0232] R 16 for

[0233] R 17a and R 17b Independently C 1-6 alkyl

[0234] q1 is an integer from 2 to 200;

[0235] X is independently O or S at each occurrence; and

[0236] Z is a silylhydroxy protecting group.

[0237] In some embodiments, for the method described in the thirty-eighth embodiment, each R 2 are independently selected from H, F or optionally C 1-4 Alkoxy-substituted C 1-4 Alkoxy; R 4 H; R 16 -CH2CH2CN; R 17a and R 17b Independently C 1-6 and Z is a silylhydroxy protecting group as described herein. In some embodiments, Z is selected from TBDPS, TBoDPS, and TBDAS. In a specific embodiment, R 2 H, R 4 H; R 16 -CH2CH2CN; R 17a and R 17b In another specific embodiment, R 2 For MOE, R 4 H; R 16 -CH2CH2CN; R 17a and R 17b All are -CH(CH3)2; and Z is TBDPS.

[0238] The thirty-ninth embodiment discloses the method described in the third aspect or any embodiment described therein (e.g., the thirty-seventh or thirty-eighth embodiment), wherein the reaction is carried out in the presence of an activator. As used herein, an activator is a chemical reagent that promotes the reaction between the 3'-hydroxyl of a phosphorodiamidite or H-phosphonate and an oligonucleotide (e.g., a compound of formula (CII) or (C2II)). Exemplary activators include, but are not limited to, the following reagents:

[0239]

[0240] In a fortieth embodiment, the present disclosure provides a method as in the thirty-ninth embodiment, wherein the activating agent is pyridinium trifluoroacetate (Py·TFA) or N-methylimidazolium trifluoromethanesulfonate.

[0241] A forty-first embodiment discloses the method as described in any one of the thirty-fourth to thirty-sixth embodiments, wherein the compound of formula (CI), (CI'), or (C2I) is not purified by chromatography (eg, column chromatography).

[0242] The forty-second embodiment discloses a method according to any one of the thirty-fourth to thirty-sixth embodiments, wherein the compound of formula (CI), (CI') or (C2I) or its salt is purified by selective precipitation and / or extraction. In certain embodiments, the compound of formula (CI), (CI') or (C2I) or its salt is purified by selective precipitation. In certain embodiments, the compound of formula (CI), (CI') or (C2I) or its salt is purified by extracting the compound of formula (CI), (CI') or (C2I) or its salt in an organic solvent (MBTE, EtOAc, heptane / MBTE mixture, DCM, etc.) with an aqueous solution (e.g., NaHCO3 / H2O or NaCl / H2O). In certain embodiments, the extraction is performed before the selective precipitation. Alternatively, the extraction is performed after the selective precipitation. In certain embodiments, the selective precipitation of the compound of formula (CI), (CI') or (C2I) or its salt can be achieved by adding heptane or a heptane / MBTE mixture to a solution of the crude product in DCM or EtOAc. Alternatively, the crude product solution can be added to heptane or a heptane / MBTE mixture to precipitate the desired product. A heptane / MBTE mixture having a suitable volume ratio (eg, the volume ratios described herein) can be used.

[0243] In some embodiments, for the methods described in the third aspect or any embodiment described therein (eg, the thirty-seventh embodiment), the variables of Formula (CI), (CI'), or (CII) are defined as follows:

[0244] Each R 2are independently selected from H, F or optionally C 1-4 Alkoxy-substituted C 1-4 alkoxy;

[0245] R 4 is H;

[0246] R 15 is 4,4'-dimethoxytrityl;

[0247] R 16 is -CH2CH2CN; and

[0248] R 17a and R 17b Independently C 1-6 alkyl.

[0249] In a particular embodiment, R 2 In another specific embodiment, R 2 H; R 4 H; R 16 is -CH2CH2CN; and R 17a and R 17b In another specific embodiment, R 2 For MOE, R 4 H; R 16 is -CH2CH2CN; and R 17a and R 17b Both are -CH(CH3)2.

[0250] The forty-third embodiment discloses a liquid method for preparing a compound of formula (CI') or a salt thereof:

[0251]

[0252] It includes the following steps:

[0253] 1) making a compound of formula (CI'A) or a salt thereof:

[0254]

[0255] With a compound of formula (A1) or a salt thereof:

[0256]

[0257] Reaction to form a compound of formula (CI'B) or a salt thereof:

[0258] and

[0259] 3) Sulfurizing or oxidizing the compound of formula (CI'B) or its salt with a sulfurizing agent or an oxidizing agent to form a compound of formula (CI'C) or its salt:

[0260]

[0261] 4) deprotecting the compound of formula (CI'C) or a salt thereof to form a compound of formula (CI'D) or a salt thereof:

[0262]

[0263] 5) Starting from the compound of formula (CI'D), repeating steps 1), 2), 3) and 4)q1-3 times, and then repeating steps 1), 2) and 3) to obtain a fragment of formula (CI') or a salt thereof, wherein:

[0264] R 1 is independently at each occurrence a nucleobase, wherein the NH2 of the nucleobase (if present) is protected by an amine protecting group;

[0265] R 2 In each occurrence, independently selected from the group consisting of H, halo, and optionally C 1-6 Alkoxy-substituted C 1-6 a group consisting of alkoxy groups;

[0266] R 4 Each occurrence is independently H or R 2 The alkoxy groups form a ring;

[0267] R 15 is a hydroxyl protecting group (e.g., a DMT group);

[0268] R 16 C independently at each occurrence 1-6 Alkyl, C 2-6 alkenyl, phenyl or benzyl, each of which is optionally substituted with -CN, -NO2 or halogen; or

[0269] R 16 for

[0270] R 17a and R 17b Independently C 1-6 alkyl;

[0271] q1 is an integer from 2 to 200; and

[0272] X is independently O or S at each occurrence.

[0273] The forty-fourth embodiment discloses a preparation method of formula (CI c ) of the oligonucleotide or its salt liquid phase method:

[0274]

[0275] It includes the formula (CI a ) or a salt thereof:

[0276]

[0277] With formula (CI b ) or a salt thereof:

[0278] Coupled to form formula (CI c ) or a salt thereof, wherein:

[0279] R 1 is independently at each occurrence a nucleobase, wherein the NH2 of the nucleobase (if present) is protected by an amine protecting group;

[0280] R 2 In each occurrence, independently selected from the group consisting of H, halo, and optionally C 1-6 Alkoxy-substituted C 1-6 a group consisting of alkoxy groups;

[0281] R 4 Each occurrence is independently H or R 2 The alkoxy groups form a ring;

[0282] R 15 is a hydroxyl protecting group;

[0283] R 16 C independently at each occurrence 1-6 Alkyl, C 2-6 alkenyl, phenyl or benzyl, each of which is optionally substituted with -CN, -NO2 or halogen; or

[0284] R 16 for

[0285] q1a is an integer from 2 to 20;

[0286] q1b is an integer from 2 to 20;

[0287] X is independently O or S at each occurrence; and

[0288] Z is a hydroxyl protecting group.

[0289] In certain embodiments, the coupling reaction of the forty-fourth embodiment is carried out in the presence of an acyl chloride. In a specific embodiment, formula (CI a ) and the oligonucleotide of formula (CI b) is carried out in the presence of pivaloyl chloride. In another specific embodiment, the coupling reaction is carried out in the presence of pivaloyl chloride and a base (e.g., pyridine).

[0290] In certain embodiments, for the methods described in the forty-third or forty-fourth embodiments, chromatography is not used to purify the reaction product of any of the reaction steps described therein. In certain embodiments, the reaction product of any of the reaction steps described therein is purified by selective precipitation and / or extraction as described herein (e.g., as described in the twenty-first, thirty-fifth, or forty-second embodiments).

[0291] d. Synthesis of 3'-oligonucleotide fragments

[0292] In a fourth aspect, the present disclosure describes a liquid phase method for preparing oligonucleotide fragments having a hydrophobic hydroxyl protecting group at the 3'-end (referred to herein as "3'-fragments"). Surprisingly, the method for synthesizing 3'-fragments disclosed herein can be used to prepare highly purified oligonucleotide fragments having 3 to 20 (e.g., 3 to 10, 3 to 8, 3 to 5, or 4 to 5) nucleotides without the need for chromatographic purification. In some embodiments, a hydrophobic 3'-hydroxyl protecting group is used, which facilitates separation of the oligonucleotide fragment product by selective precipitation. In some embodiments, the liquid phase method comprises (1) a 5'-OH deprotection step, (2) a coupling step, and (3) an oxidation or sulfurization step, wherein steps (1), (2), and (3) are repeated until the desired number of nucleotides are linked together to form a 3'-oligonucleotide fragment.

[0293] The forty-fifth embodiment discloses a liquid phase method for preparing an oligonucleotide fragment of formula (I) or a salt thereof,

[0294]

[0295] It includes the following steps:

[0296] 1) the compound of formula (I'A) or a salt thereof:

[0297]

[0298] Deprotection to form a compound of formula (IA) or a salt thereof:

[0299]

[0300] 2) reacting a compound of formula (IA) or a salt thereof with a compound of formula (A1):

[0301]

[0302] Reaction to form a compound of formula (IB) or a salt thereof:

[0303] and

[0304] 3) Sulfurizing or oxidizing the compound of formula (IB) or its salt with a sulfiding agent or an oxidizing agent to form a compound of formula (IC) or its salt:

[0305]

[0306] 4) deprotecting the compound of formula (IC) or a salt thereof to form a compound of formula (ID) or a salt thereof:

[0307]

[0308] 5) Starting from the compound of formula (ID), repeating steps 2), 3) and 4) n-2 times to obtain a fragment of formula (I) or a salt thereof, wherein:

[0309] R 1 is independently at each occurrence a nucleobase, wherein the NH2 of the nucleobase (if present) is protected by an amine protecting group;

[0310] R 2 In each occurrence, independently selected from the group consisting of H, halo, and optionally C 1-6 Alkoxy-substituted C 1-6 a group consisting of alkoxy groups;

[0311] R 4 Each occurrence is independently H or R 2 The alkoxy groups form a ring;

[0312] R 15 is a hydroxyl protecting group;

[0313] R 16 C independently at each occurrence 1-6 Alkyl, C 2-6 alkenyl, phenyl or benzyl, each of which is optionally substituted with -CN, -NO2 or halogen; or

[0314] R 16 for

[0315] R 17a and R 17b Independently C 1-6 alkyl;

[0316] n is an integer from 2 to 20;

[0317] X is independently O or S at each occurrence;

[0318] Y is a hydrophobic hydroxyl protecting group containing an alkyl chain.

[0319] A forty-sixth embodiment discloses the method of the forty-fifth embodiment, wherein the fragment of formula (I) is not purified by chromatography (eg, column chromatography).

[0320] The forty-seventh embodiment discloses the method of the forty-fifth or forty-sixth embodiment, wherein the fragment of formula (I) is purified by selective precipitation and / or extraction. In certain embodiments, the fragment of formula (I) is purified by selective precipitation. In a specific embodiment, the fragment of formula (I) is purified by adding CH3CN to the reaction mixture containing the crude product and then filtering to separate the fragment product.

[0321] The forty-eighth embodiment discloses the method of any one of the forty-fifth, forty-sixth or forty-seventh embodiments, wherein chromatography (eg, column chromatography) is not used to purify the reaction product of any one of steps 1), 2), 3) and 4).

[0322] The forty-ninth embodiment discloses the method of any one of the forty-fifth to forty-eighth embodiments, wherein the reaction product of any one of steps 1), 2), 3) and 4) is purified by selective precipitation (e.g., as described in the twenty-first, thirty-fifth or forty-second embodiment).

[0323] In a fiftieth embodiment, for the method described in any one of the forty-fifth to forty-ninth embodiments, Y is represented by the formula:

[0324]

[0325] Where X0 is C 1-10 Alkyl, wherein one or more CH2 groups are independently replaced by C(O), C(O)NH2, cycloalkyl or heterocyclyl; and X1 is C 1-25 Alkyl or C 1-25 In a particular embodiment, Y is represented by the formula:

[0326]

[0327] wherein p is an integer from 1 to 10; Het is a saturated heterocycle; and the remaining variables are as described above. In a more specific embodiment, Het is piperazine.

[0328] A fifty-first embodiment discloses the method of any one of the forty-fifth to forty-ninth embodiments, wherein Y is:

[0329]

[0330] In certain embodiments, for the method described in the fourth aspect or any embodiment described therein (e.g., the forty-fifth to fifty-first embodiments), the deprotection reaction of step 1) and / or step 4) is performed as described in the first aspect or any embodiment described therein (e.g., the second to twelfth embodiments).

[0331] In certain embodiments, for the method described in the fourth aspect or any embodiment described therein (e.g., the forty-fifth to fifty-first embodiments), the coupling reaction of step 2) can be carried out in the presence of an activating agent described herein (e.g., an activating agent described in the thirty-ninth embodiment). In certain embodiments, the activating agent is 4,5-dicyanoimidazole (DCI) or 5-ethylthio-1H-tetrazole (ETT).

[0332] In certain embodiments, for the method described in the fourth aspect or any embodiment described therein (e.g., the forty-fifth to fifty-first embodiments), the sulfurization reaction of step 3) is carried out using a sulfurizing agent such as 3-amino-1,2,4-dithiazole-5-thione (hydrogenated xanthan gum or ADTT), 3-(N,N-dimethylamino-methylene)amino)-3H-1,2,4-dithiazole (DDTT), phenylacetyl disulfide (PADS), 3H-1,2-benzodithiol-3-one 1,1-dioxide (Beaucage reagent) or phenyl-3H-1,2,4-dithiazole-3-one (POS). In a specific embodiment, the sulfurizing agent is DDTT. In a specific embodiment, the sulfurizing agent is hydrogenated xanthan gum. In certain embodiments, the sulfurization reaction is carried out in the presence of a base as described herein. In certain embodiments, the base is pyridine or imidazole. In certain embodiments, the sulfurization reaction of step 3) is performed in the presence of DDTT and 4,5-dicyanoimidazole (DCI).

[0333] In certain embodiments, for the method described in the fourth aspect or any embodiment described therein (e.g., the 45th to 51st embodiment), the oxidation reaction of step 3) is carried out using a standard oxidant known in the literature. Exemplary oxidants include, but are not limited to, tert-butyl hydroperoxide (t-BuOOH), (1S)-(+)-(10-camphorsulfonyl)oxaziridine (CSO), I2, and iodine-pyridine-water oxidant solution. In a specific embodiment, the oxidant is t-BuOOH.

[0334] e. Synthesis of 5'-oligonucleotide fragments

[0335] In a fifth aspect, the present disclosure describes a liquid phase method for preparing an oligonucleotide fragment (5'-fragment) having a phosphoramidite group that can be coupled to the above-mentioned 3'-fragment. Surprisingly, it was found that the disclosed method for preparing the 5'-fragment can be used to synthesize high-purity oligonucleotide fragments having 3 to 20 (e.g., 3 to 10, 3 to 8, 3 to 5, or 4 to 5) nucleotides without the need for chromatographic purification. In some embodiments, the method involves selective deprotection of the 3'-hydroxy protecting group. In some embodiments, the liquid phase method comprises (1) a 5'-OH deprotection step, (2) a coupling step, and (3) an oxidation or sulfurization step, wherein steps (1), (2), and (3) are repeated until the desired number of nucleotides are linked together to form a 5'-oligonucleotide fragment.

[0336] The fifty-second embodiment discloses a liquid phase method for preparing an oligonucleotide fragment of formula (II) or a salt thereof,

[0337]

[0338] The method comprises the following steps: 1') reacting a compound of formula (IIA') or a salt thereof:

[0339]

[0340] Deprotection to form a compound of formula (IIA) or a salt thereof:

[0341]

[0342] 2') reacting a compound of formula (IIA) or a salt thereof with a compound of formula (A2) or a salt thereof:

[0343]

[0344] Reaction to form a compound of formula (IIB) or a salt thereof:

[0345] and

[0346] 3') sulfiding or oxidizing the compound of formula (IIB) or its salt with a sulfiding agent or an oxidizing agent to form a compound of formula (IIC) or its salt:

[0347]

[0348] 4') deprotecting the compound of formula (IIC) or a salt thereof to form a compound of formula (IID) or a salt thereof:

[0349]

[0350] 5') when m is 3, starting from the compound of formula (IID) or a salt thereof, repeating steps 2') and 3') to form the compound of formula (IIE) or a salt thereof, or

[0351] When m is greater than 3, starting from the compound of formula (IID) or a salt thereof, steps 2'), 3') and 4') are repeated m-3 times, and then steps 2') and 3') are performed to form a compound of formula (IIE) or a salt thereof:

[0352]

[0353] 6') deprotecting the compound of formula (IIE) or a salt thereof to form a compound of formula (IIF) or a salt thereof:

[0354] and

[0355] 7') Compound (IIF) or its salt is reacted with phosphorodiamidite (R 16 O)P(NR 17a R 17b) 2 reaction to obtain a fragment of formula (II) or a salt thereof:

[0356] in:

[0357] R 1 is independently at each occurrence a nucleobase, wherein the NH2 of the nucleobase (if present) is protected by an amine protecting group;

[0358] R 2 In each occurrence, independently selected from the group consisting of H, halo, and optionally C 1-6 Alkoxy-substituted C 1-6 a group consisting of alkoxy groups;

[0359] R 4 Each occurrence is independently H or R 2 The alkoxy groups form a ring;

[0360] R 15 is a hydroxyl protecting group;

[0361] R 16 C independently at each occurrence 1-6 Alkyl, C 2-6 alkenyl, phenyl or benzyl, each of which is optionally substituted with -CN, -NO2 or halogen; or

[0362] R 16 for

[0363] R 17a and R 17b Independently C 1-6 alkyl;

[0364] m is an integer from 2 to 20;

[0365] X is independently O or S at each occurrence; and

[0366] Z is a hydroxysilyl protecting group.

[0367] In a fifty-third embodiment, for the method described in the fifty-second embodiment, the fragment of formula (II) is not purified by chromatography (eg, column chromatography).

[0368] A fifty-fourth embodiment discloses a method as described in the fifty-second or fifty-third embodiment, wherein the fragment of formula (II) is purified by extraction and / or selective precipitation as described herein (eg, as described in the twenty-first, thirty-fifth or forty-second embodiment).

[0369] A fifty-fifth embodiment discloses a method as described in the fifty-second to fifty-fourth embodiments, wherein no chromatography is used to purify the reaction product of any of steps 1'), 2'), 3'), 4'), 5'), 6') and 7').

[0370] The fifty-sixth embodiment discloses a method as described in the fifty-second to fifty-fifth embodiments, wherein the reaction product of any one of steps 1'), 2'), 3'), 4'), 5'), 6') and 7') is purified by extraction and / or selective precipitation as described herein (for example, as described in the twenty-first, thirty-fifth or forty-second embodiment).

[0371] In some embodiments, the deprotection reactions of step 1') and step 4') are performed as described in the first aspect or any embodiment described therein (eg, any one of the second to twelfth embodiments).

[0372] In some embodiments, the coupling reaction of step 2') is performed as described in the fourth aspect. In certain embodiments, the coupling reaction is performed in the presence of an activator as described herein (e.g., an activator as described in the thirty-ninth embodiment). In certain embodiments, the activator is 4,5-dicyanoimidazole (DCI) or 5-ethylthio-1H-tetrazole (ETT).

[0373] In some embodiments, the sulfurization or oxidation reaction of step 3') is performed as described in the fourth aspect.

[0374] In some embodiments, the deprotection reaction of step 6') is performed as described in the second aspect or any embodiment described therein (eg, any one of the twenty-sixth to thirty-fourth embodiments).

[0375] In some embodiments, the phosphitylation reaction of step 7') is performed as described in the third aspect or any embodiment described therein (eg, any one of the thirty-ninth to forty-second embodiments).

[0376] II. Synthesis of Target Oligonucleotides

[0377] i) 3'-5' extension:

[0378] In a sixth aspect, the present disclosure describes a liquid phase convergence synthesis of a target oligonucleotide, wherein the target oligonucleotide is assembled in the direction of the 3'-end to the 5'-end (3'-5' direction). It has been demonstrated that the convergent liquid phase method of the present disclosure is successfully used for a large number of synthetic target oligonucleotides. In addition, highly purified protected target oligonucleotides can be obtained by the method of the present disclosure without the need for chromatographic purification.

[0379] In certain embodiments, the convergent liquid phase method described herein includes gradually adding oligonucleotide fragments in the liquid (solution) phase to synthesize target oligonucleotides. For example, first 5-mer and 4-mer fragments are coupled to synthesize 9-mer fragments, and the 9-mer fragments are further reacted with another 5-mer fragment to synthesize 14-mer oligonucleotides. The 14-mer oligonucleotide can be further coupled with another fragment until the target oligonucleotide of the desired length is obtained. In certain embodiments, a 5-mer fragment with a 3'-hydrophobic hydroxyl protecting group (3'-LHPG) (3'-end fragment) is first coupled with a 5-mer fragment to form a 10-mer fragment with a 3'-LHPG group, and then the 10-mer fragment is further reacted with a 4-mer fragment to form a 14-mer fragment, which is coupled with another 4-mer fragment to form a target 18-mer oligonucleotide. In certain embodiments, a 3'-terminal fragment having n nucleotides (eg, a 5-mer fragment) is synthesized by coupling a single nucleotide having a 3'-LHPG group to a fragment having n-1 nucleotides (eg, a 4-mer fragment).

[0380] The fifty-seventh embodiment discloses a convergent liquid phase method for preparing a target oligonucleotide, comprising the following steps:

[0381] a) an oligonucleotide fragment of formula (I) or a salt thereof:

[0382]

[0383] and an oligonucleotide fragment of formula (II) or a salt thereof:

[0384]

[0385] The coupling is carried out in solution to form an oligonucleotide of formula (III) or a salt thereof:

[0386]

[0387] and

[0388] b) sulfurizing or oxidizing the oligonucleotide of formula (III) or a salt thereof to form the oligonucleotide of formula (IV) or a salt thereof:

[0389]

[0390] in:

[0391] R 1 is independently at each occurrence a nucleobase, wherein the NH2 of the nucleobase (if present) is protected by an amine protecting group;

[0392] R 2 In each occurrence, independently selected from the group consisting of H, halo, and optionally C 1-6 Alkoxy-substituted C 1-6 a group consisting of alkoxy groups;

[0393] R 4 Each occurrence is independently H or R 2 The alkoxy groups form a ring;

[0394] R 15 is a hydroxyl protecting group;

[0395] R 16 C independently at each occurrence 1-6 Alkyl, C 2-6 alkenyl, phenyl or benzyl, each of which is optionally substituted with -CN, -NO2 or halogen; or

[0396] R 16 for

[0397] R 17a and R 17b Independently C 1-6 alkyl;

[0398] n is an integer from 2 to 200;

[0399] m is an integer from 2 to 20

[0400] X is independently O or S at each occurrence;

[0401] Y is a hydrophobic hydroxyl protecting group containing an alkyl chain.

[0402] The fifty-seventh embodiment also includes a convergent liquid phase method for preparing target oligonucleotides comprising the steps of:

[0403] a) making an oligonucleotide fragment of formula (I) or a salt thereof:

[0404]

[0405] With formula (II a ) or a salt thereof:

[0406]

[0407] Coupling in solution to form formula (III a ) or a salt thereof:

[0408] in:

[0409] R 1 is independently at each occurrence a nucleobase, wherein the NH2 of the nucleobase (if present) is protected by an amine protecting group;

[0410] R 2 In each occurrence, independently selected from the group consisting of H, halo, and optionally C 1-6 Alkoxy-substituted C 1-6 a group consisting of alkoxy groups;

[0411] R 4 Each occurrence is independently H or R 2 The alkoxy groups form a ring;

[0412] R 15 is a hydroxyl protecting group;

[0413] R 16 C independently at each occurrence 1-6 Alkyl, C 2-6 alkenyl, phenyl or benzyl, each of which is optionally substituted with -CN, -NO2 or halogen; or

[0414] R 16 for

[0415] n is an integer from 2 to 200;

[0416] m is an integer from 2 to 20

[0417] X is independently O or S at each occurrence;

[0418] Y is a hydrophobic hydroxyl protecting group containing an alkyl chain.

[0419] The fifty-eighth embodiment discloses the method according to the fifty-seventh embodiment, wherein the fragment of formula (I) can be prepared by making a nucleotide of formula (Ia1) or a salt thereof:

[0420]

[0421] and an oligonucleotide fragment of formula (Ia2) or a salt thereof:

[0422]

[0423] The coupling is carried out in solution to form the oligonucleotide fragment of formula (I) or a salt thereof.

[0424] In certain embodiments, for the method described in the fifty-eighth embodiment, n is an integer from 3 to 20. In one specific embodiment, n is from 3 to 6. In another specific embodiment, n is 5.

[0425] In certain embodiments, for the method described in the fifty-eighth embodiment, fragment (I) is not purified by chromatography. In another embodiment, fragment (I) is purified by selective precipitation and / or extraction (e.g., as described in the forty-sixth and forty-seventh embodiments).

[0426] The fifty-ninth embodiment discloses a method as described in the fifty-seventh or fifty-eighth embodiment, further comprising the step c) of deprotecting the oligonucleotide of formula (IV) or a salt thereof to form an oligonucleotide of formula (V) or a salt thereof:

[0427]

[0428] The fifty-ninth embodiment also provides a method as described in the fifty-seventh or fifty-eighth embodiment, further comprising the step b): a ) or a salt thereof is deprotected to form the oligonucleotide of formula (V a ) or a salt thereof:

[0429]

[0430] A sixtieth embodiment discloses the method of the fifty-ninth embodiment, further comprising:

[0431] d) reacting an oligonucleotide of formula (V) or a salt thereof with an oligonucleotide fragment of formula (II') or a salt thereof:

[0432]

[0433] coupled to form an oligonucleotide of formula (VI) or a salt thereof:

[0434]

[0435] e) sulfiding or oxidizing the oligonucleotide of formula (VI) to form the oligonucleotide of formula (VII) or a salt thereof:

[0436]

[0437] f) deprotecting the oligonucleotide of formula (VII) or a salt thereof to form the oligonucleotide of formula (VIII) or a salt thereof:

[0438]

[0439] g) repeating steps d), e) and f) r-1 times, and then repeating steps d) and e) to form an oligonucleotide of formula (IX) or a salt thereof:

[0440]

[0441] in:

[0442] r is an integer from 1 to 50;

[0443] p i is independently at each occurrence an integer from 2 to 20,

[0444] i is an integer from 1 to r; and

[0445]

[0446] The sixty-first embodiment discloses the method as described in the sixtieth embodiment, wherein r is 2 and the oligonucleotide of formula (IX) is represented by formula (X):

[0447]

[0448] wherein p1 and p2 are each independently an integer from 2 to 20. In certain embodiments, m, n, p1 and p2 are each independently an integer from 3 to 10, from 3 to 6, or from 4 to 6. In certain embodiments, m, n, p1 and p2 are each independently 4 or 5. In certain embodiments, m and n are both 5; and p1 and p2 are both 4.

[0449] A sixty-second embodiment discloses the method of any of the fifty-seventh to sixty-first embodiments, wherein chromatography (eg, column chromatography) is not used to purify the reaction product of any of steps a), b), c), d), e), f), and g).

[0450] The sixty-third embodiment discloses the method described in embodiments fifty-seven to sixty-second, wherein the reaction product of any one of steps a), b), c), d), e), f) and g) is purified by extraction and / or selective precipitation as described herein (e.g., as described in the twenty-first, thirty-fifth, forty-second, forty-sixth and forty-seventh embodiments).

[0451] In certain embodiments, for the method of embodiments 60 to 63, the method further comprises the following steps:

[0452] h1) deprotecting oligonucleotide (IX) or (X) to form an oligonucleotide of formula (IXA) or (XA):

[0453]

[0454] or a salt thereof.

[0455] In certain embodiments, for the method of embodiments 60 to 63, the method further comprises the following steps:

[0456] h1) deprotecting the oligonucleotide (IX) or (X) or a salt thereof to form an oligonucleotide of formula (IXA) or (XA):

[0457]

[0458]

[0459] or its salts;

[0460] h2) deprotecting the oligonucleotide (IXA) or (XA) or a salt thereof to form an oligonucleotide of formula (IXB) or (XB):

[0461]

[0462] or a salt thereof.

[0463] In certain embodiments, for step h1) above, the oligonucleotide of formula (IXA) or (XA) is obtained by reacting the oligonucleotide of formula (IX) or (X) with NH4OH. In certain embodiments, the treatment with NH4OH also removes other protecting groups in the oligonucleotide, such as protecting groups in any nucleobase (e.g., NH2 protecting groups on nucleobases). In certain embodiments, the treatment with NH4OH produces an oligonucleotide of formula (IXA) or (XA) or a salt thereof, wherein R 1 is independently at each occurrence a nucleobase, wherein the NH2 of the nucleobase, if present, is unprotected.

[0464] In the sixty-fourth embodiment, for the method of any of the sixtieth to sixty-third embodiments, wherein when R 16 When -CH2CH2CN, deprotection of oligonucleotide (IX) or (X) or a salt thereof forms an oligonucleotide of formula (IXAb) or (XAb):

[0465]

[0466] or a salt thereof. In certain embodiments, the deprotection reaction is carried out by reacting the oligonucleotide (IX) or (X) or a salt thereof with NH4OH to form an oligonucleotide of formula (IXAb) or (XAb). In certain embodiments, the treatment with NH4OH also removes other protecting groups in the oligonucleotide, such as the protecting groups in any core base (e.g., NH2 protecting groups on the core base). In certain embodiments, the treatment with NH4OH produces an oligonucleotide of formula (IXAb) or (XAb) or a salt thereof, wherein R1 is independently a core base at each occurrence, wherein the NH2 of the core base (if present) is unprotected.

[0467] In certain embodiments, in the method described in the sixty-fourth embodiment, the method further comprises the following steps:

[0468] The oligonucleotide (IXAb) or (XAb) or a salt thereof is deprotected to form an oligonucleotide of formula (IXBa) or (XBa):

[0469]

[0470] In certain embodiments, oligonucleotide (IXA) or (XA) is reacted with citric acid to form an oligonucleotide of formula (IXBa) or (XBa).

[0471] In the sixty-fifth embodiment, in the method of any of the sixtieth to sixty-third embodiments, wherein R 16 is -CH2CH2CN, the method further comprising the following steps:

[0472] h1) deprotecting the oligonucleotide (IX) or (X) to form an oligonucleotide of formula (IXAa) or (XAa):

[0473]

[0474] or a salt thereof.

[0475] In certain embodiments, in the method of the sixty-fifth embodiment, the deprotection reaction is carried out by reacting oligonucleotide (IX) or (X) or a salt thereof with a base. In certain embodiments, the base is selected from 1,8-diazabicyclo[5.4.0]undec-7-ene, alkylamines (e.g., tert-butylamine, sec-butylamine, diisopropylethylamine, trimethylamine) and other suitable organic bases.

[0476] The sixty-sixth embodiment discloses the method according to the sixty-fifth embodiment, wherein the method further comprises the step of deprotecting the oligonucleotide (IXAa) or (XAa) or a salt thereof to form an oligonucleotide of formula (IXAb) or (XAb):

[0477]

[0478] or a salt thereof.

[0479] In certain embodiments, in the method described in the sixty-sixth embodiment, deprotection of the oligonucleotide (IXAa) or (XAa) or a salt thereof is carried out by reacting the oligonucleotide (IXAa) or (XAa) or a salt thereof with NH4OH. In certain embodiments, treatment with NH4OH also removes other protecting groups in the oligonucleotide, such as protecting groups in any nucleobase (e.g., NH2 protecting groups on nucleobases). In certain embodiments, treatment with NH4OH produces an oligonucleotide of formula (IXAb) or (XAb) or a salt thereof, wherein R 1 is independently at each occurrence a nucleobase, wherein the NH2 of the nucleobase, if present, is unprotected.

[0480] In certain embodiments, the oligonucleotide (IXAb) or (XAb) or a salt thereof can be further reacted with a deprotecting agent (eg, a detritylation agent) to form an oligonucleotide of formula (IXBa) or (XBa) or a salt thereof.

[0481] In one embodiment, for the method described in the sixth aspect or any embodiment described therein (e.g., the fifty-seventh to sixty-sixth embodiments), Y is:

[0482]

[0483] In certain embodiments, the oligonucleotide of formula (IXA) or (XA) or the oligonucleotide of formula (IXAb) or (XAb) obtained from step h1) is purified by depth filtration. In one embodiment, the reaction mixture of step h1) is diluted with ammonium sulfate solution before depth filtration. Dilution with ammonium sulfate can prevent the oligonucleotide from sticking to the filter.

[0484] In certain embodiments, the concentration of the ammonium sulfate solution is between 100 mM and 5 M, between 500 mM and 2 M, between 500 mM and 1500 mM, or between 1000 mM and 1200 mM.

[0485] Any suitable depth filter can be used for depth filtration. As used herein, the term "depth filter" refers to a filter that uses a porous filter medium to retain particles that pass through the medium rather than just on the surface of the medium. These filters are typically used when the fluid to be filtered contains a large number of particles because they can retain a large number of particles before clogging compared to other types of filters. Surprisingly, it has been found that depth filtration can effectively remove the by-product LHPG-OH (e.g., γ-OH) from the reaction mixture, and then the mixture is subjected to HIC purification.

[0486] In certain embodiments, the depth filter comprises filter aids such as diatomaceous earth, cellulose, polyacrylic fiber, and silica, as well as activated carbon.

[0487] In certain embodiments, the oligonucleotide of Formula (IXA), (IXAb), (XA) or (XAb) obtained from step h1) is purified by depth filtration followed by hydrophobic interaction chromatography (HIC).

[0488] In certain embodiments, for step h2) above, an oligonucleotide of Formula (IXA), (IXAa), (IXAb), (XA), (XAa), or (XAb) is reacted with a detritylation agent as described herein to form an oligonucleotide of Formula (IXB), (IXBa), (XB), or (XBa). In one embodiment, the detritylation agent is an organic acid. In one embodiment, the organic acid is acetic acid or citric acid. In a specific embodiment, the detritylation agent is citric acid. In one embodiment, R in Formula (IXA), (IXAa), (IXAb), (XA), (XAa), or (XAb) is 15 In certain embodiments, the detritylation reaction of step h2) is carried out in an aqueous solution.

[0489] In certain embodiments, the oligonucleotide of Formula (IXB), (IXBa), (XB) or (XBa) obtained from step h2) is purified by anion exchange chromatography.

[0490] The sixty-seventh embodiment discloses the method according to the fifty-seventh to sixty-sixth embodiments, wherein fragment (I) is obtained by the following steps:

[0491] 1) the compound of formula (I'A) or a salt thereof:

[0492]

[0493] Deprotection to form a compound of formula (IA) or a salt thereof:

[0494]

[0495] 2) reacting a compound of formula (IA) or a salt thereof with a compound of formula (A1) or a salt thereof:

[0496]

[0497] Reaction to form a compound of formula (IB) or a salt thereof:

[0498] and

[0499] 3) Sulfurizing or oxidizing the compound of formula (IB) or its salt with a sulfiding agent or an oxidizing agent to form a compound of formula (IC) or its salt:

[0500]

[0501] 4) deprotecting the compound of formula (IC) or a salt thereof to form a compound of formula (ID) or a salt thereof:

[0502]

[0503] 5) Starting from the compound of formula (ID), steps 2), 3) and 4) are repeated n-2 times to obtain a fragment of formula (I) or a salt thereof.

[0504] A sixty-eighth embodiment discloses the method of the sixty-seventh embodiment, wherein no chromatography (eg, column chromatography) is used to purify the reaction product of any of steps 1), 2), 3), 4), and 5).

[0505] The sixty-ninth embodiment discloses the method described in the sixty-seventh or sixty-eighth embodiment, wherein the reaction product of any one of steps 1), 2), 3), 4) and 5) is purified by extraction and / or selective precipitation as described herein (e.g., as described in the twenty-first, thirty-fifth, forty-second, forty-sixth or forty-seventh embodiment).

[0506] The seventieth embodiment discloses the method described in the fifty-seventh to sixty-ninth embodiments, wherein Y is represented by the following formula:

[0507]

[0508] Where X0 is C 1-10 Alkyl, wherein one or more CH2 groups are independently replaced by C(O), C(O)NH2, cycloalkyl or heterocyclyl; and X1 is C 1-25 Alkyl or C 1-25 In a particular embodiment, Y is represented by the formula:

[0509]

[0510] wherein p is an integer from 1 to 10; Het is a saturated heterocycle; and the remaining variables are as described above. In a more specific embodiment, Het is piperazine.

[0511] The seventy-first embodiment discloses the method of any of the fifty-seventh to sixty-ninth embodiments, wherein Y is:

[0512]

[0513] The seventy-second embodiment discloses the method according to the fifty-seventh to seventy-first embodiments, wherein the fragment of formula (II) is obtained by the following steps:

[0514] 1') the compound of formula (IIA') or a salt thereof:

[0515]

[0516] Deprotection to form a compound of formula (IIA) or a salt thereof:

[0517]

[0518] 2') reacting a compound of formula (IIA) or a salt thereof with a compound of formula (A2) or a salt thereof:

[0519]

[0520] Reaction to form a compound of formula (IIB) or a salt thereof:

[0521] and

[0522] 3') sulfiding or oxidizing the compound of formula (IIB) or its salt with a sulfiding agent or an oxidizing agent to form a compound of formula (IIC) or its salt:

[0523]

[0524] 4') deprotecting the compound of formula (IIC) or a salt thereof to form a compound of formula (IID) or a salt thereof:

[0525]

[0526] 5') when m is 3, starting from the compound of formula (IID) or a salt thereof, repeating steps 2') and 3') to form the compound of formula (IIE) or a salt thereof, or

[0527] When m is greater than 3, starting from the compound of formula (IID) or a salt thereof, steps 2'), 3') and 4') are repeated m-3 times, and then steps 2') and 3') are performed to form a compound of formula (IIE) or a salt thereof:

[0528]

[0529] 6') deprotecting the compound of formula (IIE) or a salt thereof to form a compound of formula (IIF) or a salt thereof:

[0530] and

[0531] 7') Compound (IIF) or its salt is reacted with phosphorodiamidite (R 16 O)P(NR17a R 17b )2 reaction to obtain a fragment of formula (II) or a salt thereof, wherein Z is a hydroxyl protecting group.

[0532] The seventy-third embodiment discloses the method of the seventy-second embodiment, wherein the fragment of formula (II) is not purified by chromatography before reacting with the fragment of formula (I).

[0533] The seventy-fourth embodiment discloses the method described in the seventy-second or seventy-third embodiment, wherein the reaction product of any one of steps 1'), 2'), 3'), 4'), 5'), 6') and 7') is purified by extraction and / or selective precipitation (for example, as described in the twenty-first, thirty-fifth, forty-second, forty-sixth or forty-seventh embodiment).

[0534] The seventy-fifth embodiment discloses the method according to the fifty-ninth to seventy-fourth embodiments, wherein the fragment of formula (II') is prepared by the following steps:

[0535] 1") the compound of formula (II'A') or a salt thereof:

[0536] Deprotection to form a compound of formula (II'A) or a salt thereof:

[0537]

[0538] 2″) the compound of formula (II'A) or its salt and the compound of formula (A2) or its salt:

[0539] Reaction to form a compound of formula (II'B) or a salt thereof:

[0540] and

[0541] 3") sulfiding or oxidizing the compound of formula (II'B) or its salt with a sulfiding agent or an oxidizing agent to form a compound of formula (II'C) or its salt:

[0542]

[0543] 4") deprotecting the compound of formula (II'C) or a salt thereof to form a compound of formula (II'D) or a salt thereof:

[0544]

[0545] 5") Starting from the compound of formula (II'D) or a salt thereof, steps 1'), 2') and 3') are repeated. i -2 times, followed by step 1') and step 2') to form a compound of formula (II'E) or a salt thereof:

[0546]

[0547] 6") deprotecting the compound of formula (II'E) or a salt thereof to form a compound of formula (II'F) or a salt thereof:

[0548]

[0549] 7”) Compound (II'F) or its salt is reacted with phosphorodiamidite (R 16 O)P(NR 17a R 17b )2 reaction to obtain a fragment of formula (II') or a salt thereof, wherein Z is a hydroxyl protecting group.

[0550] The seventy-sixth embodiment discloses the method of the seventy-fifth embodiment, wherein the fragment of formula (II') is not purified by chromatography (column chromatography) before reacting with the oligonucleotide of formula (V).

[0551] The seventy-seventh embodiment discloses the method described in the seventy-fifth or seventy-sixth embodiment, wherein the reaction product of any one of steps 1"), 2"), 3"), 4"), 5"), 6"), and 7") is purified by extraction and / or selective precipitation as described herein (e.g., as described in the twenty-first, thirty-fifth, forty-second, forty-sixth, or forty-seventh embodiment).

[0552] The seventy-eighth embodiment discloses the method of any one of the fifty-seventh to seventy-seventh embodiments, wherein n is 3, 4, 5 or 6.

[0553] The seventy-ninth embodiment discloses the method of any one of the fifty-seventh to seventy-eighth embodiments, wherein m is 3, 4, 5 or 6.

[0554] An eightieth embodiment discloses the method of any one of the fifty-ninth to seventy-ninth embodiments, wherein p i Each occurrence is independently 3, 4, 5, or 6.

[0555] The eighty-first embodiment discloses the method of any one of the sixtieth to seventy-ninth embodiments, wherein p1 and p2 are each independently 3, 4, 5 or 6.

[0556] The eighty-second embodiment discloses the method of any one of the sixtieth to eighty-first embodiments, wherein r is 1, 2, 3, 4, 5 or 6.

[0557] In some embodiments, the deprotection reaction or detritylation reaction of steps c), f), 1), 4), 1'), 4'), 1"), and 4") is performed as described in the first aspect or any embodiment described therein (e.g., the second to twelfth embodiments).

[0558] In some embodiments, the coupling reactions of steps a), d), 2), 2') and 2") can be performed by adding an activating agent to an organic solution containing a 3'-OH protected nucleotide fragment and a 5'-OH protected phosphoramidite or phosphonate fragment.

[0559] In some embodiments, the sulfurization reactions of steps b), e), 3), 3') and 3") can be carried out using a sulfurizing agent such as 3-amino-1,2,4-dithiazole-5-thione (XH or ADTT), 3-(N,N-dimethylamino-methylene)amino)-3H-1,2,4-dithiazole (DDTT), phenylacetyl disulfide (PADS), 3H-1,2-benzodithiol-3-one 1,1-dioxide (Beaucage reagent) or phenyl-3H-1,2,4-dithiazol-3-one (POS). In a specific embodiment, the sulfurizing agent is DDTT. In certain embodiments, the base is pyridine or imidazole.

[0560] In certain embodiments, the oxidation reactions of steps b), e), 3), 3') and 3") can be carried out using standard oxidizing agents known in the literature. Exemplary oxidizing agents include, but are not limited to, tert-butyl hydroperoxide (t-BuOOH), (1S)-(+)-(10-camphorsulfonyl)oxaziridine (CSO), I2, and iodine-pyridine-water oxidant solution. In a specific embodiment, the oxidizing agent is t-BuOOH.

[0561] In some embodiments, the deprotection reaction of step 6′) or 6″) is as described in the second aspect or any embodiment described therein (eg, the twenty-third to thirty-first embodiments).

[0562] In some embodiments, the phosphitylation reaction of step 7′) or 7″) is as described in the third aspect or any embodiment described therein (eg, the thirty-fifth to thirty-eighth embodiments).

[0563] ii) 5'-3' extension:

[0564] In a seventh aspect, the present disclosure describes a liquid phase convergence synthesis of a target oligonucleotide, wherein the target oligonucleotide is assembled in the direction of the 5'-end to the 3'-end (5'-3' direction). It has been demonstrated that the 5'-3' direction convergence liquid phase method disclosed herein is successfully used to synthesize target oligonucleotides. In addition, highly purified protected target oligonucleotides can be obtained by the disclosed method without the need for chromatographic purification.

[0565] In certain embodiments, the convergent liquid phase method described herein includes gradually adding oligonucleotide fragments in the liquid (solution) phase to synthesize target oligonucleotides. For example, a 5-mer fragment (5'-LHPG) (5'-end fragment) with a 5'-hydrophobic hydroxyl protecting group is first coupled with a 5-mer fragment to form a 10-mer fragment with a 5'-LHPG group, and then the 10-mer fragment is further reacted with another 5-mer fragment to form a 15-mer oligonucleotide. In certain embodiments, a 5'-end fragment with n nucleotides (e.g., a 5-mer fragment) is synthesized by coupling a single nucleotide with a 5'-LHPG group to a fragment with n-1 nucleotides (e.g., a 4-mer fragment).

[0566] The eighty-third embodiment discloses a convergent liquid phase method for preparing a target oligonucleotide, comprising the steps of:

[0567] a) making an oligonucleotide fragment of formula (II2) or a salt thereof:

[0568]

[0569] and an oligonucleotide fragment of formula (I2) or a salt thereof:

[0570]

[0571] The coupling is carried out in solution to form an oligonucleotide of formula (III2) or a salt thereof:

[0572]

[0573] and

[0574] b) sulfurizing or oxidizing the oligonucleotide of formula (III2) or a salt thereof to form the oligonucleotide of formula (IV2) or a salt thereof:

[0575] in:

[0576] R 1 is independently at each occurrence a nucleobase, wherein the NH2 of the nucleobase (if present) is protected by an amine protecting group;

[0577] R 2 In each occurrence, independently selected from the group consisting of H, halo, and optionally C 1-6 Alkoxy-substituted C 1-6 a group consisting of alkoxy groups;

[0578] R 4 Each occurrence is independently H or R 2 The alkoxy groups form a ring;

[0579] R 16C independently at each occurrence 1-6 Alkyl, C 2-6 alkenyl, phenyl or benzyl, each of which is optionally substituted with -CN, -NO2 or halogen; or

[0580] R 16 for

[0581] R 17a and R 17b Independently C 1-6 alkyl;

[0582] n1 is an integer from 2 to 20;

[0583] m1 is an integer from 2 to 200;

[0584] X is independently O or S at each occurrence;

[0585] Y is a hydrophobic hydroxyl protecting group containing an alkyl chain;

[0586] Z is a silylhydroxy protecting group.

[0587] The eighty-fourth embodiment discloses the method according to the eighty-third embodiment, wherein fragment (II2) is prepared by the following steps:

[0588] ia) making a nucleotide of formula (II2a1) or a salt thereof:

[0589]

[0590] and an oligonucleotide fragment of formula (II2a2) or a salt thereof:

[0591]

[0592] The coupling is carried out in solution to form an oligonucleotide of formula (II2a3) or a salt thereof:

[0593]

[0594] iia) sulfurizing or oxidizing the oligonucleotide of formula (II2a3) or a salt thereof to form the oligonucleotide of formula (II2a4) or a salt thereof:

[0595]

[0596] iia) deprotecting the oligonucleotide of formula (II2a4) or a salt thereof to form the oligonucleotide of formula (II2) or a salt thereof.

[0597] The eighty-fifth embodiment discloses the method of the eighty-fourth embodiment, wherein fragment (II2a2) is obtained by reacting an oligonucleotide of formula (II2a5) or a salt thereof:

[0598]

[0599] With phosphoramidite (R 16 O)P(NR 17a R 17b )2 is reacted to form compound (II2a2).

[0600] The eighty-sixth embodiment discloses the method according to the eighty-fifth embodiment, wherein the oligonucleotide of formula (II2a3) is obtained by the following steps:

[0601] iA) a compound of formula (II2A') or a salt thereof:

[0602]

[0603] Deprotection to form a compound of formula (II2A) or a salt thereof:

[0604]

[0605] iiA) reacting a compound of formula (II2A) or a salt thereof with a compound of formula (A12) or a salt thereof:

[0606]

[0607] Reaction to form a compound of formula (II2B) or a salt thereof:

[0608] and

[0609] iiiA) sulfiding or oxidizing the compound of formula (II2B) or a salt thereof with a sulfiding agent or an oxidizing agent to form a compound of formula (II2C) or a salt thereof:

[0610]

[0611] ivA) deprotecting the compound of formula (II2C) or a salt thereof to form a compound of formula (IID) or a salt thereof:

[0612]

[0613] vA) When m1 is greater than 3, starting from the compound of formula (IID), repeating steps m1-3 times of ii), iii) and iv) to form the compound of formula (II2a3) or a salt thereof.

[0614] In certain embodiments, in the methods disclosed in any one of the eighty-fourth to eighty-sixth embodiments, m1 is an integer from 3 to 20. In a specific embodiment, m1 is from 3 to 6. In another specific embodiment, m1 is 4. In yet another specific embodiment, m1 is 5.

[0615] The eighty-seventh embodiment discloses a method as described in the seventh aspect or any one of the eighty-third to eighty-sixth embodiments, wherein fragment (I2) is obtained by treating an oligonucleotide of formula (I2a1) or a salt thereof:

[0616]

[0617] With phosphoramidite (R 16 O)P(NR 17a R 17b )2 is reacted to form a fragment of formula (I2).

[0618] The eighty-eighth embodiment discloses the method as described in the eighty-seventh embodiment, wherein the oligonucleotide of formula (I2a1) is obtained by the following steps:

[0619] i') a compound of formula (I2A') or a salt thereof:

[0620]

[0621] Deprotection to form a compound of formula (I2A) or a salt thereof:

[0622]

[0623] ii') reacting a compound of formula (I2A) or a salt thereof with a compound of formula (A11) or a salt thereof:

[0624]

[0625] Reaction to form a compound of formula (I2B) or a salt thereof:

[0626] and

[0627] iii') sulfiding or oxidizing the compound of formula (I2B) or its salt with a sulfiding agent or an oxidizing agent to form a compound of formula (I2C) or its salt:

[0628]

[0629] iv') deprotecting the compound of formula (I2C) or a salt thereof to form a compound of formula (I2D) or a salt thereof:

[0630]

[0631] v') when n1 is greater than 2, starting from the compound of formula (I2D), repeating steps ii'), iii') and iv') n1-2 times to form the compound of formula (I2a1) or a salt thereof.

[0632] The eighty-ninth embodiment discloses a method as described in the eighty-third to eighty-eighth embodiments, further comprising the step c): deprotecting the oligonucleotide of formula (IV2) or a salt thereof to form an oligonucleotide of formula (V2) or a salt thereof:

[0633]

[0634] The ninetieth embodiment discloses the method as described in the eighty-ninth embodiment, further comprising:

[0635] d) reacting an oligonucleotide of formula (V2) or a salt thereof with an oligonucleotide fragment of formula (II2') or a salt thereof

[0636]

[0637] coupling to form an oligonucleotide of formula (VI2) or a salt thereof:

[0638]

[0639] e) sulfurizing or oxidizing the oligonucleotide of formula (VI2) to form the oligonucleotide of formula (VII2) or a salt thereof:

[0640]

[0641] f) deprotecting the oligonucleotide of formula (VII2) or a salt thereof to form the oligonucleotide of formula (VIII2) or a salt thereof:

[0642]

[0643] g) repeating steps d), e) and f) r1-1 times, followed by repeating steps d) and e) to form an oligonucleotide of formula (IX2) or a salt thereof:

[0644]

[0645] in:

[0646] r1 is an integer from 1 to 50;

[0647] s i is independently at each occurrence an integer from 2 to 20,

[0648] i is an integer from 1 to r1; and

[0649]

[0650] The ninety-first embodiment discloses the method as described in the ninetieth embodiment, wherein r1 is 2 and the oligonucleotide of formula (IX2) is represented by formula (X2) or a salt thereof:

[0651]

[0652] wherein s1 and s2 are each independently an integer from 2 to 20.

[0653] The ninety-second embodiment discloses the method as described in the ninetieth embodiment, wherein r1 is 1 and the oligonucleotide of formula (IX2) is represented by formula (X2') or a salt thereof:

[0654]

[0655] Wherein s1 is an integer from 2 to 20.

[0656] In certain embodiments, for the method of the ninety-first or ninety-second embodiment, s1, s2, m1, and n1 are each independently an integer from 3 to 10, from 3 to 6, or from 4 to 6. In certain embodiments, s1, s2, m1, and n1 are each independently 4 or 5.

[0657] The ninety-third embodiment discloses a method as described in the ninetieth, ninety-first or ninety-second embodiment, wherein the oligonucleotide fragment of formula (II2′) is prepared by reacting an oligonucleotide of formula (II2a1′) or a salt thereof:

[0658]

[0659] With phosphoramidite (R 16 O)P(NR 17a R 17b )2 to form a fragment of formula (II2') or a salt thereof.

[0660] The ninety-fourth embodiment discloses the method as described in the ninety-third embodiment, wherein the oligonucleotide of formula (II2a1′) is obtained by the following steps:

[0661] i") a compound of formula (II'2A') or a salt thereof:

[0662]

[0663] Deprotection to form a compound of formula (II'2A) or a salt thereof:

[0664]

[0665] ii") reacting a compound of formula (II'2A) or a salt thereof with a compound of formula (A12') or a salt thereof:

[0666]

[0667] Reaction to form a compound of formula (II'2B) or a salt thereof:

[0668] and

[0669] iii") sulfiding or oxidizing the compound of formula (II'2B) or its salt with a sulfiding agent or an oxidizing agent to form the compound of formula (II'2C) or its salt:

[0670]

[0671] iv") deprotecting the compound of formula (II'2C) or a salt thereof to form a compound of formula (II'2D) or a salt thereof:

[0672]

[0673] v”) when s i When the amount is greater than 2, starting from compound (II'2D), repeat steps ii"), iii") and iv")s i -2 times to form the compound of formula (II2a1′) or a salt thereof.

[0674] A ninety-fifth embodiment discloses a method as described in the eighty-third to ninety-fourth embodiments, wherein no chromatography is used to purify the reaction product of any of steps a), b), c), d), e), f), and g).

[0675] The ninety-sixth embodiment discloses a method as described in the eighty-third to ninety-fourth embodiments, wherein the reaction product of any of steps a), b), c), d), e), f) and g) is purified by extraction and / or selective precipitation as described herein (e.g., as described in the twenty-first, thirty-fifth, forty-second, forty-sixth or forty-seventh embodiment).

[0676] The ninety-seventh embodiment discloses a method as described in the ninetieth to ninety-sixth embodiments, wherein the method further comprises deprotecting the oligonucleotide of formula (IX2), (X2) or (X2′) or a salt thereof to form an oligonucleotide of formula (IX2A), (X2A) or (X2A′) or a salt thereof:

[0677]

[0678] In certain embodiments, Z is a group selected from TBDPS, ToBDPS and TBDAS in formula (IX2), (X2) or (X2'). In certain embodiments, the deprotection reaction is performed as described in the second aspect or any embodiment described therein (eg, in the twenty-sixth to thirty-second embodiments).

[0679] The ninety-eighth embodiment discloses a method as described in any one of the eighty-third to ninety-seventh embodiments, wherein when R 16When -CH2CH2CN, the method further comprises the following steps:

[0680] h1) deprotecting the oligonucleotide (IX2A), (X2A) or (X2A') or a salt thereof to form an oligonucleotide of formula (IX2Aa), (X2Aa) or (X2Aa'):

[0681]

[0682] or a salt thereof.

[0683] The ninety-ninth embodiment discloses the method as described in the ninety-eighth embodiment, wherein the deprotection reaction is carried out by reacting the oligonucleotide (IX2A), (X2A) or (X2A') or a salt thereof with a base. In certain embodiments, the base is selected from 1,8-diazabicyclo[5.4.0]undec-7-ene, alkylamines (e.g., tert-butylamine, sec-butylamine, diisopropylethylamine and triethylamine) and other suitable organic bases.

[0684] The 100th embodiment discloses a method as described in the ninety-eighth or ninety-ninth embodiment, wherein the method further comprises the step of: deprotecting the oligonucleotide (IX2Aa), (X2Aa) or (X2Aa') or a salt thereof to form an oligonucleotide of formula (IX2B), (X2B) or (X2B'):

[0685]

[0686] or a salt thereof.

[0687] The 101st embodiment discloses a method as described in the 100th embodiment, wherein the deprotection is carried out by reacting the oligonucleotide (IX2Aa) or (X2Aa) or a salt thereof with NH4OH. In certain embodiments, the treatment with NH4OH also removes other protecting groups in the oligonucleotide, such as protecting groups in any nucleobase (e.g., NH2 protecting groups on nucleobases). In certain embodiments, the treatment with NH4OH produces an oligonucleotide of formula (IX2B), (X2B) or (X2B') or a salt thereof, wherein R 1 Each occurrence is independently a nucleobase, wherein the NH2 of the nucleobase (if present) is unprotected.

[0688] The 102nd embodiment discloses a method as described in any one of the 83rd to 101st embodiments, wherein n1 is 3, 4, 5 or 6.

[0689] The 103rd embodiment discloses a method as described in any one of the 90th to 101st embodiments, wherein s i is independently 3, 4, 5 or 6 at each occurrence.

[0690] The 104th embodiment discloses a method as described in any one of the 91st to 101st embodiments, wherein s1 and s2 ae are each independently 3, 4, 5 or 6.

[0691] The 105th embodiment discloses a method as described in any one of the 83rd to 101st embodiments, wherein r1 is 1, 2, 3, 4, 5 or 6.

[0692] The 106th embodiment discloses a method as described in any one of the first to 105th embodiments, wherein all P═X groups in the compound or oligonucleotide are P═S.

[0693] The 107th embodiment discloses a method as described in any one of the first to 105th embodiments, wherein all P═X groups in the compound or oligonucleotide are P═O.

[0694] The 108th embodiment discloses a method as described in any one of the first to 105th embodiments, wherein greater than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the P═X groups in the compound or oligonucleotide are P═S.

[0695] The 109th embodiment discloses a method as described in any one of the first to 105th embodiments, wherein 10-90%, 20-80%, 30-70% or 40-60% of the P═X groups in the compound or oligonucleotide are P═S.

[0696] The 110th embodiment discloses a method as described in any one of the first to 105th embodiments, wherein 10-90%, 20-80%, 30-70% or 40-60% of the P═X groups in the compound or oligonucleotide are P═O.

[0697] In some embodiments, the deprotection reaction of steps iia), c) and f) of any one of the eighty-fourth to ninetieth and ninety-sixth embodiments can be carried out as described in the first aspect or any embodiment described therein (e.g., the twenty-sixth to thirty-fourth embodiments).

[0698] In some embodiments, the deprotection steps of iA), ivA), i'), iv'), i"), and iv") of the seventh aspect can be performed as described in the first aspect or any embodiment described therein (eg, the second to twelfth embodiments).

[0699] In some embodiments, the coupling reactions of steps a), ia), ii), iiA), ii'), d), and ii") can be performed by adding an activating agent to an organic solution containing a 3'-OH protected nucleotide fragment and a 5'-OH protected phosphoramidite or phosphonate fragment.

[0700] In some embodiments, the sulfurization reactions of steps b), iii), iiiA), iii'), e) and iii") can be carried out using a sulfurizing agent (e.g., 3-amino-1,2,4-dithiazole-5-thione (XH or ADTT), 3-(N,N-dimethylamino-methylene)amino)-3H-1,2,4-dithiazole (DDTT), phenylacetyl disulfide (PADS), 3H-1,2-benzodithiol-3-one 1,1-dioxide (Beaucage reagent) or phenyl-3H-1,2,4-dithiazol-3-one (POS). In a specific embodiment, the sulfurizing agent is DDTT. In certain embodiments, the base is pyridine or imidazole.

[0701] In certain embodiments, the oxidation reactions of steps b), iii), iiiA), iii') e), and iii") can be carried out using standard oxidizing agents known in the literature. Exemplary oxidizing agents include, but are not limited to, tert-butyl hydroperoxide (t-BuOOH), (1S)-(+)-(10-camphorsulfonyl)oxaziridine (CSO), I2, and iodine-pyridine-water oxidant solution. In a specific embodiment, the oxidizing agent is t-BuOOH.

[0702] In some embodiments, the phosphitylation reactions of the eighty-fifth, eighty-seventh, and ninety-second embodiments can be performed as described in the third aspect or any embodiment described therein (eg, the thirty-ninth to forty-second embodiments).

[0703] In one embodiment, Y is:

[0704]

[0705] In certain embodiments, the oligonucleotide of formula (IX2B), (X2B) or (X2B') obtained from the deprotection reaction is purified by depth filtration. In one embodiment, the reaction mixture of the deprotection reaction is diluted with ammonium sulfate solution before performing depth filtration. Dilution with ammonium sulfate can prevent the oligonucleotide from sticking to the filter.

[0706] In certain embodiments, the concentration of the ammonium sulfate solution is between 100 mM and 5 M, between 500 mM and 2 M, between 500 mM and 1500 mM, or between 1000 mM and 1200 mM.

[0707] Any suitable depth filter can be used for depth filtration, such as the suitable depth filters described herein.

[0708] In certain embodiments, oligonucleotides of Formula (IX2A), (IX2Aa), (IX2Aa'), (X2A), (X2A'), (X2Aa), (X2Aa'), (X2B), or (X2B') can be purified by depth filtration followed by hydrophobic interaction chromatography (HIC).

[0709] In certain embodiments, any reaction described in the first to eighth aspects or any embodiment described therein (e.g., the first to the 135th embodiment) can be carried out in a suitable solvent or a mixture of suitable solvents. In certain embodiments, the reaction can be carried out in a suitable organic solvent or a mixture of suitable organic solvents. Exemplary organic solvents that can be used in the present disclosure include but are not limited to dichloromethane (DCM), acetonitrile (ACN), tetrahydrofuran (THF), acetone, 2-methyltetrahydrofuran, methyl tert-butyl ether, ethyl acetate, etc.

[0710] In certain embodiments, any reaction described in the first to eighth aspects or any embodiment described therein (e.g., the first to the 135th embodiment) can be carried out at a suitable temperature. In certain embodiments, the reaction is carried out at room temperature. In certain embodiments, the reaction is carried out at a temperature between 20°C and 30°C. In certain embodiments, the reaction is carried out at a temperature between -10°C and 10°C, -5°C and 5°C. In certain embodiments, the reaction is carried out at 25±2°C. In certain embodiments, the reaction is carried out at 0±2°C.

[0711] The 111th embodiment discloses a method according to any one of the embodiments described herein (e.g., the first to 135th embodiments), wherein the nucleobase is selected from the group consisting of cytosine, guanine, adenine, thymine, uracil, hypoxanthine, xanthine, 7-methylguanine, 5,6-dihydrouracil, 5-methylcytosine and 5-hydroxymethylcytosine, wherein the NH2 group of the nucleobase, if present, is protected by PhCO-, CH3CO-, iPrCO-, Me2N-CH= or Me2N-CMe=.

[0712] The 112th embodiment discloses a method according to any one of the embodiments described herein (e.g., the first to 135th embodiments), wherein R 1 Selected from the group consisting of cytosine, guanine, adenine, thymine, uracil and 5-methylcytosine, wherein the NH2 group of the nucleobase (if present) is protected by PhCO-, CH3CO-, iPrCO-, Me2N-CH= or Me2N-CMe=.

[0713] The 113th embodiment discloses a method according to any one of the embodiments described herein (e.g., the first to 135th embodiments), wherein:

[0714] Each R 2 Independently selected from H, F and optionally C 1-4 Alkoxy-substituted C 1-4 a group consisting of alkoxy groups;

[0715] Each R 4 independently H or with R 2 The alkoxy group forms a ring, wherein the ring is optionally substituted by 1 to 3 C 1-4 an alkyl-substituted 5- or 6-membered ring;

[0716] R 16 is -CH2CH2CN; and

[0717] R 17a and R 17b Independently C 1-4 alkyl.

[0718] In a specific embodiment, the method is the method according to embodiment 113, wherein:

[0719] Each R 2 are independently H or -OCH2CH2OMe;

[0720] Each R 4 is H;

[0721] R 16 is -CH2CH2CN; and

[0722] R 17a and R 17b Both are -CH(CH3)2.

[0723] The 114th embodiment discloses a method as described in any one of the 51st to 135th embodiments, wherein the target oligonucleotide is an antisense oligonucleotide comprising 16 to 30 nucleotides.

[0724] The 115th embodiment discloses the method of the 114th embodiment, wherein the antisense oligonucleotide comprises only modified RNA.

[0725] The 116th embodiment discloses the method of the 114th embodiment, wherein the antisense oligonucleotide comprises DNA and modified RNA.

[0726] The 117th embodiment discloses the method of the 114th embodiment, wherein the antisense oligonucleotide is a gapmer.

[0727] The 118th embodiment discloses the method of the 114th embodiment, wherein the antisense oligonucleotide comprises only DNA.

[0728] In certain embodiments, the compounds described herein have a 5'-DMT group (denoted by R 15 The target oligonucleotide (denoted by ) is purified by chromatography (eg, hydrophobic interaction chromatography (HIC)) and then subjected to a detritylation reaction to remove the 5'-DMT group.

[0729] III. Synthesis of Oligonucleotides with Chiral Phosphorothioate Bonds

[0730] In an eighth aspect, the present disclosure describes a liquid phase method (KW Knouse, JN de Gruyter, MA Schmidt, et al. Science, Vol. 361, No. 6408, pp. 1234-1238 (2018)) for synthesizing stereospecific oligonucleotides using P(V)-PSI reagents. Linearly synthesized oligonucleotide fragments can be combined using the liquid phase convergent synthesis method described herein to produce stereoselective target oligonucleotides (e.g., antisense oligonucleotides (ASOs)).

[0731] The 119th embodiment discloses a liquid phase method for preparing an oligonucleotide of formula (PI1) or (PI2) or a salt thereof,

[0732]

[0733] It includes the following steps:

[0734] 1) making a compound of formula (PIB) or a salt thereof:

[0735]

[0736] and a compound of formula (PI1A) or (PI2A) or a salt thereof:

[0737]

[0738] Coupling to form a compound of formula (PI1C) or (PI2C) or a salt thereof:

[0739]

[0740] 2) deprotecting the compound of formula (PI1C) or (PI2C) or a salt thereof to form a compound of formula (PI1D) or (PI2D) or a salt thereof:

[0741]

[0742]

[0743] 3) Starting from the compound of formula (PI1D) or (PI2D) or a salt thereof, repeating steps 1) and 2) t-3 times, followed by step 1) to obtain formula (PI') or a salt thereof, wherein:

[0744] R 1 is independently at each occurrence a nucleobase, wherein the NH2 of the nucleobase (if present) is protected by an amine protecting group;

[0745] R 2 In each occurrence, independently selected from the group consisting of H, halo, and optionally C 1-6 Alkoxy-substituted C 1-6 a group consisting of alkoxy groups;

[0746] R 4 Each occurrence is independently H or R 2 The alkoxy groups form a ring;

[0747] R 15 is a hydroxyl protecting group;

[0748] t is an integer from 3 to 20; and

[0749] Z is a silylhydroxy protecting group.

[0750] In the 120th embodiment, for the method described in the 119th embodiment, the compound of formula (PI1A) is prepared by the following procedure: making a compound of formula (PIA1) or a salt thereof:

[0751]

[0752] With the compound of formula (1):

[0753]

[0754] reacting to form a compound of formula (PI1A) or a salt thereof; and

[0755] The compound of formula (PI2A) is prepared by the following operation: a compound of formula (PIA1) or a salt thereof is reacted with a compound of formula (2):

[0756]

[0757] reacting to form a compound of formula (PI2A) or a salt thereof.

[0758] The 121st embodiment discloses a method as described in the method of the 119th or 120th embodiment, wherein the fragment of formula (PIB) is obtained by converting a compound of formula (PIB1) or a salt thereof into

[0759] Prepared by deprotection.

[0760] The 122nd embodiment discloses a method as described in the method of the 119th, 120th or 121st embodiment, wherein the coupling reaction of step 1) is carried out in the presence of a base. In certain embodiments, the base is selected from 8-diazabicyclo[5.4.0]undec-7-ene (DBU), alkylamines (e.g., tert-butylamine, sec-butylamine, diisopropylethylamine, trimethylamine, triethylamine, 2-methylpropan-2-amine, etc.) and other suitable organic bases. In a specific embodiment, the base is DBU.

[0761] In certain embodiments, the coupling reaction of step 1) is carried out in an anhydrous or substantially anhydrous solution in the presence of a base. In certain embodiments, the anhydrous or substantially anhydrous solution is obtained by removing water using azeotropic distillation prior to the reaction. In certain embodiments, the anhydrous or substantially anhydrous solution is obtained by adding a desiccant.

[0762] The 123rd embodiment discloses a method as described in the 122nd embodiment, wherein the coupling reaction is carried out in the presence of a base and a desiccant. Any suitable desiccant can be used. In some embodiments, the desiccant is selected from calcium chloride, potassium chloride, sodium sulfate, calcium sulfate, magnesium sulfate, and molecular sieves. In a specific embodiment, the desiccant is a molecular sieve.

[0763] In certain embodiments, the base is DBU and the drying agent is a molecular sieve. In a particular embodiment, the size of the molecular sieve is

[0764] The 124th embodiment discloses a method as described in any one of the 119th to 121st embodiments, wherein the deprotection reaction is carried out by reacting the compound with a detritylating agent. In certain embodiments, the detritylating agent is an organic acid. In certain embodiments, the detritylating agent is CF3COOH, CCl3COOH, CHCl2COOH, CH2ClCOOH, citric acid, methanesulfonic acid, benzenesulfonic acid, CClF2COOH, CHF2COOH or PhSO2H. In a specific embodiment, the detritylating agent is CHCl2COOH. In another preferred embodiment, the detritylating agent is citric acid.

[0765] The 125th embodiment discloses a method as described in any one of the 119th to 124th embodiments, wherein R 15 It is 4,4'-dimethoxytrityl.

[0766] The 126th embodiment discloses a method as described in any one of the 120th to 125th embodiments, wherein the reaction between the compound of formula (PIA1) and the compound of formula (1) or (2) is carried out in an anhydrous or substantially anhydrous solution in the presence of a base.

[0767] In certain embodiments, the anhydrous or substantially anhydrous solution is obtained by removing water using azeotropic distillation prior to the reaction. In certain embodiments, the anhydrous or substantially anhydrous solution is obtained by adding a desiccant.

[0768] In certain embodiments, the base is selected from 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU), alkylamines (e.g., tert-butylamine, sec-butylamine, diisopropylethylamine, trimethylamine, triethylamine, etc.) and other suitable organic bases. In a specific embodiment, the base is DBU.

[0769] The 127th embodiment discloses a method as described in any one of the 119th to 126th embodiments, wherein the method further comprises deprotecting the oligonucleotide of formula (PI1) or (PI2) or a salt thereof to form an oligonucleotide of formula (PI1') or (PI2') or a salt thereof:

[0770]

[0771] The 128th embodiment discloses the method as described in the 127th embodiment, wherein the silyl protecting group is selected from TBDPS, TBoDPS and TBDAS.

[0772]

[0773] wherein R5, R6 and R7 are each independently H, C 1-30 Alkyl or C 1-30 In a particular embodiment, Z is TBDPS.

[0774] The 129th embodiment discloses a method as described in the 128th embodiment, wherein the deprotection reaction is a reaction carried out by reacting an oligonucleotide of formula (PI1) or (PI2) or a salt thereof with a desilylation agent (e.g., as described in the second aspect or any embodiment described therein). In certain embodiments, the disilylation agent is tetra-n-butylammonium fluoride (TEAF).

[0775] The 130th embodiment discloses a method as described in any one of the 119th to 129th embodiments, wherein: each R 2 Independently selected from H, F or optionally C 1-4 Alkoxy-substituted C 1-4 Alkoxy; and R 4is H. In a particular embodiment, R 2 is H. In another specific embodiment, R 2 It is -OCH2CH2OCH3.

[0776] The 131st embodiment discloses a method as described in any one of the 119th to 130th embodiments, wherein Formula (PI1A), (PI2A), (PIB), (PI1C), (PI2C), (PI1D), (PI2D), (PI1), (PI2), (PI1') and / or (PI2') are purified by column chromatography.

[0777] The present disclosure also provides a convergent liquid phase method for preparing oligonucleotides, wherein at least a portion of the phosphorothioate linkages in the oligonucleotide are diastereospecific phosphorothioates.

[0778] The 132nd embodiment discloses a convergent liquid phase method for preparing oligonucleotides, comprising the steps of: making an oligonucleotide fragment of formula (P1F1) or (P2F2) or a salt thereof:

[0779]

[0780]

[0781] With an oligonucleotide of formula (P1F2) or (P2F2) or a salt thereof:

[0782]

[0783]

[0784] coupling to form an oligonucleotide of formula (PIII1) or (PIII2) or a salt thereof:

[0785]

[0786] in:

[0787] R 1 is independently at each occurrence a nucleobase, wherein the NH2 of the nucleobase (if present) is protected by an amine protecting group;

[0788] R 2 In each occurrence, independently selected from the group consisting of H, halo, and optionally C 1-6 Alkoxy-substituted C 1-6 a group consisting of alkoxy groups;

[0789] R 4 Each occurrence is independently H or R 2 The alkoxy groups form a ring;

[0790] R 15 is a hydroxyl protecting group;

[0791] X is independently O or S at each occurrence;

[0792] t1 is an integer from 3 to 20;

[0793] x1 is an integer from 3 to 20; and

[0794] Z is a silylhydroxy protecting group.

[0795] Specifically, the oligonucleotide of formula (PIII1) or a salt thereof is formed by a coupling reaction between an oligonucleotide fragment of formula (P1F1) or a salt thereof and an oligonucleotide of formula (P1F2) or a salt thereof. Similarly, the oligonucleotide of formula (PIII2) or a salt thereof is formed by a coupling reaction between an oligonucleotide fragment of formula (P2F1) or a salt thereof and an oligonucleotide of formula (P2F2) or a salt thereof.

[0796] In certain embodiments, the oligonucleotide of Formula (PIII1) or (PIII2) or a salt thereof is purified by chromatography.

[0797] The 133rd embodiment discloses a convergent liquid phase method for preparing oligonucleotides, comprising the steps of: making an oligonucleotide fragment of formula (P1F3) or (P2F3) or a salt thereof:

[0798]

[0799]

[0800] and an oligonucleotide fragment of formula (PF4) or a salt thereof:

[0801]

[0802] coupled to form an oligonucleotide of formula (PIV1) or (PIV2) or a salt thereof:

[0803]

[0804] in:

[0805] R 1 is independently at each occurrence a nucleobase, wherein the NH2 of the nucleobase (if present) is protected by an amine protecting group;

[0806] R 2 In each occurrence, independently selected from the group consisting of H, halo, and optionally C 1-6 Alkoxy-substituted C 1-6 a group consisting of alkoxy groups;

[0807] R 4 Each occurrence is independently H or R 2 The alkoxy groups form a ring;

[0808] R 15 is a hydroxyl protecting group;

[0809] X is independently O or S at each occurrence

[0810] t2 is an integer from 3 to 20;

[0811] x2 is an integer from 3 to 20; and

[0812] Z is a silylhydroxy protecting group.

[0813] Specifically, the oligonucleotide of formula (PIV1) or its salt is formed by a coupling reaction between an oligonucleotide fragment of formula (P1F3) or its salt and an oligonucleotide fragment of formula (PF4) or its salt. Similarly, the oligonucleotide of formula (PIV2) or its salt is formed by a coupling reaction between an oligonucleotide fragment of formula (P2F3) or its salt and an oligonucleotide fragment of formula (PF4) or its salt.

[0814] In certain embodiments, the oligonucleotide of Formula (PIV1) or (PIV2) or a salt thereof is purified by chromatography.

[0815] The 134th embodiment discloses a method as described in the 133rd embodiment, wherein the method further comprises the following steps:

[0816] a) deprotecting an oligonucleotide of formula (PIV1) or (PIV2) or a salt thereof to form an oligonucleotide of formula (PIV1′) or (PIV2′) or a salt thereof:

[0817]

[0818] and

[0819] b) reacting an oligonucleotide of formula (PIV1′) or (PIV2′) or a salt thereof with an oligonucleotide fragment of formula (P1F5) or (P2F5) or a salt thereof:

[0820]

[0821] coupling to form an oligonucleotide of formula (PV1) or (PV2) or a salt thereof:

[0822]

[0823] (PV2), where y1 is an integer from 3 to 20.

[0824] Specifically, the oligonucleotide of formula (PV1) or its salt is formed by a coupling reaction between the oligonucleotide of formula (PIV1') or its salt and the oligonucleotide fragment of formula (P1F5) or its salt. Similarly, the oligonucleotide of formula (PV2) or its salt is formed by a coupling reaction between the oligonucleotide of formula (PIV2') or its salt and the oligonucleotide fragment of formula (P2F5) or its salt.

[0825] In certain embodiments, the oligonucleotide of Formula (PIV1′) or (PIV2′) or a salt thereof and / or the oligonucleotide of Formula (PV1) or (PV2) or a salt thereof is purified by chromatography.

[0826] In certain embodiments, an oligonucleotide fragment of formula (P1F5) or (P2F5), or a salt thereof, is prepared by reacting an oligonucleotide fragment of formula (PF5a), or a salt thereof:

[0827]

[0828] It is prepared by reacting with a PSI reagent (i.e., a compound of formula (1) or (2) or a salt thereof).

[0829] In certain embodiments, an oligonucleotide of formula (PF5a) or a salt thereof is prepared by making an oligonucleotide of formula (PF5b) or a salt thereof:

[0830]

[0831] Prepared by reaction with a base, wherein R 16 =-CH2CH2CN. In certain embodiments, the base is selected from DBU, alkylamines (e.g., tert-butylamine, sec-butylamine, diisopropylethylamine, trimethylamine, triethylamine, 2-methylpropan-2-amine, etc.) and other suitable organic bases. In a specific embodiment, the base is triethylamine or 2-methylpropan-2-amine. In another specific embodiment, the base is triethylamine.

[0832] The 135th embodiment discloses a method as described in the 133rd embodiment, wherein the method further comprises the following steps:

[0833] a) deprotecting an oligonucleotide of formula (PIV1) or (PIV2) or a salt thereof to form an oligonucleotide of formula (PIV1′) or (PIV2′) or a salt thereof:

[0834]

[0835] b) reacting an oligonucleotide of formula (PIV1′) or (PIV2′) or a salt thereof with an oligonucleotide fragment of formula (P1F6) or (P2F6) or a salt thereof:

[0836]

[0837] coupling to form an oligonucleotide of formula (PVI1) or (PVI2) or a salt thereof:

[0838]

[0839] c) deprotecting the oligonucleotide of formula (PVI1) or (PIV2) or a salt thereof to form the oligonucleotide of formula (PVI1′) or (PVI2′) or a salt thereof:

[0840]

[0841] c) reacting an oligonucleotide of formula (PVI1′) or (PVI2′) or a salt thereof with an oligonucleotide of formula (P1F5) or (P2F5) or a salt thereof:

[0842]

[0843] coupling to form an oligonucleotide of formula (PVII1) or (PVII2) or a salt thereof:

[0844]

[0845] wherein y1 is an integer from 3 to 20; and z1 is an integer from 3 to 20.

[0846] Specifically, the oligonucleotide of formula (PVI1) or its salt is formed by the coupling reaction of the oligonucleotide of formula (PIV1') or its salt with the oligonucleotide fragment of formula (P1F6) or its salt, and the oligonucleotide of formula (PVII1) or its salt is formed by the coupling reaction of the oligonucleotide of formula (PVI1') or its salt with the oligonucleotide fragment of formula (P1F5) or its salt. Similarly, the oligonucleotide of formula (PVI2) or its salt is formed by the coupling reaction of the oligonucleotide of formula (PIV2') or its salt with the oligonucleotide fragment of formula (P2F6) or its salt, and the oligonucleotide of formula (PVII2) or its salt is formed by the coupling reaction of the oligonucleotide of formula (PVI2') or its salt with the oligonucleotide fragment of formula (P2F5) or its salt.

[0847] In certain embodiments, any of the oligonucleotides of Formula (PIV1′), (PIV2′), (PVI1), (PVI2), (PVI1′), (PVI2′), (PVII1), and (PVII2), or a salt thereof, is purified by chromatography.

[0848] In certain embodiments, the coupling reaction described in any one of the 132nd to 135th embodiments is carried out as described in the 122nd or 123rd embodiment. In a specific embodiment, the coupling reaction is carried out in the presence of a base. In another specific embodiment, the coupling reaction is carried out in the presence of a base and a drying agent. In yet another specific embodiment, the coupling reaction is carried out in the presence of DBU and molecular sieves.

[0849] In certain embodiments, the deprotection reaction described in any one of the 132nd to 135th embodiments is performed as described in the 124th embodiment.

[0850] In certain embodiments, the methods disclosed herein involve the preparation of the following oligonucleotides:

[0851] 1. ASO 1 (BIIB 058) (SEQ ID NO: 1), an 18-mer phosphorothioate oligonucleotide wherein each nucleooligonucleotide includes a methoxy-ethyl group (MoE) at the 2' position.

[0852] 2. ASO 2 (BIIB 067) (SEQ ID NO: 2), a 5-10-5 gapmer phosphorothioate and phosphodiester mixed backbone oligonucleotide. The central block of the gapmer is 10 deoxyribonucleotides flanked by 2'-MoE ribonucleotide blocks.

[0853] 3. Phosphorothioate oligonucleotides A, B, C, D and E, as shown in Table 2 below.

[0854] 4. ASO 8 (SEQ ID NO: 8), a 4-8-6 gapmer phosphorothioate and phosphodiester mixed backbone oligonucleotide. The central block of the gapmer is 8 deoxyribonucleotides flanked by 2'-MoE ribonucleotide blocks.

[0855] 5′- G Me U P＝O Me U P＝O Me U P＝O Me U Me CAT Me CAATATC Me U P＝O G P＝O Me C AA-3′ (SEQ ID NO: 8)

[0856] 5. ASO 9 (SEQ ID NO: 9), a 5-8-5 gapmer mixed phosphorothioate and phosphodiester backbone oligonucleotide. The central block of the gapmer is 8 deoxyribonucleotides flanked by 2'-MoE ribonucleotide blocks.

[0857] 5'- Me C Me C P＝O GUU TT Me CTTA Me C Me C A Me C P＝O M e C Me CU-3' (SEQ ID NO:9)

[0858] 5' Me C P＝O Me C P＝O G P＝O UU P＝O T P＝O T P＝O Me C P＝O T P＝O T P＝O A P＝O Me C P＝O Me C P＝O A P＝O Me C P＝O M e C P＝O Me C P＝ O U-3’ (ASO 9-1)

[0859] 5'- Me C P＝O Me C P＝O G P＝O UU TTMe CT P＝O T P＝O A P＝O Me C P＝O Me C P＝O A P＝O Me C P＝O M e C P＝O Me C P＝O U-3’ (ASO9-2)

[0860] Among them: Underline: MOE ribonucleotide

[0861] P=O:phosphodiester

[0862] Any other: phosphorothioate

[0863] Table 1. Phosphorothioate oligonucleotides A, B, C, D, and E

[0864]

[0865]

[0866] In certain embodiments, the target antisense oligonucleotide is a phosphorothioate oligonucleotide having the following sequence (from 5' to 3'):

[0867] TCACTTTCATAATGCTGG(SEQ ID NO:1),

[0868] wherein each internucleoside linkage of the oligonucleotide is a phosphorothioate linkage, each nucleoside of the oligonucleotide is a 2'-O-methoxyethyl (MOE) nucleoside, and each cytosine is a 5-methylcytosine. SEQ ID NO: 1 is also known as BIIB058 and is described in WO2007 / 002390, WO2010 / 148249, and US8,980,853, the teachings of each of which are incorporated herein by reference.

[0869] In certain embodiments, the sequence of the antisense oligonucleotide is a 5-10-5 MOE gapmer having the following sequence (from 5' to 3'):

[0870] CAGGATACATTTCTACAGCT(SEQ ID NO:2),

[0871] wherein each of nucleosides 1-5 and 16-20 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-15 is a 2'-deoxynucleoside, wherein the internucleoside linkage between nucleosides 2 to 3, 4 to 5, 16 to 17, and 18 to 19 is a phosphodiester linkage and the internucleoside linkage between nucleosides 1 to 2, 3 to 4, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 17 to 18, and 19 to 20 is a phosphorothioate linkage, and wherein each cytosine is 5'-methylcytosine. SEQ ID NO: 2 is described by the following chemical symbols: mCes Aeo Ges Geo Aes Tds Ads mCdsAds Tds Tds Tds mCds Tds Ads mCeo Aes Geo mCes Te; wherein, A = adenine,

[0872] mC=5'-methylcytosine

[0873] G=guanine,

[0874] T=thymine,

[0875] e=2'-O-methoxyethyl ribose modified sugar,

[0876] d=2'-deoxyribose,

[0877] s = phosphorothioate internucleoside linkage, and

[0878] o = phosphodiester internucleoside linkage.

[0879] SEQ ID NO: 2 is known as BIIB067 or ISIS 666853 and is described in WO2015153800, the teachings of which are incorporated herein by reference.

[0880] In certain embodiments, the method is as described in any one of the above embodiments or any aspect thereof, wherein the antisense oligonucleotide is a 4-8-6 gapmer having the following sequence (from 5' to 3'):

[0881] GUUUUCATCAATATCUGCAA(SEQ ID NO:8)

[0882] wherein each of nucleosides 1-4 and 13-18 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 5-12 is a 2'-deoxynucleotide, wherein the internucleoside linkages between nucleosides 2 to 3, 3 to 4, 13 to 14, 14 to 15, and 15 to 16 are phosphodiester linkages and the internucleoside linkages between nucleosides 1 to 2, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 16 to 17, and 17 to 18 are phosphorothioate linkages, wherein each cytosine is 5-methylcytosine, and wherein uracil is 5-methyluracil. SEQ ID NO:8 is described by the following chemical symbols:

[0883] 5′- G Me U P＝O Me U P＝O Me U P＝O Me U Me CAT Me CAATATC Me U P＝O G P＝O Me C AA-3′

[0884] Underline = MoE ribonucleotide

[0885] G = guanine

[0886] Me C=5-methylcytosine

[0887] T = thymine

[0888] A = adenine

[0889] Me U = 5-methyluracil (also known as thymine)

[0890] P=O=phosphodiester internucleoside bond

[0891] Any other internucleoside linkage is a phosphorothioate linkage.

[0892] In certain embodiments, the method is as described in any one of the above embodiments or any aspect thereof, wherein the antisense oligonucleotide is a 5-8-5 gapmer (ASO 9) having the following sequence (from 5' to 3'):

[0893] CCGUUTTCTTACCACCCU(SEQ ID NO:9)

[0894] wherein each of nucleosides 1-5 and 14-18 is a 2'-O-methoxyethyl ribose modified nucleoside and each of nucleosides 6-13 is a 2'-deoxynucleotide, wherein the internucleoside linkage between nucleosides 3 to 4 and 16 to 17 is a phosphodiester linkage and the internucleoside linkage between nucleosides 1 to 2, 2 to 3, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, and 17 to 18 is a phosphorothioate linkage, wherein each cytosine is 5-methylcytosine, and wherein uracil is 5-methyluracil.

[0895] SEQ ID NO:9 is described by the following chemical symbols:

[0896] 5'- Me C Me C P＝O G M U M U TT Me CTTA Me C Me C A Me C P＝O M e C Me C M U-3’ (SEQ ID NO:9)

[0897] Underline = MoE ribonucleotide

[0898] G = guanine

[0899] Me C=5-methylcytosine

[0900] T = thymine

[0901] A = adenine

[0902] Me U = 5-methyluracil (also known as thymine)

[0903] P=O=phosphodiester internucleoside bond

[0904] In certain embodiments, ASO 9 is prepared using the convergent liquid phase method of oligonucleotide synthesis disclosed herein as follows:

[0905] In certain embodiments, ASO 9 is prepared using the convergent liquid phase method of oligonucleotide synthesis disclosed herein. In certain embodiments, the method involves the addition of a fragment DMTrO-T s T s A s C s C s Add phosphoramidite to the 3'-hydroxyl group of -OH to obtain the fragment DMTrO-T s T s A s C s C s -OP. Fragment DMTrO-T s T s A s C s C s -OP and HO-A s C o C s C s U-LHPG coupling followed by sulfurization yields DMTrO-T s T s A s C s C s A s C o C s C s U-LHPG. This DMT-protected fragment is deprotected (detritylated) at the 5'-hydroxyl group to obtain HO-T s T s A s C s C s A s C o C s C s U-LHPG, which is further combined with the phosphoramidite fragment DMTrO-U s T s T s C-OP coupling (synthetic method is similar to DMTrO-T discussed above) s T s A s C s C s -OP synthesis), and then sulfurized to obtain DMTrO-U s T s T s C s T s T s A s Cs C s A s C o C s C s U-LHPG. This DMT-protected fragment is deprotected (detritylated) at the 5'-hydroxyl group to obtain HO-U s T s T s C s T s T s A s C s C s A s C o C s C s U-LHPG, which is combined with DMTrO-C s C o G s U-OP coupling ((The synthesis method is similar to the DMTrO-T discussed above s T s A s C s C s -OP synthesis)), and then sulfurized to obtain DMTrO-C s C o G s UsU s T s T s C s T s T s A s C s C s A s C o C s C s U-LHPG (fully protected ASO 9). In certain embodiments, the fragment HO-A s C o C s C s U-LHPG can be prepared by the following steps: HO-U-LHPG and DMTrOA s C o C s CP coupling followed by sulfidation and 5'-hydroxyl deprotection (detritylation). Fragment DMTrOA s C o C s CP can be activated by the fragment DMTrOA s C o C sIt is prepared by adding a phosphoramidite to the 3' hydroxyl group of C-OH. As used herein, O is a phosphodiester bond and S is a phosphorothioate bond.

[0906] Example

[0907] abbreviation

[0908] ACN = acetonitrile

[0909] DBU = 8-diazabicyclo[5.4.0]undec-7-ene

[0910] DCA=CHCl2COOH or dichloroacetic acid

[0911] DCM = dichloromethane

[0912] DDTT = 3-(N,N-dimethylamino-methylene)amino)-3H-1,2,4-dithiazole

[0913] DCI=4,5-dicyanoimidazole DI=

[0914] DIEA=N,N-diisopropylethylamine

[0915] DMT or DMTr = 4,4'-dimethoxytrityl or bis-(4-methoxyphenyl)phenylmethyl

[0916] DMSO = dimethyl sulfoxide

[0917] EtOAc or EA = ethyl acetate

[0918] ETT=5-ethylthio-1H-tetrazole

[0919] h or hr = hours

[0920] HBTU = 3-[bis(dimethylamino)methylimidazolium]-3H-benzotriazole-1-oxide hexafluorophosphate

[0921] HOBt = Hydroxybenzotriazole

[0922] imid = imidazole

[0923] iPrOH = isopropyl alcohol

[0924] MOE = Methoxyethyl

[0925] MS = molecular sieve

[0926] MTBE or TBME = methyl tert-butyl ether

[0927] Py = pyridine

[0928] RT = retention time

[0929] TBAF = Tetra-n-butylammonium fluoride

[0930] TBuAA = tributylammonium acetate

[0931] TBDPSCl = tert-butyl(chloro)diphenylsilane

[0932] TCA = trichloroacetic acid

[0933] TEA = triethylamine

[0934] TEAB = Tetraethylammonium bromide

[0935] TFA = trifluoroacetic acid

[0936] THF = Tetrahydrofuran

[0937] Example 1. Synthesis of ASO 9

[0938] A. Preparation of 3'-fragment:

[0939] 1. Synthesis of 5'-OH-ACCCU-LHPG fragment (fragment 1)

[0940] General procedure for the preparation of compounds 1-2

[0941]

[0942] To a solution of compound 1-1 (176 g, 103 mmol, 1.00 eq) in DCM (1800 mL) at 0°C was added DCA (66.8 g, 518 mmol, 42.6 mL, 5.00 eq) and CySH (24.1 g, 207 mmol, 25.3 mL, 2.00 eq). The mixture was stirred at 0°C for 1 h. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.43) indicated complete consumption of compound 1-1 and the formation of a new spot. The reaction was clean according to TLC. The reaction mixture was quenched by the addition of NaHCO3 (2.50%, 2000 mL) and the dichloromethane (DCM) layer was collected. Anhydrous acetonitrile (ACN) (5000 mL, 30.0 V) was slowly added at 25°C to precipitate the product. Compound 1-2 was obtained as a white solid (144 g, 103 mmol, 99.5% yield).

[0943] General procedure for the preparation of compounds 1-3

[0944]

[0945] Compound 1-2 (125 g, 89.6 mmol, 1.00 eq) and 5'-DMT-MOE C-3'-P imide (124 g, 134 mmol, 1.50 eq) were co-evaporated with ACN (300 mL) and DCM (700 mL). Molecular sieves 3A (54.0 g) were added to a solution of compound 1-2 (125 g, 89.6 mmol, 1.00 eq) and 5'-DMT-MOE C-3'-P imide (124 g, 134 mmol, 1.50 eq) in DCM / ACN = 3:1 (1800 mL). The mixture was stirred at 25°C for 1 hour. DCI (21.1 g, 179 mmol, 2.00 eq) was added to the mixture. The mixture was stirred at 25°C for 1 hour. TLC (dichloromethane:ethyl acetate:methanol=10:10:1, product Rf=0.55) indicated that compound 1-2 was completely consumed and a new spot was formed. According to TLC, the reaction was clean.

[0946] To the mixture were added DDTT (36.7 g, 178 mmol, 2.00 eq) and propan-2-ol (3.22 g, 53.6 mmol, 4.11 mL, 0.600 eq). The mixture was stirred at 25°C for 0.5 h. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.55) indicated the formation of a new spot. The reaction was clean according to TLC.

[0947] To the mixture was added CySH (20.6 g, 178 mmol, 21.7 mL, 2.00 eq) and TFA (101 g, 890 mmol, 65.9 mL, 10.0 eq) at 0°C. The mixture was stirred at 0°C for 2 h. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.51) indicated the formation of a new spot. The reaction was clean according to TLC.

[0948] Pyridine (Py) (84.4 g, 1.07 mol, 86.2 mL, 12.0 eq) was added to the mixture. The molecular sieves were removed by filtration, and the solid filter cake was washed with DCM (500 mL). The pH of the reaction mixture was adjusted to 6-7 with 2.5% aqueous NaHCO₃ solution (1000 mL). The combined organic layers were dried over Mg₂SO₄, filtered, and concentrated. The crude product was redissolved in DCM (450 mL) and added dropwise to ACN (4000 ml, 30.0 V) with vigorous stirring. The desired product precipitated. Compound 1-3 (173 g, 88.9 mmol, 99.9% yield) was obtained as a white solid.

[0949] General procedure for the preparation of compounds 1-4

[0950]

[0951] Compound 1-3 (123 g, 63.2 mmol, 1 eq) and 5'-DMT-MOE C-3'-P imide (87.4 g, 94.8 mmol, 1.50 eq) were co-evaporated with ACN (500 mL) and DCM (1500 mL). Molecular sieves 3A (48.0 g) were added to a solution of compound 1-3 (123 g, 63.2 mmol, 1.00 eq) and 5'-DMT-MOE C-3'-P imide (87.4 g, 94.8 mmol, 1.50 eq) in DCM / ACN = 3:1 (1600 mL). The mixture was stirred at 25°C for 1 h. DCI (14.9 g, 126 mmol, 2.00 eq) was added to the mixture. The mixture was stirred at 25°C for 1 h. TLC (dichloromethane:ethyl acetate:methanol=10:10:1, product Rf=0.64) indicated that compound 1-3 was completely consumed and a new spot was formed. According to TLC, the reaction was clean.

[0952] To the mixture was added DDTT (25.9 g, 126 mmol, 2.00 eq). The mixture was stirred at 25°C for 0.5 h. To the mixture was added propan-2-ol (2.28 g, 37.95 mmol, 2.91 mL, 0.6 eq) at 25°C. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.68) indicated the formation of a new spot. According to TLC, the reaction was clean.

[0953] To the mixture was added trifluoroacetic acid (TFA) (86.5 g, 758 mmol, 56.1 mL, 12.0 eq) and CySH (14.7 g, 126 mmol, 15.4 mL, 2.00 eq) at 0°C. The mixture was stirred at 0°C for 1 hour. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.56) indicated the formation of a new spot. According to TLC, the reaction was clean.

[0954] Py (70.03 g, 885.31 mmol, 71.46 mL, 14 eq) was added to the mixture. The molecular sieves were removed by filtration, and the solid filter cake was washed with DCM (1000 mL). The pH of the reaction mixture was adjusted to 6-7 with 2.5% aqueous NaHCO₃ (2000 mL). The combined organic layers were dried over Mg₂SO₄. The crude product was redissolved in DCM (600 mL) and added dropwise to ACN (5000 ml, 30 V) with vigorous stirring. The desired product precipitated. Compound 1-4 (143 g, 57.31 mmol, 90.63% yield) was obtained as a white solid.

[0955] General procedures for the preparation of compounds 1-5

[0956]

[0957] Compound 1-4 (290 g, 116 mmol, 1.00 eq) and 5'-DMT-MOE C-3'-P imide (160 g, 174 mmol, 1.50 eq) were co-evaporated with ACN (500 mL) and DCM (1500 mL). Molecular sieves were added to a solution of compound 1-4 (290 g, 116.23 mmol, 1 eq) and 5'-DMT-MOE C-3'-P imide (160 g, 174 mmol, 1.50 eq) in DCM / ACN = 3:1 (2300 mL). (69.0 g). The mixture was stirred at 25°C for 1 hour. DCI (34.3 g, 290 mmol, 2.50 eq) was added to the mixture. The mixture was stirred at 25°C for 1 hour. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.70) indicated that compound 1-4 was completely consumed and a new spot was formed. According to TLC, the reaction was clean.

[0958] To the mixture was added t-BuOOH (H₂O, 31.8 mL, 70.0% purity, 2.00 eq) and the resulting mixture was stirred at 25°C for 1 h. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.72) indicated the formation of a new spot. The reaction was clean according to TLC. The molecular sieves were removed by filtration, and the solid filter cake was washed with DCM (1000 mL). The crude product was added dropwise to ACN (9000 ml, 30.0 V) with vigorous stirring. The desired product precipitated. Compound 1-5 (386 g, 116 mmol, 99.8% yield) was obtained as a white solid.

[0959] General procedures for the preparation of compounds 1-6

[0960]

[0961] To a solution of compound 1-5 (386 g, 115 mmol, 1.00 eq) in DCM (5700 mL) at 0°C were added CySH (40.3 g, 347 mmol, 42.5 mL, 3.00 eq) and dichloroacetic acid (DCA) (298 g, 2.32 mol, 190 mL, 20.0 eq). The mixture was stirred at 0°C for 1 h. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.46) indicated complete consumption of compound 1-5 and the formation of a new spot. According to TLC, the reaction was clean. Py (201 g, 2.55 mol, 205 mL, 22.0 eq) was added to the mixture. The molecular sieves were removed by filtration, and the solid filter cake was washed with DCM (800 mL). The pH of the reaction mixture was adjusted to 6-7 with 2.5% aqueous NaHCO3 (4000 mL). The combined organic layers were dried over MgSO. The crude product was redissolved in DCM (500 mL) and added dropwise to ACN (12000 mL, 30 V) with vigorous stirring. The desired product precipitated, affording compound 1-6 (310 g, 102 mmol, 88.3% yield) as a white solid.

[0962] General procedure for the preparation of compound 1-7 (5'-OH-ACCCU-LHPG)

[0963]

[0964] Compound 1-6 (154 g, 50.8 mmol, 1.00 eq) and 5'-DMT-MOE A-3'-P amidite (71.0 g, 76.2 mmol, 1.50 eq) were co-evaporated with ACN (500 mL) and DCM (1500 mL).

[0965] To a solution of compound 1-6 (154 g, 50.8 mmol, 1.00 eq) and 5'-DMT-MOE A-3'-P imide (71.0 g, 76.2 mmol, 1.50 eq) in DCM / ACN = 3:1 (1200 mL) was added molecular sieves 3A (36.0 g). The mixture was stirred at 25 ° C for 1 hour. DCI (15.0 g, 127 mmol, 2.50 eq) was added to the mixture. The mixture was stirred at 25 ° C for 1 hour. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.57) indicated that compound 1-6 was completely consumed and a new spot was formed. According to TLC, the reaction was clean. To the mixture were added DDTT (17.7 g, 86.3 mmol, 1.70 eq) and propan-2-ol (iPrOH) (1.83 g, 30.4 mmol, 2.33 mL, 0.600 eq). The mixture was stirred at 25°C for 0.5 h. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.59) indicated the formation of a new spot. The reaction was clean according to TLC.

[0966] To the mixture was added TFA (75.2 g, 659 mmol, 48.8 mL, 13.0 eq) and CySH (11.7 g, 101 mmol, 12.4 mL, 2.00 eq) at 0°C. The mixture was stirred at 0°C for 1 hour. TLC (dichloromethane:ethyl acetate:methanol = 10:10:1, product Rf = 0.47) indicated the formation of a new spot. The reaction was clean according to TLC.

[0967] Py (58.5 g, 739 mmol, 59.7 mL, 15.0 eq) was added to the mixture. The molecular sieves were removed by filtration, and the solid filter cake was washed with DCM (300 mL). The pH of the reaction mixture was adjusted to 6-7 with 2.5% aqueous NaHCO₃ (2000 mL). The combined organic layers were dried over Mg₂SO₄. The crude product was redissolved in DCM (400 mL) and added dropwise to ACN (4500 ml, 30.0 V) with vigorous stirring. The desired product precipitated. Compound 1-7 (5'-OH-ACCCU-LHPG) (169 g, 47.0 mmol, 92.7% yield) was obtained as a white solid. For HPLC and LC-MS analysis of compound 1-7, it was deprotected using an aminolysis (NH₃ / H₂O) procedure similar to the aminolysis procedure for compound 1 disclosed below to obtain 1-7-a (5'-OH-ACCCU-OH). HPLC and LC-MS of compound 1-7-a are shown in Figure 1 middle.

[0968]

[0969] The HPLC-MS method of compound 1-7-a is described as follows:

[0970] ●Column-ACQUITY UPLC BEH Shield RP18 column, 1.7μm, 2.1mm X 150mm;

[0971] Column temperature: 65°C

[0972] ●Mass spectrometry scanning range: 300-2000 m / z;

[0973] ●MS polarity: negative

[0974] Solution A: 5 mM tributylamine acetate (TBuAA) in 10% CH3CN, 1 μM EDTA; Solution B: 5 mM TBuAA in 80% CH3CN, 1 μM EDTA

[0975] Gradient:

[0976]

[0977] 2. Alternative Synthesis of 5'-OH-ACCCU-LHPG Fragment (Fragment 1)

[0978] Preparation of 5'-DMT-ACCC-3'OH

[0979]

[0980] 5'-DMT-ACCC-3'-OH (1-8) was prepared based on the above scheme using a similar procedure as described for compound 1-3 above.

[0981] General procedure for the preparation of 5'-DMT-ACCC-3'-P amidite (1-8a)

[0982]

[0983] Under N2 protection, 5'-DMT-ACCC-3'-OH (280.0 g, 1.0 eq.) was charged to reactor (R1). DCM (1000 mL, 3.57 V) was charged to a flask under N2 protection. The compound was co-evaporated with DCM under vacuum at 25-30°C. The co-evaporation with DCM was repeated three times until the residual water content was less than 0.01%. THF (1400 mL, 5 V) was charged to R1 under N2 protection. A sample was collected for analysis. The temperature of R1 was adjusted between -5°C and 5°C. P-reagent (106.7 g, 2.992 eq.) was charged to R1 under N2 protection. (Pyridine; 45.7 g, 2.001 eq., of 2,2,2-trifluoroacetic acid) was added to R1 under N2 protection, and the reaction mixture was stirred at -5°C to 5°C for 1 hour.

[0984] Under N2 protection, methyl tert-butyl ether (MTBE) (10080mL 36V) was charged into another flask (R2). Py (70mL 0.25V) was charged into R2 under N2 protection. Heptane (3920mL 14V) was charged into R1 under N2 protection. R2 was purged with N2 for 30 minutes at -5°C to 5°C. Under N2 protection, the solution from R1 was slowly charged into the solution of R2. R2 was stirred at -5°C to 5°C for 1 hour. The reaction mixture was filtered. The filter cake was washed twice with MTBE: heptane (5:2, 700mL) solution. Filtrate samples were collected for analysis. The filter cake was dried at 25°C to 30°C for 24 hours to obtain 5'-DMT-ACCC-3'-P subamide 1-8a (292.3g, yield: 96.25%, purity: 98%).

[0985] General procedure for the preparation of 5'-DMT-ACCCU-3'-LHPG(1-9)

[0986]

[0987] 5'-HO-U-3'-LHPG (120.0 g) was charged into the reactor, and then molecular sieves (300.0 g), 5'-DMT-ACCC-P-imide (280.68 g, 1.27 eq.), and DCM (3000 mL, 25 V). The reaction mixture was stirred at 20°C–30°C for 1 hour. DCI (20.33 g, 2.00 eq.) was added to the reaction mixture, and the mixture was stirred at 20°C–30°C for 30 minutes. A sample was collected for analysis. DDTT (35.35 g, 2.0 eq.) was added to the reaction mixture. A sample was collected for analysis. The reaction mixture was filtered, concentrated, and dissolved in DCM (720 mL, 6 V). The DCM solution was added dropwise to an ACN solution (9000 mL, 75 V), and most of the DCM was removed by rotary distillation. The mixture was filtered, and the filter cake was washed twice with ACN (600 mL, 10 V). The wet cake was dried at 20° C. to 30° C. for 16 hours to obtain 5′-DMT-ACCCU-3′-LHPG (287.15 g, 85.7% yield).

[0988] General procedure for the preparation of 5'-OH-ACCCU-3'-LHPG (1-7)

[0989]

[0990] 5'-DMT-ACCCC-3'-LHPG (285.54 g), molecular sieves (3A) (142.77 g), and DCM (2855 mL, 10 V) were charged to a reactor. The reaction mixture was stirred at 20°C to 30°C for 1 hour, and the reaction temperature was adjusted to -5°C to 5°C. Dodecan-1-thiol (51.97 g, 3.5 eq.) was charged to the reactor, followed by TFA (58.55 g, 7.0 eq.), and the reaction mixture was stirred at -5°C to 5°C for 1 hour. 1-Methylimidazole (NMI) (54.21 g, 9.0 eq.) was charged to the reactor, and the reaction mixture was stirred at 20°C to 30°C for 5 minutes. The reaction mixture was filtered, and the solution was concentrated to remove the DCM. The crude product was dissolved in DCM (427.5 mL, 1.5 V), and this solution was added dropwise to a solution of ACN (8566 mL, 30 V). The resulting mixture was concentrated by rotary distillation to remove most of the DCM and filtered. The filter cake was washed twice with ACN (571 mL, 4V) and dried at 20-30°C to afford compound 1-7 (239.92 g; 91.1% yield).

[0991] B. General procedure for preparing 5'-fragments:

[0992] 1. Synthesis of deoxy-TTACC 5-mer fragment (fragment 2)

[0993] General procedure for preparing compound 2-2

[0994]

[0995] To a solution of compound 2-1 (300 g, 463 mmol, 1.00 eq) in DCM (2300 mL) was added imidazole (94.6 g, 1.39 mol, 3.00 eq) at 25°C. The mixture was a pale yellow homogeneous solution. TBDPSCl (tert-butyl(chloro)diphenylsilane) (166 g, 602 mmol, 155 mL, 1.30 eq) was added at 25°C. The mixture was stirred at 25°C for 12 hours. Note: The temperature rose by 5°C during the addition of TBDPSCl. HPLC showed that the reactants were completely consumed. Propan-2-ol (27.8 g, 463 mmol, 35.5 mL, 1.00 eq) was added and the mixture was stirred at 25°C for 0.5 hours.

[0996] To the above solution was added cyclohexanethiol (70.0 g, 602 mmol, 73.7 mL, 1.30 eq) at 0°C. The mixture was stirred at 0°C for 15 minutes. TFA (264.06 g, 2.32 mol, 171.47 mL, 5 eq) was added dropwise at 0°C over 45 minutes. The mixture was stirred at 0°C for 1 hour. The color of the solution changed from light yellow to dark red, and white solid was observed during the addition of TFA. HPLC indicated the reaction was complete.

[0997] Reactant mixture is poured into Na cO solution (245g Na cO , in 1.5L water), dilute and separate two layers with methyl tertiary butyl ether (TBME or MTBE) (1.5L).Organic layer is washed with salt solution (750mL x 2), use anhydrous MgSO (232g) drying, is filtered through diatomite and concentrated.Attention is added Na cO during the aqueous solution, observe some white solids, and the product in concentration process is just precipitated out until being evaporated to drying, obtains the crude product that is yellow foam solid shape.

[0998] The crude product was dissolved in DCM (300 mL) and placed in a 1000 mL separatory funnel. The crude product solution was slowly added dropwise from the funnel to a solvent mixture of heptane / TBME (v / v 9:1, 3.0 L) to carry out a precipitation process. This process takes approximately 30 minutes. The pure product as a white solid was collected using a Buchner funnel, and the product filter cake was washed with a solvent mixture of heptane (100 mL x 2) and concentrated to dryness. Compound 2-2 (235 g, 395 mmol, 85.2% yield, 98.0% purity) was obtained as a white solid.

[0999] General procedure for the preparation of compounds 2-4

[1000]

[1001] Compound 2-2 (10.0 g, 17.1 mmol, 1.00 eq) and compound monomer 2-3 (17.4 g, 20.6 mmol, 1.20 eq) were co-evaporated with CH 3 CN (20 mL×2) in a 250 mL single-necked round flask under Ar 2 .

[1002] Compound 2-2 (10.0 g, 17.1 mmol, 1.00 eq) and compound monomer 2-3 (17.4 g, 20.6 mmol, 1.20 eq) were dissolved in ACN (80 mL) and DCM (80 mL) (CH3CN / DCM=1 / 1) at 25°C. ETT (3.34 g, 25.7 mmol, 1.50 eq) was added and the mixture solution was stirred at 25°C under Ar2 for 30 minutes. It should be noted that the acetonitrile used in the reaction was 99.9% pure and was further dried with molecular sieves to a water content of ≤50 ppm. The DCM used was also anhydrous DCM. The mixture changed from a light yellow homogeneous solution to a light yellow turbid solution. HPLC showed that compound 2-2 was completely consumed.

[1003] To the above solution was added hydroxanthin (2.83 g, 18.8 mmol, 1.10 eq) at 25°C. The mixture was stirred at 25°C for 0.5 h. Note: The mixture changed from a pale yellow homogeneous solution to a yellow turbid solution. HPLC indicated the reaction was complete.

[1004] The above solution was cooled to 0°C in an ice-water bath and held for 30 minutes. TFA (13.7 g, 120 mmol, 8.88 mL, 7.00 eq) was added to the reaction mixture at 0°C. The mixture was stirred at 0°C for 2.5 hours. The color of the mixture changed from yellow turbidity to red. HPLC indicated the reaction was complete.

[1005] Na2CO3 solution (12.7 g Na2CO3, in 83 mL water) was slowly added to the reaction mixture (observing the speed of CO2 release to avoid collision of the reaction solution). The naturalization process was completed in about 12 hours, and then all solvents of the reaction mixture were removed by rotary evaporation to obtain a milky white aqueous suspension of the crude product.

[1006] The crude product was dissolved in a mixture solvent of EtOAc / TBME (v / v 1:3, 800 mL) and the two layers were separated. The organic layer was washed with water (400 mL), brine (2 x 400 mL), dried over anhydrous MgSO4 (-42.0 g), filtered through celite and concentrated.

[1007] The crude product was dissolved in DCM (55 mL) and placed in a 100 mL separatory funnel. The crude product solution was slowly added from the funnel to a solvent mixture of heptane / TBME (v / v 9:1, 1600 mL) to perform the precipitation process. This process took approximately 60 minutes. The quenching step was extended by 1 hour.

[1008] The pure product was collected as a white solid using a Buchner funnel. The product filter cake was washed with a solvent mixture of heptane (50 mL x 2) and concentrated to dryness. Compound dimer 2-4 was obtained as a light yellow solid (25.5 g, 16.6 mmol, 96.6% yield, 68.2% purity).

[1009] General procedure for the preparation of compounds 2-6

[1010]

[1011] Compound dimer 2-4 (10.0 g, 9.43 mmol, 1.00 eq) and compound monomer 2-5 (8.90 g, 10.4 mmol, 1.10 eq) were co-evaporated with ACN (100 mL x 3) in a 500 mL single-necked round flask and then dissolved in ACN (30 mL) and DCM (30 mL) (CH3CN / DCM = 1 / 1) at 25°C. 5-Ethylsulfanyl-2H-tetrazole (1.84 g, 14.2 mmol, 1.5 eq) was added at 25°C and the mixture was stirred at 25°C for 30 minutes. HPLC indicated that the reactant dimer 2-4 was completely consumed.

[1012] To the above solution was added 5-amino-1,2,4-dithiazole-3-thione (1.56 g, 10.4 mmol, 1.10 eq) at 25°C. The mixture was stirred at 25°C for 0.5 hours. The mixture changed from a pale yellow homogeneous solution to a turbid yellow color. HPLC indicated the reaction was complete.

[1013] The above solution was cooled to 0°C. TFA (6.45 g, 56.6 mmol, 4.20 mL, 6.00 eq) was added dropwise at 0°C. The mixture was stirred at 0-25°C for 3 hours. The color of the mixture changed from yellow turbidity to an orange-yellow suspension. HPLC indicated that the reaction was complete.

[1014] Na2CO3 solution (6.00 g, Na2CO3, in 46.6 mL of water) was slowly added to the reaction mixture (observing the rate of CO2 release to avoid collision of the reaction solution). The naturalization process was completed in about 1 hour, and then all solvents of the reaction mixture were removed by rotary evaporation to obtain a milky white aqueous suspension of the crude product.

[1015] The crude product is dissolved in a mixture solvent of EtOAc / TBME (v / v 3:1,622mL) and separated into two layers. The organic layer is washed with water (155mL), salt solution (2x 155mL), and by anhydrous MgSO (~15.5g) drying, filtered and concentrated under vacuum. Note that in this process, no yellow gel solid is precipitated. The crude product is dissolved among the DCM (70mL) and packed in a 100mL separating funnel.

[1016] In the solvent of TBME (1.24L), slowly add the crude product solution from funnel for precipitation process.This process approximately needs 1.5 hours.Be collected into the pure product of white solid with Buchner funnel, wash product filter cake with the solvent mixture of heptane (50mL x 2) and be concentrated into dryness.Obtain compound trimer 2-6 (11.4g, 6.63mmol, 70.3% productive rate, 90.0% purity) of light yellow solid.

[1017] General procedure for the preparation of compounds 2-8

[1018]

[1019] To a solution of compound trimer 2-6 (4.20 g, 2.72 mmol, 1.00 eq) in CH 3 CN (10 mL) was added monomer 2-7 (3.03 g, 4.07 mmol, 1.50 eq) and the solution was co-evaporated with CH 3 CN (10 mL×2) under Ar 2 in a 100 mL single-necked round flask.

[1020] Compound trimer 2-6 (4.20 g, 2.72 mmol, 1.00 eq) and monomer 2-7 (3.03 g, 4.07 mmol, 1.50 eq) were dissolved in CH3CN (12 mL) and DCM (12 mL) (CH3CN / DCM=1 / 1) at 25°C. Molecular sieves were added. (4.00 g, 1.00 eq) and the mixture solution was stirred at 25 ° C for 1 hour under Ar2. 5-Ethylsulfanyl-2H-tetrazole (530 mg, 4.07 mmol, 1.50 eq) was added at 25 ° C. The mixture was stirred at 25 ° C for 0.5 hours. The mixture changed from a light yellow homogeneous solution to a light yellow turbid solution. The reaction mixture was filtered to remove molecular sieve.

[1021] It should be noted that both acetonitrile and DCM were freshly redistilled. HPLC showed that the trimer was completely consumed.

[1022] To the above solution was added 5-amino-1,2,4-dithiazole-3-thione (449 mg, 2.99 mmol, 1.10 eq) at 25°C. The mixture was stirred at 25°C for 0.5 hours. The mixture changed from a pale yellow homogeneous solution to a yellow turbid solution. HPLC indicated the reaction was complete.

[1023] TFA (2.48 g, 21.7 mmol, 1.61 mL, 8.00 eq) was added dropwise to the above mixture at 0°C. The mixture was stirred at 0°C for 4.5 hours. The mixture turned from yellow turbidity to an orange-yellow suspension. HPLC indicated that the reaction was complete.

[1024] Na2CO3 solution (2.88 g Na2CO3, in 20 mL water) was slowly added to the reaction mixture (observing the rate of CO2 release to avoid collision of the reaction solution). The naturalization process was completed in about 1 hour, and then all solvents of the reaction mixture were removed by rotary evaporation to obtain a milky white aqueous suspension of the crude product.

[1025] The crude product was dissolved in a mixture solvent of EtOAc / TBME (v / v 3:1, 260 mL) and the two layers were separated. The organic layer was washed with water (64 mL), brine (2 x 64 mL), dried over anhydrous MgSO4 (-6.44 g), filtered through celite and concentrated.

[1026] The crude product was dissolved in DCM (28 mL) and placed in a 100 mL separatory funnel. The crude product solution was slowly added dropwise from the funnel to TBME (518 mL) to allow precipitation. This process took approximately 30 minutes.

[1027] The pure product was collected as a white solid using a Buchner funnel. The product filter cake was washed with a solvent mixture of heptane (20 mL x 2) and concentrated to dryness. Compound tetramer 2-8 (4.37 g, 2.07 mmol, 76.2% yield, 91.0% purity) was obtained as a pale yellow solid.

[1028] General procedure for the preparation of compounds 2-9 (deoxy-TTACC 5-mer)

[1029]

[1030] Tetramer 2-8 (120 g, 62.5 mmol, 1.00 eq) was co-evaporated with ACN (500 mL x 2), then monomer 2-7 (51.2 g, 68.8 mmol, 1.10 eq) was added and the solution was co-evaporated with ACN (500 mL x 2) in a 3 L single-necked round flask under Ar2.

[1031] To a mixture of tetramer 2-8 (120 g, 62.5 mmol, 1.00 eq) and monomer 2-7 (51.2 g, 68.8 mmol, 1.10 eq) in ACN (485 mL) was added molecular sieves 3A (36 g) at 25°C. The mixture was stirred at 25°C for 1 hour. Py·TFA (1 M, 93.8 mL, 1.50 eq) was added at 25°C. The resulting mixture was stirred at 25°C for 30 minutes. It should be noted that the acetonitrile was freshly redistilled. HPLC indicated complete consumption of tetramer 2-8.

[1032] To the above mixture was added DDTT (14.1 g, 68.8 mmol, 1.10 eq) at 25°C. The mixture was stirred at 25°C for 0.5 h. After the sulfurization was complete, the mixture was diluted with redistilled MeCN (480 mL) and then cooled to 0°C. Py (49.4 g, 625 mmol, 50.5 mL, 10.0 eq) was added at 0°C.

[1033] Meanwhile, a 1L three-necked round-bottom flask was charged with imidazole (85.1 g, 1.25 mol, 20.0 eq) and anhydrous THF (240 mL) and placed in an ice bath for 30 minutes. HF (17.9 g, 625 mmol, 16.3 mL, 70% purity, 10.0 eq) was slowly added and stirred for an additional 15 minutes (a homogeneous solution was obtained by this step). This solution was added to the suspension at 0°C via a syringe pump (2 mL / min drip rate). The mixture was stirred at 0°C for 3 hours. HPLC indicated the reaction was complete.

[1034] The reaction mixture was dissolved in EtOAc (2.8 L). The organic layer was washed with saturated NaHCO (1.4 L x 2), water (1.4 L x 3), brine (1.4 L) and dried over anhydrous MgSO (-208 g), filtered and concentrated under vacuum. No yellow gel solid was precipitated during this process.

[1035] The crude product was dissolved in DCM (840 mL) and ACN (240 mL) was placed in a 1 L separatory funnel. The crude product solution was slowly added from the funnel to the solvent of TBME (8.5 L) to carry out the precipitation process. This process takes about 3 hours. The pure product was collected as a white solid with a Buchner funnel, and the product filter cake was washed with a solvent mixture of TBME (1 L x 2) and concentrated to dryness. Deoxy-TTACC 5-mer (145.5 g, 57.8 mmol, 92.4% yield, 93.6% purity) was obtained as a white solid. HPLC-MS (RT = 7.174 min) of deoxy-TTACC 5-mer (2-9) is shown in Figure 2 middle.

[1036] HPLC-MS method for compound 2-9:

[1037] ●Column: ACQUITY UPLC BEH Shield RP18 column, 1.7μm, 2.1mm X 150mm;

[1038] Column temperature: 60°C

[1039] MS analysis was performed on a Thermo Orbitrap Fusion with a resolution of 60k and a mass range of 700 to 2000.

[1040] ●MS polarity: positive

[1041] Mobile phase A: 20 mM ammonium acetate in 25:75 ACN:water; Mobile phase B: acetonitrile;

[1042] Gradient:

[1043]

[1044]

[1045] 2. Synthesis of UTTC 4-mer (Fragment 3)

[1046] General procedure for preparing compound 3-2

[1047]

[1048] To a solution of compound 3-1 (500 g, 772 mmol, 1.00 eq) in DCM (3800 mL) was added imidazole (158 g, 2.32 mol, 3.00 eq). TBDPSCl (276 g, 1.00 mol, 258 mL, 1.30 eq) was added. The mixture was stirred at 25° C. for 16 h. TLC (petroleum ether / ethyl acetate = 5 / 1, product: Rf = 0.40) indicated complete consumption of compound 3-1. Propan-2-ol (46.4 g, 59.1 mL, 1.00 eq) was added and the mixture was stirred for 30 minutes.

[1049] To the above solution was added CySH (117 g, 1.00 mol, 123 mL, 1.30 eq) at 0°C. The mixture was stirred at 0°C for 15 minutes. TFA (440 g, 3.86 mol, 286 mL, 5.00 eq) was added dropwise at 0°C over 30 minutes. The mixture was stirred at 0°C for 1 hour. HPLC showed that the reaction was complete. Note that the color of the solution was observed to change from light yellow to dark red during the addition of TFA.

[1050] The reaction mixture was poured into Na2CO3 solution (410 g Na2CO3 in 2.5 L water), diluted with TBME (2.5 L) and the two layers were separated. The organic layer was washed with brine (1.3 L x 2), dried over anhydrous MgSO4 (321 g), filtered through celite and concentrated.

[1051] The crude product was dissolved in DCM (600mL) and loaded into a 1000mL separating funnel. From the funnel, the crude product solution was slowly added to the solvent mixture of heptane / TBME (v / v 9: 1, 5.0L) to carry out a precipitation process. This process takes approximately 30 minutes. The pure product was collected in a Buchner funnel as a white solid, and the product filter cake was washed with a solvent mixture of heptane (500mL x 2) and concentrated to dryness. Compound 3-2 (390g, 660mmol, 85.5% yield, 98.8% purity) was obtained as a white solid.

[1052] General procedure for preparing compound 3-3

[1053]

[1054] Compound 3-2 (110 g, 188 mmol, 1.00 eq) and dT amidite (168 g, 226 mmol, 1.20 eq) were co-evaporated with CH3CN (1.0 L x 3). The mixture was dissolved in CH3CN (500 mL) and DCM (500 mL) at 25 ° C. 5-(ethylthio)-1H-tetrazole (ETT) (1.67 g, 12.8 mmol, 1.50 eq) was added with stirring and the mixture solution was stirred at 25 ° C for 30 minutes under Ar2 atmosphere. Note that acetonitrile and DCM were freshly redistilled. HPLC indicated that compound 3-2 was completely consumed. Note that dT amidite is DMT-2'-deoxythymidine-phosphoramidite:

[1055]

[1056] To the above solution was added hydrogenated xanthan gum (31.1 g, 207 mmol, 1.10 eq) at 25° C. The mixture was stirred at 25° C. for 0.5 h. HPLC indicated that the reaction was complete.

[1057] The above solution was cooled to 0°C in ice water. CySH (24.1 g, 207 mmol, 25.4 mL, 1.10 eq) was added to the reaction mixture at 0°C. TFA (215 g, 1.88 mol, 140 mL, 10.0 eq) was added to the reaction mixture at 0°C. The mixture was stirred at 25°C for 2 h. HPLC indicated the reaction was complete. The color of the mixture changed from turbid yellow to red.

[1058] Na2CO3 solution (254 g, Na2CO3, in 3.4 L water) was slowly added to the reaction mixture (observing the rate of CO2 release to avoid collision of the reaction solution). The naturalization process was completed in about 1 hour, and then all solvents of the reaction mixture were removed by rotary evaporation to obtain a milky white aqueous suspension of the crude product.

[1059] The two reactions were combined here, and the resulting aqueous solution of the crude product was diluted with 7.5 L MeCN (adding MeCN can dissolve the crude product filter cake) and extracted 3 times with TBME / heptane (3 x 3.4 L, v / v, 1:4) to remove non-polar impurities (such as CySH and DMTrSCy, etc.). The aqueous fractions were collected in a 3.0 L round-bottom flask and reduced pressure was applied by a rotary evaporator to remove all MeCN, again giving an aqueous solution of the crude product as a yellow gel filter cake.

[1060] The crude product was diluted with an EtOAc / TBME mixture (v / v = 1:3, 5.1 L) (ensuring that no gel solids remained in the solution) and the two layers were separated. The organic layer was washed three times with DI water (3 x 2.5 L) and brine (2.5 L), dried over anhydrous MgSO4 (~500 g), and concentrated to dryness to afford a crude yellow foam, which was used directly in the next step without further treatment. Compound 3-3 (420 g, 330 mmol, 88.5% yield, 76.0% purity) was obtained as a pale yellow solid.

[1061] General procedure for the preparation of compounds 3-4

[1062]

[1063] Compound 3-3 (200 g, 208 mmol, 1.00 eq) and dT amidite (186 g, 250 mmol, 1.20 eq) were co-evaporated with ACN (1.0 L x 3) in a 3 L single-necked round flask under Ar2. Molecular sieves 3A (52.0 g) were added to the above solution in ACN (525 mL) and DCM (525 mL) at 25 ° C. The mixture was stirred at 25 ° C for 1 h. ETT (40.8 g, 313 mmol, 1.50 eq) was added at 25 ° C. The resulting mixture was stirred at 25 ° C for 30 minutes. Note that acetonitrile and DCM were freshly redistilled. HPLC indicated that compound 3-3 was completely consumed.

[1064] To the above solution was added hydrogenated xanthan gum (34.5 g, 229 mmol, 1.10 eq) at 25° C. The mixture was stirred at 25° C. for 0.5 h. HPLC indicated that the reaction was complete.

[1065] The above solution was cooled to 0°C in ice water. CySH (26.7 g, 229 mmol, 28.1 mL, 1.10 eq) was added to the reaction mixture at 0°C and held for 10 minutes. TFA (238 g, 2.09 mol, 154 mL, 10.0 eq) was added to the reaction mixture at 0°C. The mixture was stirred at 25°C for 2 hours. HPLC indicated the reaction was complete. Notice the color of the mixture changed from turbid yellow to red.

[1066] Na2CO3 solution (156 g, Na2CO3, in 2100 mL of water) was slowly added to the reaction mixture (observing the rate of CO2 release to avoid collision of the reaction solution). The naturalization process was completed in about 1 hour, and then all solvents of the reaction mixture were removed by rotary evaporation to obtain a milky white aqueous suspension of the crude product.

[1067] The crude product was dissolved in a mixture solvent of EtOAc / TBME (v / v 1:2, 6400 mL) and the two layers were separated. The organic layer was washed with water (3 x 3200 mL), brine (3200 mL), dried over anhydrous MgSO4 (-520 g), filtered and concentrated under vacuum.

[1068] The two reactions are combined here, and the crude product is dissolved in DCM (1.0 L x 2) and loaded into a 1000 mL separatory funnel. The crude product solution is slowly added from the funnel to a solvent of TBME / heptane (v / v=9:1, 21 L) to carry out a precipitation process. This process takes about 3 hours. The pure product is collected as a white solid with a Buchner funnel, and the product filter cake is washed with a solvent mixture of heptane (800 mL x 2) and concentrated to dryness. Compound 3-4 (301 g, 216 mmol, 51.8% yield, 95.8% purity) is obtained as a light yellow solid. HPLC shows compound 2-4: RT=6.778 min.

[1069] General procedure for preparation of 3-5 (UTTC tetramer)

[1070]

[1071] Compound 3-4 (200 g, 150 mmol, 1.00 eq) and MOE U amide (129 g, 157.85 mmol, 1.05 eq) were co-evaporated with CH3CN (500 mL x 3). Molecular sieves (MS) were added to a solution of compound 3-4 (200 g, 150 mmol, 1.00 eq) and MOE U amide (129 g, 157 mmol, 1.05 eq) in anhydrous CH3CN (800 mL). (40.0 g, 150 mmol, 1.00 eq). The mixture was stirred at 25°C for 1 h. Py-TFA (1.00 M, 225 mL, 1.50 eq) was then added to the reaction mixture at 25°C. The resulting mixture was stirred at 25°C for 30 min. Note that both acetonitrile and DCM were freshly redistilled. HPLC indicated that compound 2-4 was completely consumed. Note that the MOE U amide is:

[1072]

[1073] To the above solution was added DDTT (33.9 g, 165 mmol, 1.10 eq) at 25°C. The mixture was stirred at 25°C for 0.5 h. The mixture was then cooled to 0°C in an ice bath and held for 30 minutes. HPLC indicated the reaction was complete. Note that the mixture changed from a turbid yellow to a homogeneous yellow solution.

[1074] Meanwhile, a 1 L three-necked round-bottom flask was charged with imidazole (204 g, 3.01 mol, 20.0 eq) and anhydrous THF (400 mL) and placed in an ice bath for 30 minutes. HF (43.0 g, 1.50 mol, 39.1 mL, 70.0% purity, 10.0 eq) was slowly added and stirred for an additional 15 minutes. The mixture was added to the above suspension at 0°C and held for 1 hour. The mixture was stirred at 0°C for 1 hour. HPLC indicated the reaction was complete.

[1075] The reaction mixture was dissolved in EtOAc (5.2 L). The organic layer was washed with saturated NaHCO (3.6 L x 2), water (2.6 L x 3), brine (2.6 L) and dried over anhydrous MgSO (-440 g), filtered and concentrated under vacuum. Note that no yellow gel solid precipitated during this process.

[1076] The crude product was dissolved in DCM (2.0 L) and loaded into a 1 L separating funnel. The crude product solution was slowly added from the funnel to a solvent mixture of TBME (17.6 L) to carry out a precipitation process. This process takes about 30 minutes. The pure product was collected with a Buchner funnel as a white solid, and the product filter cake was washed with a solvent mixture of TBME (500 mL x 2) and concentrated to dryness. Compound 3-5 (UTTC 4 polymers) (258 g, 134 mmol, 89.0% yield, 95.6% purity) was obtained as a light yellow solid. The HPLC-MS of compound UTTC 4 polymers (3-5) is shown in Figure 3 middle.

[1077] HPLC-MS method of compound 3-5:

[1078] ●Column: ACQUITY UPLC BEH Shield RP18 column, 1.7μm, 2.1mm X 150mm;

[1079] Column temperature: 60°C

[1080] MS analysis was performed on a Thermo Orbitrap Fusion with a resolution of 60k and a mass range of 300 to 2000.

[1081] ●MS polarity: positive;

[1082] Mobile phase A: 20 mM ammonium acetate in 25:75 ACN:water; Mobile phase B: acetonitrile;

[1083] Gradient:

[1084]

[1085]

[1086] 3. Synthesis of 5'DMT-MOE CCGU-OH (Fragment 4)

[1087] General procedure for preparing compound 4-2

[1088]

[1089] To a solution of compound 4-1 (200 g, 323 mmol) in DCM (1600 mL) was added imidazole (66.0 g, 969 mmol) and TBDPSCl (115 g, 420 mmol, 107 mL) at 25° C. The mixture was stirred at 25° C. for 12 hours. TLC (petroleum ether / ethyl acetate = 1 / 1, R f =0.63 min) indicated compound 4-1 and a major new spot with lower polarity. Propan-2-ol (19.4 g, 323 mmol, 24.7 mL) was added to the mixture and stirred at 25°C for 0.5 hours.

[1090] CySH (48.8 g, 420 mmol) and TFA (184 g, 1.62 mol) were added dropwise to the solution of the last step at 0 ° C. The mixture was stirred at 0 ° C for 1 hour. TLC (petroleum ether / ethyl acetate=1 / 1, Rf=0.50) showed that the reaction was complete. The reaction mixture was quenched by adding Na2CO3 solution (185 g, 1600 mL DI H2O) at 25 ° C, then diluted with TBME (500 mL) and separated into two layers. The combined organic layer was washed with brine (500 mL), dried over MgSO4, filtered and concentrated under reduced pressure to obtain a residue. The crude product compound 4-2 was dissolved in ACN (2000 mL) and DI H2O (300 mL) and extracted with heptane / TBME (4 / 1, 8 L, 1.6 L x5). The ACN layer was diluted with DCM (3.2 L), water was separated, dried over anhydrous MgSO4, filtered and concentrated under reduced pressure to obtain a residue. Compound 4-2 was obtained as a white foam (176 g, 98.1% yield, 95.8% purity). 1 H NMR: 400 MHz DMSO:11.30(s,1H),7.69(m,J=6.4Hz,3H),7.61(dd,J=7.73,1.47Hz,2H),7.44 (m,6H),5.97(d,J=5.87Hz,1H),5.12(t,J=4.89,4.89Hz,1H),4.31(m,1H),3.9( q,J=2.8,2.8,2.8Hz,1H),3.76(t,J=5.38,5.38Hz,1H),3.46(m,2H),3.28(m,2 H),3.21(ddd,J=12.23,4.4,3.13Hz,1H),3.14(s,3H),1.73(s,3H),1.05(s,9H)

[1091] General procedure for preparing compound 4-4

[1092]

[1093] Compound 4-3 (164 g, 179 mmol) and compound 4-2 (90.5 g, 163 mmol) were co-evaporated with ACN (450 mL x 3) in a 3000 mL single-necked round flask under Ar2, and Molecular sieves (10.0 g) were added to a single-necked flask, and ACN (1000 mL) was added under Ar pressure. The mixture was stirred at 25°C for 1 hour, and then DCI (28.9 g, 244 mmol) was added to the mixture. The mixture was stirred at 25°C for 0.5 h. HPLC showed that the starting material was completely consumed.

[1094] After the coupling reaction was complete, DDTT (37.7 g, 183 mmol) was added to the mixture. The reaction mixture was stirred at 25° C. for 0.5 h, and then DI H 2 O (0.12 mL) and PPh 3 (4.38 g, 16.7 mmol) were added to the mixture, and the mixture was stirred at 25° C. for 0.5 h. HPLC showed that the starting material was completely consumed.

[1095] Most of the ACN was removed by rotary evaporation, and the reaction was diluted with tBuOMe / EtOAc (3 / 1, 1500 mL). A yellow solid precipitated. The filtrate was filtered and washed with DI H2O (1000 mL x 2) and brine (600 mL x 2). The organic layer was dried and concentrated to dryness. Compound 4-4 (233.8 g, crude product, 80.1% purity) was obtained as a light yellow solid, which was used in the next step without further purification.

[1096] General procedure for the preparation of compounds 4-5

[1097]

[1098] Compound 4-4 (234 g, 167 mmol) was dissolved in anhydrous DCM (1600 mL), and then TCA (81.8 g, 501 mmol) and CySH (29.1 g, 250 mmol) were added at 0° C. The mixture was stirred at 0° C. for 0.5 hours. HPLC showed that the starting material was completely consumed.

[1099] The reaction was quenched by slowly adding NaHCO / H O (84.0 g NaHCO in 1200 mL DI H O). The mixture was stirred vigorously for 10 minutes and the two layers were separated. The H O layer was extracted with DCM (600 mL), and the combined organic layers were dried and concentrated to dryness. The mixture was redissolved in CH CN / DI H O (2 / 1, 1200 mL), and the CH CN / H O layer was washed with heptane / tBuOMe (4 / 1, 1000 mL x 5). Most of the CH CN was removed by rotary evaporation, and the mixture was then diluted with tBuOMe / EtOAc (2 / 1, 1500 mL). The mixture was washed with NaHCO / H O (1000 mL x 2 to remove DCI) and brine (600 mL x 2). The organic layer was dried over MgSO , filtered and concentrated to dryness. The crude product can be used in the next step without further purification. The crude product compound 4-5 (180 g, 98.2% yield, 94.6% purity) was obtained as a light yellow solid and used in the next step without further purification.

[1100] General procedure for the preparation of compounds 4-7

[1101]

[1102] Compound 4-5 (115 g, 104 mmol) and compound 4-6 (106 g, 115 mmol) were co-evaporated with ACN (500 mL x3) in a 2000 mL single-necked round flask under Ar2, and the mixture was added to the single-necked flask. Molecular sieves (45.0 g) were added under Ar2 pressure and ACN (1050 mL). The mixture was stirred at 25°C for 1 hour, and then DCI (18.6 g, 157 mmol) was added to the mixture. HPLC showed that the starting material was completely consumed.

[1103] After the coupling reaction was completed, tBuOOH (5.5 M, 38.1 mL) and H2O (10 mL) were added to the reaction mixture. The reaction mixture was stirred at 25°C for 30 minutes. HPLC showed that the starting material was completely consumed.

[1104] After the oxidation was complete, the reaction mixture was cooled to 0°C in an ice-water bath and held for 5 minutes, and commercial grade I2 oxidation solution (628.87 mL 0.05 M in pyridine / H2O, v / v 9:1) was added to the mixture over 20 minutes. The reaction mixture was stirred at 0°C for another 5 minutes. HPLC showed that the starting material was completely consumed.

[1105] The reaction mixture was slowly poured into a Na2S2O3 / H2O solution (Na2S2O3 33.1 g in 2300 mL H2O) and the solution was vigorously stirred for 10 minutes. The mixture was then diluted with a mixture solvent of 3000 mL EtOAc / tBuOMe (1 / 3). The organic layer was separated and washed with NaHCO3 / H2O (2000 mL) and brine (1000 mL). The organic layer was dried and concentrated to dryness. The crude product was redissolved in DCM / tBuOMe (1 / 1, 460 mL). The crude solvent was slowly dropped into heptane / t The desired product was precipitated in a solvent mixture of BuOMe (2 / 1, 2300 mL). The product was collected as a light yellow solid after filtration and the solid filter cake was washed with heptane / t The mixture was washed with BuOMe (1 / 1, 230 mL x 2) to obtain compound 7 (217 g, crude product, 87.6% purity) as a light yellow solid, which was used in the next step without further purification.

[1106] General procedure for the preparation of compounds 4-8

[1107]

[1108] Compound 4-7 (204 g, 104 mmol) was dissolved in anhydrous DCM (2000 mL), and then DCA (67.5 g, 524 mmol) and CySH (18.2 g, 157 mmol) were added at 0° C. The mixture was warmed to 25° C. and stirred for 2 hours. HPLC showed that the starting material was completely consumed.

[1109] The reaction was quenched by slowly adding Na2CO3 / H2O (77.4g Na2CO3, in 1200mL DI H2O). The mixture was stirred vigorously for 10 minutes and the two layers were separated. The H2O layer was extracted with DCM (600mL), and the combined organic layer was dried and concentrated to dryness. The mixture was redissolved in CH3CN / H2O (2 / 1, 900mL) and washed with heptane / tBuOMe=(4 / 1, 800mL x 5) CH3CN / H2O layer. Most of CN3CN was removed by rotary evaporator, and the mixture was then diluted with tBuOMe / EtOAc (1 / 3, 1800mL), and the mixture was washed with NaHCO3 / H2O (900mL x 2), brine (600mL). The organic layer was dried and concentrated to dryness. The crude product can be used in the next step without further purification. Compound 4-8 (130 g, 75.3% yield, 92.4% purity) was obtained as a light yellow solid and used in the next step without further purification.

[1110] General procedure for the preparation of 5'DMT-MOE CCGU-OH

[1111]

[1112] Compound 4-8 (153 g, 92.8 mmol) and compound 4-6 (89.9 g, 97.5 mmol) were co-evaporated with ACN (400 mL x 3) in a 3000 mL single-necked round flask under Ar2, and 3A molecular sieves (45.0 g) were added to the single-necked flask, and ACN (928 mL) was added under Ar2 pressure. The mixture was stirred at 25 ° C for 1 hour, and then Py-TFA (1 M, 139 mL) was added to the mixture. HPLC showed that the starting material was completely consumed.

[1113] After the coupling reaction was completed, DDTT (20.0 g, 97.5 mmol) was added to the mixture. The reaction mixture was stirred at 25°C for 0.5 hours and turned from yellow turbidity to yellow homogeneous solution, indicating the completion of the reaction. It was then cooled to 0°C in an ice bath and maintained for 30 minutes.

[1114] At the same time, a 500 mL round-bottom flask was charged with imidazole (127 g, 1.87 mol) and anhydrous THF (232 mL) and placed in an ice bath for 30 minutes. HF-Py (24.3 mL, 70.0% purity) was slowly added and then stirred for an additional 15 minutes (a homogeneous solution was obtained from this step). The solution from the previous step was slowly added to the reaction mixture from the previous reaction mixture via a peristaltic pump (1 mL / 5 min drip rate) and stirred at 0°C for 1-2 hours. The completion of the reaction can be monitored by HPLC. HPLC showed that the starting material was completely consumed. The mixture was diluted with EA (4500 mL) and slowly neutralized with NaHCO3 / H2O (2500 mL) at 0°C. The organic layer was separated and washed with NaHCO3 / H2O (2500 mL) and brine (2000 mL). The organic layer was dried and concentrated to dryness. The crude product was redissolved in DCM (600 mL). The crude solvent was slowly added dropwise to a tBuOMe (6000 mL) solution. The desired product was precipitated. The product was collected as a pale yellow solid after filtration, and the solid filter cake was washed with tBuOMe (600 mL x 2). 4-9 (5'DMT-MOE CCGU-OH) (190 g, 90.5% yield, 94.8% purity) was obtained as a pale yellow solid. HPLC-MS of MOE-CCGU tetramer (4-9) is shown in Figure 4 middle.

[1115] HPLC-MS method for compounds 4-9:

[1116] ●Column: ACQUITY UPLC BEH Shield RP18 column, 1.7μm, 2.1mm X 150mm;

[1117] Column temperature: 60°C

[1118] MS analysis was performed on a Thermo Orbitrap Fusion with a resolution of 60k and a mass range of 400 to 2000.

[1119] ●MS polarity: positive

[1120] Mobile phase A: 20 mM ammonium acetate in 25:75 ACN:water; Mobile phase B: acetonitrile;

[1121] Gradient:

[1122]

[1123]

[1124] C. Convergent Synthesis of Target Oligonucleotides

[1125] General procedure for preparing compound 5-1

[1126]

[1127] To a solution of Amidite Reagent (63.9 g, 212 mmol, 67.3 mL, 5.0 eq) and Compound 2-9 (100 g, 42.4 mmol, 1.0 eq) in THF (400 mL) was added Py-TFA (24.5 g, 127 mmol, 15.9 mL, 3.0 eq) at 0° C. The mixture was stirred at 0° C. for 1 hour. HPLC showed that Compound 2-9 was completely consumed.

[1128] The reaction mixture was transferred to a 500 mL separatory funnel (approximately 20 mL after combining the DCM wash volume). The crude product solution was slowly added dropwise from the funnel to a TBME / py solvent (v / v 100:0.7, 15 L) to initiate precipitation. This process took approximately 90 minutes. The pure product was collected as an off-white solid from the previous step. The product cake was washed with pure TBME (1.0 L x 3) and dried under vacuum. Compound 5-1 (106 g, 90.8% yield, 93% purity) was obtained as a white solid. Note that anhydrous THF was used. Compound 2-9 and Py-TFA were co-evaporated with THF three times. Pyridine was added to maintain a basic environment, thereby minimizing hydrolysis of the amidite product.

[1129] General procedure for preparing compound 5-2

[1130]

[1131] To compound 5-1 (122 g, 48.0 mmol, 1.5 eq) in DCM / ACN=2 / 1 (900 mL), DCI (9.46 g, 80.08 mmol, 2.5 eq) was added to molecular sieves (45.0 g) and compound 1-7 (115 g, 32.0 mmol, 1.0 eq), and the mixture was stirred at 10° C. for 1 h.

[1132] The reaction was monitored by TLC (complete conversion in 60 min). After the coupling reaction was complete, DDTT (9.87 g, 48.05 mmol, 1.5 eq) was added to the mixture. ℃The reaction mixture was stirred at 4°C for 30 minutes. The reaction mixture was filtered and the filtrate was concentrated to 1 / 2 volume. The residual solution was added to ACN (5.0 L). The product was precipitated. The filter cake was filtered and collected. The filter cake was washed with ACN (1 L) and dried under vacuum. Compound 5-2 (194 g, 99.6% yield) was obtained as a light yellow solid. Please note that acetonitrile and DCM were freshly redistilled. Compound 5-1 and compound 1-7 were co-evaporated with DCM / ACN three times.

[1133] For HPLC and LC-MS analysis of compound 5-2, it was deprotected using an aminolysis (NH3 / H2O) procedure similar to the aminolysis procedure disclosed below for compound 1 to obtain 5-2-a (DMTrO-TsTsAsCsCsAsCoCsCsU-OH). HPLC and LC-MS of compound 5-2-a are shown in Figure 5 middle.

[1134] General procedure for preparing compound 5-3

[1135]

[1136] Compound 5-2 (194 g, 31.9 mmol, 1.0 eq) and Molecular sieves (65.0 g) were added to a round flask, and anhydrous DCM (1.3 L) was added under Ar pressure. The mixture was stirred at 15°C for 1 hour, and then CySH (7.42 g, 63.8 mmol, 7.81 mL, 2.0 eq) and TCA (52.1 g, 319 mmol, 32.1 mL, 10.0 eq) were added to the mixture at 0°C.

[1137] The reaction was stirred at 0°C for 90 minutes (reaction checked by TLC), after which Py (30.2 g, 382 mmol, 30.9 mL, 12.0 eq) was added to the mixture. The mixture was stirred at 15°C for 5 minutes. 3A molecular sieves were removed by filtration. DCM solvent was slowly added to CH3CN (7.0 L), precipitating a pale yellow solid. Most of the DCM was removed by rotary evaporation, and the white precipitate was collected and washed with CH3CN (500 ml x 3). Compound 5-3 was obtained as a pale yellow solid (180 g, 97.6% yield). Note that the DCM was freshly redistilled. Compound 5-2 was co-evaporated with DCM three times. The product has good solubility in DCM, and it is important to remove most of the DCM before filtration. For HPLC and LC-MS analysis of compound 5-3, it was deprotected using an aminolysis (NH3 / H2O) procedure similar to the aminolysis procedure disclosed below for compound 1 to obtain 5-3-a (HO-TsTsAsCsCsAsCoCsCsU-OH). HPLC and LC-MS of compound 5-3-a are shown in Figure 6 middle.

[1138] HPLC-MS method of 5-3-a

[1139] Column: ACQUITY UPLC BEH C18 column, 1.7 μm, 2.1 mm x 50 mm;

[1140] Column temperature: 50°C

[1141] ●Ionization mode: API-ES;

[1142] ●Mass ranges from 1350 to 2300;

[1143] ●MS polarity: negative;

[1144] Mobile phase A: 5 mM TBuAA in 10% CH3CN, 1 μM EDTA; solution B: 5 mM TBuAA in 80% CH3CN, 1 μM EDTA;

[1145] Gradient

[1146]

[1147] General procedure for the preparation of compound 5-4

[1148]

[1149] Compound 3-5 (102 g, 55.3 mmol, 1.0 eq) was co-evaporated with THF (300 mL x 3). Py-TFA (32.0 g, 166 mmol, 3.0 eq) was co-evaporated with THF (300 mL x 3). In a 2000 mL round-bottom flask, compound 3-5 (102 g, 55.3 mmol, 1.0 eq) and amidite reagent (83.4 g, 276 mmol, 87.9 mL, 5.0 eq) in anhydrous THF (400 mL) were added and cooled to 0°C in an ice bath for 30 minutes. Activator Py-TFA (32.0 g, 166 mmol, 3.0 eq) was added, and the reaction mixture was stirred at 0°C for 1 hour. HPLC showed that the starting material was completely consumed.

[1150] From funnel into solvent TBME / heptane / Py ​​(95 / 5 / 1,15.8L), slowly drip crude product solution to carry out precipitation process.This process approximately needs 30 minutes.From the previous step, collect the pure product in off-white solid shape, with pure TBME (500mLx 3) washing product filter cake and by high vacuum drying 3 hours.

[1151] Compound 5-4 was obtained as a white solid (107 g, 52.4 mmol, 94.6% yield). Note that THF was anhydrous, and compound 3-5 and Py-TFA were co-evaporated with anhydrous THF three times.

[1152] General procedure for the preparation of compound 5-5

[1153]

[1154] Compound 5-3 (177 g, 30.6 mmol, 1.0 eq), compound 5-4 (106 g, 52.0 mmol, 1.7 eq) and Molecular sieves (60 g) were added to a round flask, and anhydrous DCM (850 mL, HO <50 ppm) and ACN (425 mL, HO <50 ppm) were added under Ar pressure. The mixture was stirred at 15°C for 1 hour, and then DCI (9.05 g, 76.6 mmol, 2.5 eq) was added to the mixture. The mixture was stirred at 15°C for 0.67 h. TLC (DCM:MeOH = 10:1) indicated complete consumption of compound 5-3.

[1155] After the coupling reaction was completed, DDTT (10.7 g, 52.0 mmol, 1.7 eq) was added to the mixture and the reaction mixture was stirred at 15° C. for 10 minutes.

[1156] Remove by filtration The mixture was stirred for 2 h at 4 ℃ for 10 minutes and then stirred for 2 h. The mixture was stirred for 30 minutes. The mixture was stirred for 10 minutes. The mixture was stirred for 20 minutes ...30 minutes. The mixture was stirred for 20 minutes.

[1157] For HPLC and LC-MS analysis of compound 5-5, it was deprotected using an aminolysis (NH3 / H2O) procedure similar to the aminolysis procedure disclosed below for compound 1 to obtain 5-5-a (DMTrO-UsTsTsCsTsTsAsCsCsAsCoCsCsU-OH). HPLC and LC-MS of compound 5-5-a are shown in Figure 7 middle.

[1158] HPLC-MS method of 5-5-a

[1159] Column: ACQUITY UPLC BEH C18 column, 1.7 μm, 2.1 mm x 50 mm;

[1160] Column temperature: 50°C

[1161] ●Ionization mode: API-ES;

[1162] ●Mass ranges from 1350 to 2300;

[1163] ●MS polarity: negative;

[1164] Mobile phase A: 5 mM TBuAA in 10% CH3CN, 1 μM EDTA; solution B: 5 mM TBuAA in 80% CH3CN, 1 μM EDTA;

[1165] Gradient:

[1166]

[1167]

[1168] General procedure for the preparation of compounds 5-6

[1169]

[1170] Compound 5-5 (234 g, 30.2 mmol, 1.0 eq) and Molecular sieves (12.5 g) were added to a round flask, and anhydrous DCM (1500 mL, H2O <50 ppm) was added under Ar pressure. The mixture was stirred at 15°C for 1 hour, and then CySH (10.5 g, 90.5 mmol, 11.1 mL, 3.0 eq) and TCA (59.2 g, 362 mmol, 12.0 eq) were added to the mixture.

[1171] The reaction was stirred at 0°C for 60 min (checked by TLC), and then Py (35.8 g, 452 mmol, 36.5 mL, 15.0 eq) was added to the mixture. The mixture was stirred at 15°C for 5 min,

[1172] Remove by filtration Molecular sieves. DCM solvent was slowly added to 10 L of CH3CN to precipitate a pale yellow solid. Most of the DCM was removed by rotary evaporation, and the white precipitate was collected and washed with CH3CN (500 ml x 3). Compound 5-6 was obtained as a pale yellow solid (210 g, 93.3% yield).

[1173] For HPLC and LC-MS analysis of compound 5-6, it was deprotected using an aminolysis (NH3 / H2O) procedure similar to the aminolysis procedure disclosed below for compound 1 to obtain 5-6-a (HO-UsTsTsCsTsTsAsCsCsAsCoCsCsU-OH). HPLC and LC-MS of compound 5-6-a are shown in Figure 8 middle.

[1174] HPLC-MS method of 5-6-a

[1175] Column: ACQUITY UPLC BEH C18 column, 1.7 μm, 2.1 mm x 50 mm;

[1176] Column temperature: 50°C

[1177] ●Ionization mode: API-ES;

[1178] ●Mass ranges from 1350 to 2300;

[1179] ●MS polarity: negative;

[1180] Mobile phase A: 5 mM TBuAA in 10% CH3CN, 1 μM EDTA; solution B: 5 mM TBuAA in 80% CH3CN, 1 μM EDTA;

[1181] Gradient:

[1182]

[1183] General procedure for the preparation of compounds 5-7

[1184]

[1185] To a 2000 mL round-bottom flask, compound 4-9 (130 g, 57.8 mmol, 1.0 eq) and amidite reagent (87.2 g, 289 mmol, 91.9 mL, 5.0 eq) in anhydrous THF (520 mL) were added and cooled to 0°C in an ice bath for 30 min. The activating agent, Py-TFA (33.5 g, 173 mmol, 34.2 mL, 3.0 eq), was added, and the reaction mixture was stirred at 0°C for 1 hour. HPLC indicated complete consumption of the starting material.

[1186] The crude product solution was slowly added from the funnel to the solvent TBME / heptane / Py ​​(95 / 5 / 1, 15850 mL) to carry out the precipitation process. This process took about 30 minutes. The pure product was collected as an off-white solid from the previous step, and the product filter cake was washed with pure TBME (500 mL x 3) and dried under high vacuum for 3 hours.

[1187] Compound 5-7 was obtained as a white solid (133 g, 93.9% yield).

[1188] General procedure for the preparation of compound 1, fully protected ASO 9

[1189]

[1190] Compound 5-6 (242 g, 32.5 mmol, 1.0 eq), compound 5-7 (135 g, 55.2 mmol, 1.7 eq) and To molecular sieves (80.0 g) were added anhydrous DCM (1200 mL, HO <50 ppm) and ACN (600 mL, HO <50 ppm). The mixture was stirred at 15°C for 1 hour, and then DCI (9.60 g, 81.2 mmol, 2.5 eq) was added. The mixture was stirred at 15°C for 1 hour. TLC confirmed the reaction was complete.

[1191] After the coupling reaction was completed, DDTT (11.3 g, 55.2 mmol, 1.7 eq) was added to the mixture. The reaction mixture was stirred at 15 °C for 10 minutes. The mixture was removed by filtration. The mixture was stirred for 2 h at 40 ℃ for 30 min. Molecular sieves were added and the reaction was diluted with 10 L CH3CN (a pale yellow solid precipitated). DCM was removed by rotary evaporation, and the pale yellow solid was collected and washed with CH3CN (500 mL x 3). Compound 1 (264 g, 82.8% yield) was obtained as a pale yellow solid.

[1192] For HPLC and LC-MS analysis of compound 1, it was deprotected using the following aminolysis (NH3 / H2O) procedure to obtain 1-a (DMTrO-CsCoGsUsUsTsTsCsTsTsAsCsCsAsCoCsCsU-OH). HPLC and LC-MS of compound 1-a are shown in Figure 9 middle.

[1193] HPLC-MS method of 1-a

[1194] Column: ACQUITY UPLC BEH C18 column, 1.7 μm, 2.1 mm x 50 mm;

[1195] Column temperature: 50°C

[1196] ●Ionization mode: API-ES;

[1197] ●Mass ranges from 1350 to 2300;

[1198] ●MS polarity: negative;

[1199] Mobile phase A: 5 mM TBuAA in 10% CH3CN, 1 μM EDTA; solution B: 5 mM TBuAA in 80% CH3CN, 1 μM EDTA;

[1200] Gradient:

[1201]

[1202]

[1203] Deprotection and aminolysis of compound 1 and fully protected ASO 9

[1204]

[1205] To a 1-L flask, compound 1 (64 g) and CH3CN:Et3N (640 ml, v / v) were added. The mixture was stirred at 25°C for two hours, after which the solvent was removed by rotary evaporation. 500 ml of NH4OH (~30% wt) was added to the flask and the mixture was stirred at 25°C for approximately 30 minutes. The resulting solution was transferred to a 1-L glass pressure flask and the mixture was heated to 65°C for 5 hours. The mixture was cooled to ambient temperature for downstream purification.

[1206] ASO 9 purification process:

[1207] The DMT on ASO 9 from aminolysis (2 L) was diluted with 1111 mM ammonium sulfate solution (18 L) to a final ammonium sulfate concentration of 1000 mM. The suspension was then filtered through a depth filter, which was wetted, rinsed and equilibrated with 3 bed volumes of a solution (1000 mM ammonium sulfate, 50 mM tris, pH 8.5).

[1208] For the hydrophobic interaction chromatography (HIC) step, the HIC column of 20 cm bed height (BH) x 14 cm internal diameter (ID) is equilibrated with 4 column volumes (CV) of equilibrium buffer (1000 mM ammonium sulfate, 50 mM tris, pH 8.5). The filtrate from the deep filter is loaded onto the column. The column is tracked with 4 CV of buffer (1000 mM ammonium sulfate, 50 mM tris, pH 8.5) and washed with 100 cm / hr of buffer (800 mM ammonium sulfate, 50 mM tris, pH 8.5) until the UV gate (2 mm flow cell) reaches 0.5 AU. Once the UV gate reaches 0.5 AU, the column is washed with the same buffer (800 mM ammonium sulfate, 50 mM tris, pH 8.5) for 2 or more CVs. For the washing step, the flow rate is 100 cm / hr. The column was eluted with 8 CV of buffer (50 mM ammonium sulfate, 50 mM tris, pH 8.5) to provide DMT on ASO 9. The column was stripped with 4 CV of deionized water. The column was washed with 3 CV of 1N sodium hydroxide and stored in 0.1N sodium hydroxide. The HIC process was run at a speed of 200 cm / hr, but the wash was run at a speed of 100 cm / hr.

[1209] The HIC eluate (~9 L) containing DMT on ASO 9 was cooled to 10°C and 25% (w / w) citric acid solution (0.9 L) was added to adjust the pH of the mixture to 2.7. The mixture was stirred at 10°C for 4.5 hours and 5N sodium hydroxide (0.8 L) was added to adjust the pH to 8.5. The mixture was then filtered using a 0.22 μm sterilizing filter to remove the DMT-OH byproduct. The filtrate was then purified by anion exchange chromatography.

[1210] The 15cm BH x 14cm ID AEX post is equipped with a high salt buffer solution (2000mM sodium chloride, 250mM tris, pH 8.5) for 2 CV and balanced with a balance buffer solution (100mM sodium chloride, 50mM tris, pH 8.5) for 4 CV. The filtrate from the trityl removal step is diluted with water to a conductivity of about 20mS and loaded onto the post. Buffer solution (300mM sodium chloride, 50mM tris, pH 8.5) is used to wash the post until the UV gate (2mm flow cell) reaches 0.4AU. Continuous washing of the same buffer solution (300mM sodium chloride, 50mM tris, pH 8.5) for more than 4 CV is performed. Buffer solution (525mM sodium chloride, 50mM tris, pH 8.5) elution post is used to provide ASO 9 solution. The column was stripped with 4 CV of buffer (2000 mM NaCl, 250 mM tris, pH 8.5), then washed with 3 CV of 1 N NaOH and stored in 0.1 N NaOH. The AEX process was run at 200 cm / hr. The HPLC-MS of ASO 9 is shown in Figure 12 middle.

[1211] Example 2. Synthesis of ASO (10-mer) using a 5' to 3' extension strategy

[1212] 1. General Synthesis of 5'P-Amide Fragments (5-mers)

[1213]

[1214] Starting from 1-2A and phosphoramidite, compound 2-2A was obtained in >98% yield using a procedure similar to the synthesis of compound 1-8a described above.

[1215] 2. Synthesis of ASO 6-mer

[1216]

[1217] Using a procedure similar to that used for the synthesis of fragment 1-9 above, compound 4-2A was coupled with compound 3-2A to give a 6-mer (compound 5-2A) in >98% yield, followed by the desilylation procedure described in step 3 of the synthesis of 4-9. The mass spectrum of the ASO 6-mer before desilylation is shown in Figure 13 middle.

[1218] 3. Synthesis of ASO 10-mer

[1219]

[1220] Using a similar procedure to the synthesis of fragments 1-9 described above, ASO 5-mer 6-2A was coupled with 5-mer fragment 2-2A to give ASO 10-mer in >98% yield. The mass spectrum of ASO 10-mer is shown in Figure 14 middle.

[1221] 4. Convergent Synthesis of the ASO 15-mer 5'-ACoAGATATTTTTGTT-3'-OH

[1222]

[1223] The ASO 15-mer was synthesized using a similar procedure as described above based on the convergent synthesis method shown in the above scheme. The three fragments used in the convergent synthesis were: 5'-LHPG-ACoAGA-3'-OH (fragment 1); 5'-P-TATTT-3'-OTBDPS (fragment 2); and 5'-P-TTGTT-3'-OTBDPS (fragment 3).

[1224] 1) Synthesis of fragment 1: 5'-LHPG-ACoAGA-3'-OH(1-3A)

[1225]

[1226] Fragment 1 (Compound 1-3A) was synthesized as shown in the above scheme using a similar procedure as described above. The mass spectrum of the deprotected fragment 1 (Compound 1-3A-H) is shown in Figure 15 middle.

[1227]

[1228] 2) Synthesis of Fragment 2: 5'-P-TATTT-3'-OTBDPS (Compound 2-3A)

[1229] Fragment 2 was synthesized using a procedure similar to that described above for the synthesis of 2-2A.

[1230] 3) Synthesis of Fragment 3: 5'-P-TTGTT-3'-OTBDPS (Compound 3-3A)

[1231] Fragment 3 was also synthesized using a procedure similar to that described above for the synthesis of 2-2A.

[1232] 4) Convergent synthesis of ASO 15-mers:

[1233] ASO 15-mers were synthesized using the liquid phase convergent synthesis method described herein. Fragment 1 was coupled with fragment 2 and then thiolated to form compound 4-3A. Desilylation of compound 4-3A removed the 3'-TBDPS group to produce compound 5-3A, which was then coupled with fragment 3 and then thiolated to produce ASO 15-mer 6-3A. The formation of 4-3A and 5-3A was confirmed by LC-MS analysis of the corresponding deprotected products 4-3A-H and 5-3A-H, which were formed by treating compound 4-3A or 5-3A with NH3 / H2O. The mass spectra of compounds 4-3A-H and 5-3A-H are shown in Figure 5, respectively. Figure 16 and Figure 17 The aminolysis reaction of compounds 4-3A and 5-3A is shown below:

[1234]

[1235]

[1236] 5) Deprotection and aminolysis of ASO 15-mer 6-3A

[1237]

[1238] Using a similar deprotection and aminolysis procedure as described above for the DMT synthesis of ASO 9, ASO 15-mer 6-3A was treated with NH4OH to afford a mixture of 6a and 6b, indicating complete removal of the 5'-LHPG protecting group and partial removal of the TBDPS group at the 3'-end (see Figure 18 ).

[1239] Example 3: Study on deamination during 5'OH deprotection:

[1240] Detritylation of UCC trimers and CC dimers

[1241] 1. Study on deamination of UCC trimer:

[1242] The detritylation of the UCC trimer was studied under different reaction conditions to find the optimal conditions and reagents required to minimize the deamination side reaction. Table 1 shows a comparison of different reaction conditions and the amount of undesirable deamination products under these conditions. Figure 9 Visible, use Molecular sieves and quenching the reaction with pyridine resulted in <0.5% deamination, compared to 7% deamination without sieves and 10% deamination without sieves and pyridine quenching.

[1243]

[1244] Table 1: Comparison of reaction conditions and deamination products of UCC trimers

[1245]

[1246] 2. Study on deamination of CC dimer:

[1247] Similar to the studies performed above on the UCC trimer, the CC dimer was detritylated using various reagents and conditions to minimize or avoid deamination. Figure 11 It can be seen that when DCA, thiol and When the molecular sieves were added, no deamination product was detected after 14 hours at room temperature even when water was added. On the other hand, when no molecular sieves and water were added, 4.46% of the deamination product was obtained, and when water was added without adding molecular sieves for 14 hours at room temperature, 49% of the deamination product was obtained.

[1248]

[1249] Table 2: Comparison of reaction conditions and deamination products of CC dimers

[1250]

[1251] 3. Deamination results from detritylation of fragment synthesis

[1252] Pentamer MOE DMTO-AC o CCU-OH (from DMTO-ACCCU-OLHPG) contains approximately 10% of a desamino impurity (Ia, Ib, and Ic combined, ratio not determined) (Scheme A).

[1253] Scheme A. High levels of deamination impurities in DMTO-ACCCU-OLHPG

[1254]

[1255] The synthesis of its analogue HO-CCC-OTBDPS was then completed using the same procedure, and this trimer product was found to contain at least 10% of total deaminated impurities (Scheme B).

[1256] Scheme B: High levels of deamination impurities in HO-CCC-OTBDPS

[1257]

[1258] MOE fragment-LHPG (I): Based on the above results, pentamer MOE DMTO-AC o CCU-OH, was repeated with a modified detritylation procedure. In this synthesis, the solution was After drying over molecular sieves, acid was added to each detritylation reaction. Deamination by-products were completely suppressed (Table 3).

[1259]

[1260] Table 3. Effect of drying on MOE DMTO-AC o Effect of Deamination Impurities in CCU-OH

[1261]

[1262] Example 4. Synthesis of ASO 8

[1263] Fully protected ASO 8, having a DMT group at the 5'-end and a LHPS group at the 3'-end, was prepared using a similar procedure as described for ASO 9 in Example 1. The oligonucleotide fragments used for the synthesis are shown in the scheme below.

[1264] 1. Synthesis of ASO 8 by 5+6+(4+5) coupling

[1265]

[1266] 2. Synthesis of ASO 8 by 5+6+4+5 coupling

[1267]

[1268] The DMT on ASO 8 was detritylated and purified using a similar procedure as described for ASO 9 in Example 1. The HPLC-MS of ASO 8 is shown in Figure 19 middle.

[1269] HPLC-MS method for ASO 8:

[1270] Column: ACQUITY UPLC BEH C18 column, 1.7 μm, 2.1 mm x 50 mm;

[1271] Column temperature: 50°C

[1272] ●Ionization mode: API-ES;

[1273] ●Mass ranges from 1350 to 2300;

[1274] ●MS polarity: negative;

[1275] Mobile phase A: 5 mM TBuAA in 10% CH3CN, 1 μM EDTA; solution B: 5 mM TBuAA in 80% CH3CN, 1 μM EDTA;

[1276] Gradient:

[1277]

[1278] Example 5. Desilylation studies

[1279] A new, simple, mild, and clean deprotection method for 3'-OTBDPS has been developed to minimize impurity formation. The presence of imidazole was found to greatly accelerate the deprotection of TBDPS and minimize impurities. Comparative studies described below show that desilylation using known conditions results in the formation of various byproducts, such as N-2 and diol byproducts. In contrast, the new desilylation method significantly reduces these byproducts.

[1280] a. Desilylate the CCGU tetramer using known desilylation conditions:

[1281]

[1282] 250 mg of CCGU tetramer was treated with 20 equivalents of HF and 30 equivalents of pyridine at 0° C. for 7 hours. N-2 and diol byproducts were observed. Desilylation reactions using other known methods such as TBAF or CsF produced complex mixtures.

[1283] The presence of N-2 and diol byproducts can significantly affect the purity of the final target oligonucleotide.

[1284] b. Desilylation of CCGU tetramer under HF / imidazole desilylation conditions:

[1285]

[1286] In contrast to the desilylation reaction performed using the known conditions described above, desilylation with HF / imidazole resulted in a complete desilylation reaction within 2 hours, with less than 0.5% of the diol and N-2 side products observed. Furthermore, only 5 equivalents of HF were required to achieve complete conversion of the starting material, compared to the 20 equivalents of HF required using known desilylation conditions.

[1287] Example 6. Synthesis of 5'-DMT-GUUUUUGCAA-NO2-benzoyl via H-phosphonate chemistry

[1288]

[1289] SM 1 (3.78 g) and SM 2 (2.64 g) were dissolved in 20 ml of CH 3 CN. Pyridine 2.4 ml and pivaloyl chloride 0.62 ml were slowly added to the mixture at 0° C. After stirring at 0° C. for 40 minutes, I 2 / py (0.05 M 40 ml) was added to the mixture. After stirring at 0° C. for 30 minutes, the reaction was quenched with Na 2 S 2 O 3 / H 2 O solution to obtain 5'-DMT-GUUUUUGCAA-NO 2 -benzoyl as a light yellow solid. The structure of 5'-DMT-GUUUUUGCA A-NO 2 -benzoyl was confirmed by MS (see Figure 20 ).

[1290] Example 7. Feasibility Assessment of Convergent Solution-Phase Synthesis of ASO 9 Analogs with Various PO / PS Bonds

[1291] HPLC method (A).

[1292] Column: Xbridge Shield RP18 5μm, 2.1mm x 50mm column.

[1293] Column temperature: 40°C;

[1294] Mobile phase:

[1295] Solution A: 10 mM NH4HCO3 aqueous solution

[1296] Solution B: 100% acetonitrile

[1297] gradient:

[1298]

[1299] HPLC method (B).

[1300] Column: Xbridge C18 3.5 μm, 4.6 mm x 150 mm column.

[1301] Column temperature: 40°C;

[1302] Mobile phase:

[1303] Solution A: 10 mM NH4HCO3 aqueous solution

[1304] Solution B: 100% acetonitrile

[1305] gradient:

[1306]

[1307] HPLC method (C).

[1308] Column: Xbridge Shield RP18 5μm, 2.1mm x 50mm column.

[1309] Column temperature: 40°C;

[1310] Mobile phase:

[1311] Solution A: 10 mM NH4HCO3 aqueous solution

[1312] Solution B: 100% acetonitrile

[1313] gradient:

[1314]

[1315] HPLC-MS method (D).

[1316] Column: Xbridge Shield RP18 5μm, 2.1mm x 50mm column.

[1317] Column temperature: 40°C;

[1318] Mass ranges from 100 to 1000;

[1319] MS polarity: negative

[1320] Mobile phase:

[1321] Solution A: 10 mM NH4HCO3 aqueous solution

[1322] Solution B: 100% acetonitrile

[1323] gradient:

[1324]

[1325]

[1326] HPLC-MS method (E).

[1327] Column: Luna C18 3.0 μm, 2.0 mm x 30 mm column.

[1328] Column temperature: 40°C;

[1329] Mass ranges from 100 to 2000;

[1330] MS polarity: positive

[1331] Mobile phase:

[1332] Solution A: 0.037% TFA (v / v) in water Solution B: 0.018% TFA (v / v) in acetonitrile

[1333] gradient:

[1334]

[1335]

[1336] HPLC-MS method (F).

[1337] Column: Xbridge Shield RP18 5μm, 2.1mm x 50mm column.

[1338] Column temperature: 40°C;

[1339] Mass ranges from 100 to 1000;

[1340] MS polarity: positive

[1341] Mobile phase:

[1342] Solution A: 10 mM NH4HCO3 aqueous solution

[1343] Solution B: 100% acetonitrile

[1344] gradient:

[1345]

[1346]

[1347] HPLC-MS method for imide compounds 7-1-6a, 7-3-10a, and 7-4-8a (G).

[1348] Column: ACQUITY UPLC BEH C18 1.7 μm, 2.1 mm x 50 mm column.

[1349] Column temperature: 50°C;

[1350] Mass ranges from 500 to 2200;

[1351] MS polarity: negative

[1352] Mobile phase:

[1353] Solution A: 5 mM tributylamine acetate (TBuAA) in 10% CH CN, 1 μ m EDTA;

[1354] Solution B: 5 mM TBuAA in 80% CH3CN, 1 μM EDTA

[1355] gradient:

[1356]

[1357] ASO 9 analogs with different numbers of P=O / S bonds were synthesized.

[1358]

[1359] A. Preparation of 5' fragment

[1360] 1. Preparation of 5'-DMTr-CCGU-OH or 5'-OH-CCGU-TBDPS Quadmer (Fragment 4)

[1361] Synthesis of compound 7-1-2

[1362]

[1363] To a solution of compound 7-1-1 (8.50 g, 13.7 mmol, 1.00 eq) and imidazole (4.68 g, 68.7 mmol, 5.00 eq) in DCM (85 mL) was added TBDPSCl (4.15 g, 15.1 mmol, 3.88 mL, 1.10 eq). The mixture was stirred at 25° C. for 16 h. TLC (petroleum ether:ethyl acetate = 1:2, product: R f =0.55) indicated that compound 7-1-1 was completely consumed and a new spot was formed. According to TLC, the reaction was clean. Propan-2-ol (825 mg, 13.7 mmol, 1.00 eq) was added and the mixture was stirred at 25°C for 0.5 hours.

[1364] To the above solution was added dodecan-1-thiol (7.23 g, 35.7 mmol, 8.56 mL, 1.30 eq) cooled to 0°C, and then TFA (25.0 g, 219 mmol, 16.2 mL, 8.00 eq) was added to the reaction mixture at 0°C. The mixture was stirred at 0°C for 1 h. TLC (petroleum ether:ethyl acetate = 1:2, product: R f =0.28) indicated that the starting material was completely consumed and a new spot was formed. According to TLC, the reaction was clean.

[1365] The reaction mixture was quenched by adding NaHCO (500 mL), then diluted with DCM (100 mL) and extracted with NaHCO (200 mL). The combined organic layers were washed with brine 200 mL (100 mL x 2), dried over MgSO, filtered and concentrated under reduced pressure to give residue. The crude product was dissolved in DCM (600 mL) and placed in a 1000 mL separating funnel.

[1366] The crude product was dissolved in 100 mL of ACN and 50 mL of DI water, and the mixture was extracted with heptane:TBME=4:1 (120 mL x 4). (TLC indicated that the product was clean in ACN and DI water). The product was in ACN and water. The mixture was extracted with TBME (100 mL), and the organic layer was dried and concentrated to dryness to give a white solid. Compound 7-2 (14.0 g, 23.4 mmol, 85.1% yield, 92.7% purity) was obtained as a white foam.

[1367] HPLC (Method A): RT = 3.446 min; LCMS (Method F): RT = 1.371 min;

[1368] m / z: [M+H] of compound 7-1-2 + =555.3.

[1369] Synthesis of compound 7-1-3

[1370]

[1371] Compound 7-1-2 (12.0 g, 21.6 mmol, 1.00 eq and MOE G amide (21.7 g, 23.8 mmol, 1.10 eq) were co-evaporated with ACN (10 mL x 3) in a 250 mL single-necked round flask under argon, and ACN (60 mL) was added under argon pressure. Molecular sieves (3.00 g) were added to a single-necked flask. The mixture was stirred at 25°C for 1 hour, and then DCI (3.83 g, 32.4 mmol, 1.50 eq) was added to the mixture. The reaction mixture was stirred at 25°C for 1 hour. TLC (dichloromethane:methanol = 15:1, product: R f =0.39) indicated that compound 7-1-2 was completely consumed and a new spot was formed. According to TLC, the reaction was clean. HPLC (product: RT = 7.199 min; starting material: RT = 5.194 min) indicated that compound 2 was completely consumed.

[1372] To the above solution was added BuOOH (3.90 g, 43.2 mmol, 4.15 mL, 2.00 eq). The mixture was stirred at 25°C for 0.5 h. HPLC (7-1-3, product: RT = 6.869 min; starting material: RT = 7.199 min) indicated the reaction was complete. The reaction mixture was poured into a solution of NaHCO₃ and Na₂SO₃ (10.0 eq NaHCO₃ and 5.00 eq Na₂SO₃ in 400 mL DI water), then diluted with DCM (100 mL). The layers were separated, and the organic layer was washed with NaHCO₃ (200 mL), brine (200 mL), dried, filtered, and concentrated. Compound 7-1-3 (32.0 g, 18.9 mmol, 87.6% yield, 82.0% purity) was obtained as a light yellow foam.

[1373] HPLC (method A): RT = 6.868 min; LCMS (method F): RT = 1.501, 1.520 min; m / z: [M+H] of compound 7-1-3 + =1383.5.

[1374] General procedure for the preparation of compound 7-1-3a

[1375]

[1376] Compound 7-1-3 (25.0 g, 18.0 mmol, 1.00 eq) in DCM (120 mL) was added to dodecan-1-thiol (4.75 g, 23.4 mmol, 5.63 mL, 1.30 eq) at 0°C, and then TFA (16.4 g, 144 mmol, 10.7 mL, 8.00 eq) was added to the reaction mixture at 0°C. The mixture was stirred at 0°C for 1 h. TLC (dichloromethane:methanol=10:1, product: R f =0.24) indicated that compound 7-1-3 was completely consumed and formed a new spot. According to TLC, the reaction was clean.

[1377] The reaction mixture was poured into NaHCO 3 solution (10.0 eq NaHCO 3 in 300 mL DI water), then the mixture was diluted with DCM (100 mL) and the two layers were separated, the organic layer was washed with NaHCO 3 (100 mL), brine (100 mL), dried, filtered and concentrated.

[1378] The mixture was redissolved in CH3CN:HO (2:1, 70 mL), and the CH3CN / HO layer was washed with heptane:MTBE=4:1 (100 mL x 4), and then the CH3CN and HO layers were diluted with EtOAc (100 mL), and the organic layer was washed with brine (100 mL), dried, filtered and concentrated. Compound 7-1-3a (17.0 g, 15.0 mmol, 83.3% yield, 95.8% purity) was obtained as a light yellow foam.

[1379] HPLC (Method A): RT = 6.778 min; LCMS (Method F): RT = 1.322 min;

[1380] m / z: [M+H] of compound 7-1-3a + =1081.4.

[1381] Synthesis of compound 7-1-4

[1382]

[1383] Compound 7-1-3a (17.0 g, 15.7 mmol, 1.00 eq) and MOE C amide (15.9 g, 17.2 mmol, 1.10 eq) were co-evaporated with ACN (50 mL x 3) in a 250 mL single-necked round bottle under Ar, and the mixture was added to the single-necked bottle. Molecular sieves (4.00 g) were added to the mixture, and ACN (85 mL) was added under Ar pressure. The mixture was stirred at 25°C for 1 h, and then DCI (2.78 g, 23.5 mmol, 1.50 eq) was added to the mixture. The reaction mixture was stirred at 25°C for 1 hour. HPLC (product: RT = 7.932, 8.001 min; starting material: RT = 5.111, 5.169 min) showed that the starting material was completely consumed.

[1384] To the above solution was added BuOOH (4.05 g, 31.4 mmol, 4.31 mL, 70.0% purity, 2.00 eq). The mixture was stirred at 25°C for 0.5 h. HPLC (7-1-4, product: RT = 7.746, 7.832, 7.916 min; starting material: RT = 7.932, 8.001 min) showed that the starting material was completely consumed.

[1385] The reaction mixture was poured into a NaHCO solution (10.0 eq NaHCO and 5.00 eq NaSO in 400 mL DI water), then diluted with EtOAc (100 mL), and the two layers were separated. The organic layer was washed with NaHCO (200 mL), brine (200 mL), dried, filtered, and concentrated. Compound 7-1-4 (33.4 g, 12.7 mmol, 81.3% yield, 73.5% purity) was obtained as a white solid.

[1386] HPLC (method A): RT = 7.746, 7.832, 7.916 min; LCMS (method F): RT = 1.603 min; m / z: [M+H] of compound 7-1-4 + =1917.7.

[1387] Synthesis of compound 7-1-4a

[1388]

[1389] To compound 7-1-4 (23.0 g, 11.9 mmol, 1.00 eq) in ACN (120 mL) at 0°C was added dodecan-1-thiol (3.15 g, 15.5 mmol, 3.73 mL, 1.30 eq), and then TFA (10.9 g, 95.8 mmol, 7.10 mL, 8.00 eq) was added to the reaction mixture at 0°C. The mixture was stirred at 0°C for 1 h. TLC (dichloromethane:methanol=7:1, product: R f =0.40) indicated that compound 7-1-4 was completely consumed and formed a new spot. According to TLC, the reaction was clean.

[1390] The reaction mixture is poured into NaHCO (10.0eq NaHCO , in 400mL DI water) in, then use EtOAc (200mL) dilution mixture, and separate two layers, by organic layer NaHCO the aqueous solution (150mL), salt solution (150mL) washing, dry, filter and concentrate.Crude product is redissolved in DCM (50mL).Crude solvent is slowly added dropwise in isopropyl ether (500mL) solvent.Deposit required product.Collect the product of light yellow solid after filtration, and solid filter cake is washed with isopropyl ether (50mL x2).Obtain compound 7-1-4a (22.0g, 11.1mmol, 93.0% productive rate, 81.9% purity) of light yellow solid.

[1391] After HPLC purification, compound 7-1-4a (13.0 g, 8.04 mmol, 86.9% yield, 98.3% purity) was obtained as a white foam. HPLC (Method A): RT = 6.127, 6.193, 6.277 min, and LCMS (Method F): RT = 1.431 min; m / z: [M+H] + =1615.5.

[1392] Preparation of CCGU 4-mer

[1393]

[1394] Compound 7-1-4a (13.0 g, 8.04 mmol, 1.00 eq) and MOE C amide (8.17 g, 8.84 mmol, 1.10 eq) were co-evaporated with ACN (30 mL x 3) in a 250 mL single-necked round flask under Ar, and Molecular sieves (3.50 g) were added to a single-necked flask, and ACN (65 mL) was added under Ar pressure. The mixture was stirred at 25° C. for 1 h, and then DCI (1.42 g, 12.0 mmol, 1.50 eq) was added to the mixture. The mixture was stirred at 25° C. for 1 h.

[1395] HPLC (product: RT = 8.547 min; starting material: RT = 6.127, 6.193, 6.277 min) showed that the starting material was completely consumed.

[1396] To the above solution was added BuOOH (2.07 g, 16.0 mmol, 2.20 mL, 70.0% purity, 2.00 eq) at 25° C. The mixture was stirred at 25° C. for 0.5 h. HPLC (7-5, product: RT = 8.400 min; starting material: RT = 8.547 min) showed that the starting material was completely consumed.

[1397] The reaction mixture was poured into NaHCO and NaSO solution (10.0 eq NaHCO and 5.00 eq NaSO in 500 mL DI water), then the mixture was diluted with EtOAc (300 mL), and the two layers were separated. The organic layer was washed with NaHCO (200 mL) and brine (200 mL), dried, filtered and concentrated. The crude product was redissolved in DCM (50 mL). The crude solvent was slowly added dropwise to isopropyl ether (600 mL) solvent. The desired product was precipitated. After filtration, a light yellow solid product was collected, and the solid filter cake was washed with isopropyl ether (50 mL x 2). After HPLC purification, compound 7-1-5 (CCGU) (15.0 g, 5.94 mmol, 73.9% yield, 97.3% purity) was obtained as a yellow solid. HPLC (method B): RT = 8.400 min, LCMS (method F): RT = 1.665 min; m / z: [M+2H] 2+ / 2=1226.4

[1398] Preparation of DMTr-CCGU-OH (7-1-6)

[1399]

[1400] To a solution of 7-1-5 (6.00 g, 2.44 mmol, 1.00 eq) in ACN (35 mL) and then pyridine was added dropwise hydrofluoric acid (698 mg, 24.4 mmol, 634 uL, 70.0% purity, 10.0 eq) and imidazole (3.33 g, 48.8 mmol, 20.0 eq) in THF (8 mL) at 0°C. The mixture was stirred at 0°C for 3 h. TLC (dichloromethane:methanol=10:1, product: R f =10:1) indicated that compound 7-1-5 was completely consumed and two new spots were formed. According to TLC, the reaction was chaotic.

[1401] The reaction mixture was dissolved in EtOAc (20 mL). The organic layer was washed with saturated aqueous NaHCO3 (20 mL x 2), brine (20 mL) and dried over anhydrous Na2SO4, filtered and concentrated under vacuum. The crude product was redissolved in DCM (5 mL). The crude solvent was slowly added dropwise to a solvent of MTBE (50 mL). The desired product was precipitated. The product was collected as a white solid after filtration, and the solid filter cake was washed with isopropyl ether MTBE (50 mL x 2). Compound 7-1-6 (4.90 g, 2.07 mmol, 84.5% yield, 93.5% purity) was obtained as a white solid. HPLC (Method B): RT = 10.986, 11.182, 11.264 minutes, LCMS (Method F): RT = 1.502 minutes; m / z: [M+2H] 2+ / 2=1107.4.

[1402] Preparation of DMTr-CCGU-OH(7-1-6a)

[1403]

[1404] 7-1-6a was synthesized from 7-1-6 using a procedure similar to the phosphoramidite synthesis described above. HPLC-MS (Method G): RT = 9.740, 9.843, 9.949 min; m / z: [M-2H] for compound 7-1-6a. 2- / 2=1205.8.

[1405] Preparation of HO-CCGU-OTBDPS (7-1-7)

[1406]

[1407] To a solution of 7-1-5 (6.20 g, 2.52 mmol, 1.00 eq) in ACN (30 mL) was added dodecan-1-thiol (766 mg, 3.79 mmol, 906 uL, 1.50 eq) at 0°C, and then TFA (2.30 g, 20.1 mmol, 1.49 mL, 8.00 eq) was added dropwise at 0°C. The mixture was stirred at 0°C for 1 h. TLC (DCM:MeOH=10:1, product: R f =0.35) indicated that compound 7-1-5 was completely consumed and two new spots were formed. According to TLC, the reaction showed chaos.

[1408] Pour reaction mixture into NaHCO (10.0eq NaHCO in 100mL DI water ) in, then use EtOAc 50mL dilution and use NaHCO The aqueous solution 100mL extraction.By salt solution 200mL (100mL x 2) washing of the organic layer merged, through Na SO Drying, filter and under reduced pressure concentrate, obtain resistates.Crude product is redissolved among DCM (80mL).Crude solvent is slowly added drop-wise in the solvent of MTBE (300mL).Precipitate required product.Collect the product of white solid after filtration, and with solid filter cake is washed with isopropyl ether MTBE (50mL x 2).

[1409] Purification by HPLC gave compound 7-1-7 (4.86 g, 2.18 mmol, 86.4% yield, 96.6% purity) as a white solid. HPLC (Method B): RT = 0.664, 10.794, 10.917 min, LCMS (Method F): RT = 1.431 min; m / z: [M+2H] 2+ / 2=1075.9.

[1410] B. Preparation of 3' fragment

[1411] 1. General Procedure for Preparation of 5'-OH-ACCCU-LHPG Pentamer (Fragment 1)

[1412] General procedure for the preparation of compound 7-2-1

[1413]

[1414] Compound 7-2-a was co-evaporated with toluene (60.0 ml x 3). To a solution of compound 7-2-a (10.0 g, 16.1 mmol, 1.00 eq) in DCM (100 mL) was added N, N-diethylethylamine (8.18 g, 80.8 mmol, 11.2 mL, 5.00 eq) and tetrahydrofuran-2,5-dione (3.24 g, 32.3 mmol, 2.00 eq). The mixture was stirred at 25 ° C for 4 hours. HPLC indicated that compound 7-2-a was completely consumed. The reaction mixture was washed with TEAB (0.5 M, 300 ml), dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to obtain a residue. Compound 7-2-1 (11.0 g, 15.3 mmol, 94.6% yield) was obtained as a brown solid.

[1415] HPLC (Method A): RT = 2.405 min

[1416] General procedure for the preparation of compound 7-2-2

[1417]

[1418] To a solution of compound 7-2-1a (10.1 g, 10.2 mmol, 1.00 eq) in DCM (300 mL) were added compound 7-2-2 (11.0 g, 14.5 mmol, 1.43 eq, HCl), HBTU (13.1 g, 34.6 mmol, 3.40 eq), HOBt (4.69 g, 34.6 mmol, 3.40 eq) and DIEA (4.48 g, 34.6 mmol, 6.04 mL, 3.40 eq). The mixture was stirred at 25 ° C for 0.5 hours. TLC (starting material, R f =0.38, product, R f =0.42) indicates that compound 7-2-1a is completely consumed. The reaction mixture is concentrated under reduced pressure to remove the solvent. The crude product is ground with ACN (700ml) at 25 ° C for 15 minutes. It is then filtered and washed with ACN (100ml x 2). Compound 7-2-2 (16.0g, 9.43mmol, 92.4% yield) is obtained as a brown solid.

[1419] General procedure for the preparation of compound 7-2-3

[1420]

[1421] To a solution of compound 7-2-2 (16.0 g, 9.43 mmol, 1.00 eq) in DCM (160 mL) was added dodecan-1-thiol (5.73 g, 28.3 mmol, 6.78 mL, 3.00 eq) and TFA (10.7 g, 94.3 mmol, 6.98 mL, 10.0 eq). The mixture was stirred at 0°C for 1 hour. TLC (DCM:MeOH=10:1, starting material, R f =0.50, product, R f =0.43) indicates that compound 7-2-2 is completely consumed. The reaction mixture is washed with saturated NaHCO3 aqueous solution until pH>7, extracted with dichloromethane (300mL), washed with brine (200ml), dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to obtain a residue. The crude product is ground together with ACN (800ml) at 25°C for 30 minutes. It is then filtered and washed with ACN (100ml x 2). Compound 7-2-3 (11.7g, 8.39mmol, 88.9% yield) is obtained as a white solid.

[1422] General procedure for the preparation of compound 7-2-4

[1423]

[1424] Compound 7-2-3 and MOE C amide were co-evaporated with (ACN 60.0 ml x 3) and (DCM 20.0 ml x 3). To a solution of compound 7-2-3 (11.7 g, 8.39 mmol, 1.00 eq) and MOE C amide (15.4 g, 16.7 mmol, 2.00 eq) were added DCM (120 mL) and ACN (20 mL), followed by 3A MS, and the mixture was stirred for 1 hour. DCI (2.98 g, 20.98 mmol, 2.50 eq) was then added to the mixture, and the mixture was stirred for 0.5 hour. 2-Hydroperoxy-2-methyl-propane (3.24 g, 25.1 mmol, 5.04 mL, 5 M, 3.00 eq) was then added to the mixture, and the mixture was stirred at 25° C. for 0.5 hour. TLC (DCM:MeOH=20:1, starting material, R f =0.43, product, R f =0.48) indicates that compound 7-2-3 is completely consumed. The reaction mixture is washed with NaHCO3 aqueous solution and Na2SO3 aqueous solution (200ml), washed with brine (200ml), filtered and concentrated under reduced pressure to obtain a residue. The crude product is ground together with ACN (350ml) at 25°C for 30 minutes. It is then filtered and washed with ACN (100ml x 2). Compound 7-2-4 (17.1g, 7.33mmol, 87.2% yield) is obtained as a white solid.

[1425] General procedure for the preparation of compound 7-2-5

[1426]

[1427] To a solution of compound 7-2-4 (17.1 g, 7.33 mmol, 1.00 eq) in DCM (170 mL) was added dodecan-1-thiol (4.45 g, 21.9 mmol, 5.26 mL, 3.00 eq) and TFA (8.35 g, 73.2 mmol, 5.42 mL, 10.0 eq). The mixture was stirred at 0°C for 1 hour. TLC (DCM:MeOH=10:1, starting material, R f =0.43, product, R f=0.48) indicates that compound 7-2-4 is completely consumed. The reaction mixture is washed with saturated NaHCO3 aqueous solution until pH>7, extracted with dichloromethane (300mL), washed with brine (200ml), dried over Na2SO4, filtered and concentrated under reduced pressure to obtain a residue. The crude product is ground together with ACN at 0°C for 30 minutes. It is then filtered and washed with ACN (100ml x 2). Compound 7-2-5 (13.7g, 6.74mmol, 92.0% yield) is obtained as a white solid.

[1428] General procedure for the preparation of compound 7-2-6

[1429]

[1430] Compound 5 and MOE C amidite were co-evaporated with (ACN 80.0 ml x 3) and (DCM 30.0 ml x 3). DCM (80.0 mL) and ACN (20.0 mL) were added to compound 7-2-5 (13.7 g, 6.74 mmol, 1.00 eq) and MOE C amidite (12.4 g, 13.4 mmol, 2.00 eq), and then The mixture was stirred for 1 h, then DCI (2.39 g, 16.8 mmol, 2.50 eq) was added to the mixture and the mixture was stirred for 0.5 h, then 2-hydroperoxy-2-methyl-propane (5 M, 4.05 mL, 3.00 eq) was added to the mixture and the mixture was stirred at 25 ° C for 0.5 h. TLC (DCM: MeOH = 15: 1, starting material, R f =0.43, product, R f =0.50) indicating complete consumption of compound 7-2-5. The reaction mixture was filtered. The filtrate was triturated with ACN at 25°C for 30 min. It was then filtered and washed with ACN (100 ml x 2). Compound 7-2-6 (17.0 g, 6.15 mmol, 91.1% yield) was obtained as a white solid.

[1431] General procedure for the preparation of compound 7-2-7

[1432]

[1433] To a solution of compound 7-2-6 (17.0 g, 6.15 mmol, 1.00 eq) in DCM (190 mL) was added dodecan-1-thiol (3.73 g, 18.4 mmol, 4.42 mL, 3.00 eq) and TFA (7.01 g, 61.4 mmol, 4.55 mL, 10.0 eq). The mixture was stirred at 0°C for 1 hour. TLC (DCM:MeOH=10:1, starting material, R f =0.43, product, R f =0.38) indicates that compound 7-2-6 is completely consumed. The reaction mixture is washed with saturated NaHCO3 aqueous solution until pH>7, extracted with dichloromethane (300mL), washed with brine (200ml), dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to obtain a residue. The crude product is ground together with ACN at 0°C for 30 minutes. It is then filtered and washed with ACN (100ml x 2). Compound 7-2-7 (14.7g, 5.97mmol, 97.0% yield) is obtained as a white solid.

[1434] General procedure for the preparation of compound 7-2-8

[1435]

[1436] Compound 7-2-7 and MOE C amidite were co-evaporated with (ACN 60.0 ml x 3) and (DCM 20.0 ml x 3). To a solution of compound 7-2-7 (13.0 g, 5.31 mmol, 1.00 eq) and MOE C amidite (9.80 g, 10.6 mmol, 2.00 eq) was added DCM (60.0 mL) and ACN (20.0 mL), and then The mixture was stirred for 1 h, then DCI (1.89 g, 13.2 mmol, 2.50 eq) was added to the mixture and the mixture was stirred for 0.5 h, then 2-hydroperoxy-2-methyl-propane (5 M, 3.19 mL, 3.00 eq) was added to the mixture and the mixture was stirred at 25 ° C for 0.5 h. TLC (DCM: MeOH = 15: 1, starting material, R f =0.43, product, R f =0.48) indicating that compound 7-2-7 was completely consumed. The reaction mixture was filtered. The filtrate was triturated with ACN (800 ml) at 25°C for 30 minutes. It was then filtered and washed with ACN (100 ml x 2). Compound 7-2-8 (14.4 g, 4.36 mmol, 82.1% yield) was obtained as a white solid.

[1437] General procedure for the preparation of compound 7-2-9

[1438]

[1439] To a solution of compound 7-2-8 (14.47 g, 4.39 mmol, 1.00 eq) in DCM (70.0 mL) was added dodecan-1-thiol (2.66 g, 13.1 mmol, 3.15 mL, 3.00 eq) and TFA (5.00 g, 43.8 mmol, 3.25 mL, 10.0 eq). The mixture was stirred at 0°C for 1 hour. TLC (DCM:MeOH=10:1, starting material, R f =0.43, product, R f =0.38) indicates that compound 7-2-8 is completely consumed. The reaction mixture is washed with saturated NaHCO3 aqueous solution until pH>7, extracted with dichloromethane (300mL), washed with brine (200ml), dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to obtain a residue. The crude product is ground together with ACN (800ml) at 25°C for 30 minutes. It is then filtered and washed with ACN (100ml x 2). Compound 7-2-9 (11.6g, 3.88mmol, 88.5% yield) is obtained as a white solid.

[1440] General procedure for the preparation of compound 7-2-10

[1441]

[1442] Compound 7-2-9 and MOE A amide were co-evaporated with (ACN 60 ml x 3) and (DCM 20 ml x 3). To a solution of compound 7-2-9 (11.6 g, 3.87 mmol, 1.00 eq) and MOE A amide (7.21 g, 7.74 mmol, 2.00 eq) was added DCM (60.0 mL) and ACN (20.0 mL), and then MS, the mixture was stirred for 1 hour, then DCI (1.37 g, 9.67 mmol, 2.50 eq) was added to the mixture, and the mixture was stirred for 0.5 hour, then 2-hydroperoxy-2-methyl-propane (5 M, 2.32 mL, 3.00 eq) was added to the mixture, and the mixture was stirred at 25°C for 0.5 hour. TLC (DCM:MeOH=15:1, starting material, R f =0.43, product, R f=0.47) indicating that compound 7-2-9 was completely consumed. The reaction mixture was filtered. The filtrate was triturated with ACN (800 ml) at 25°C for 30 minutes. It was then filtered and washed with ACN (100 ml x 2). Compound 7-2-10 (14.0 g, 3.64 mmol, 94.1% yield) was obtained as a white solid.

[1443] General procedure for preparation of fragment 1

[1444]

[1445] To a solution of compound 7-2-10 (14.0 g, 3.64 mmol, 1.00 eq) in DCM (70.0 mL) was added dodecan-1-thiol (2.21 g, 10.9 mmol, 2.62 mL, 3.00 eq). The mixture was stirred at 0°C for 1 h. TLC (DCM:MeOH=15:1, starting material, R f =0.43, product, R f =0.39) indicates that compound 7-2-10 is completely consumed. The reaction mixture is washed with saturated NaHCO3 aqueous solution until pH>7, extracted with dichloromethane (300mL), washed with brine (200mL), dried over anhydrous Na2SO4, filtered and concentrated under reduced pressure to obtain a residue. The crude product is triturated with ACN (800ml) at 25°C for 30 minutes. It is then filtered and washed with ACN (100ml x 2). Compound 7-2-10 (fragment 1) (10.0g, 2.82mmol, 77.5% yield) is obtained as a white solid. After deprotecting the LHPG group using aminolysis, 7-2-10 (fragment 1) is characterized by HPLC and mass spectrometry. HPLC (method C): RT = 2.11min and LCMS (method D): RT = 0.219min; m / z: [M-2H] 2- / 2=916.6.

[1446] 2. General Procedure for Preparation of 5'-Deoxy-TTACC Pentamer or 5'-DMTr-TTACC-OH or 5'-OH-TTACC-TBDPS Pentamer (Fragment 2)

[1447] General procedure for the preparation of compound 7-3-2

[1448]

[1449] To a solution of compound 7-3-1 (40.0 g, 61.7 mmol, 1.00 eq) in DCM (200 mL) was added imidazole (21.0 g, 308 mmol, 5.00 eq). The mixture was a pale yellow homogeneous solution. TBDPSCl (22.0 g, 80.2 mmol, 20.6 mL, 1.30 eq) was added. The mixture was stirred at 25°C for 16 h. TLC (petroleum ether:ethyl acetate = 2:1, product: R f =0.46) indicated that compound 7-3-1 was completely consumed and formed a new spot. According to TLC, the reaction was clean.

[1450] Propan-2-ol (4.73 mL, 1.00 eq) was added and the mixture was stirred for 0.5 hours. The above mixture was cooled to 0°C in an ice-water bath. Dodecan-1-thiol (16.2 g, 80.2 mmol, 19.2 mL, 1.30 eq) was added and the mixture was stirred at 0°C for 15 min. TFA (56.3 g, 494 mmol, 36.5 mL, 8.00 eq) was added dropwise at 0°C. The mixture was stirred at 0°C for 1 hour. TLC (petroleum ether: ethyl acetate = 2:1, R f =0.24) indicates that starting material is consumed completely and forms a new spot.According to TLC, reaction is clean.Reaction mixture is poured into NaHCO (10.0eq NaHCO , in 500mL DI water) in, then use DCM 100mL dilution and use NaHCO The aqueous solution 200mL extraction.The organic layer merging is washed with salt solution 200mL (100mL x 2), through Na SO Drying, filter and under reduced pressure concentrate, obtain resistates.

[1451] The crude product is dissolved among 100mL DCM, slowly drips crude product solution from funnel to the solvent mixture of heptane / TBME (v / v 9:1,1200mL) to carry out precipitation process.This process approximately needs 30 minutes.The pure product that is white solid is collected with Buchner funnel, the solvent mixture washing product filter cake with heptane (100mL x 2) and is concentrated to dryness.

[1452] Compound 7-3-2 was obtained as a white solid (34.8 g, 56.1 mmol, 91.0% yield, 94.2% purity).

[1453] HPLC (Method A): RT = 7.136 min, and LCMS (Method F): RT = 1.570 min; m / z: [M+H] + =584.2.

[1454] General procedure for the preparation of compound 7-3-3

[1455]

[1456] Under Ar, compound 7-3-2 (13.0 g, 22.2 mmol, 1.00 eq) and dC imide (20.7 g, 24.5 mmol, 1.10 eq) were co-evaporated with ACN (100 mL x 3) in a 250 mL single-necked round bottle, and 100 mL x 3 was added to the single-necked bottle. Molecular sieves (3.00 g) were added to ACN / DCM (1:1) (100 mL) under Ar pressure. The mixture was stirred at 25°C for 1 h, and then DCI (3.94 g, 33.4 mmol, 1.50 eq) was added. The mixture was stirred at 25°C for 1 h. HPLC (product: RT = 6.207 min; starting material: RT = 7.136 min) showed complete consumption of the starting material.

[1457] After the coupling reaction was complete, BuOOH (5.73 g, 44.5 mmol, 6.10 mL, 70.0% purity, 2.00 eq) was added to the above solution at 25°C. The mixture was stirred at 25°C for 1 h. HPLC (7-3-3, product: RT = 9.028 min; starting material: RT = 6.027 min) showed complete consumption of the starting material. The reaction mixture was poured into a solution of NaHCO3 and Na2SO3 (10.0 eq NaHCO3 and 5.00 eq Na2SO3 in 400 mL DI water), then diluted with EtOAc (200 mL). The layers were separated, and the organic layer was washed with NaHCO3 (200 mL), brine (100 mL), dried, filtered, and concentrated.

[1458] Compound 7-3-3 (33.0 g, 22.0 mmol, 98.7% yield, 89.7% purity) was obtained as a white foam. HPLC (Method A): RT = 5.518 min, and LCMS (Method D): RT = 1.787 min; m / z: [MH] - =1344.6.

[1459] General procedure for the preparation of compound 7-3-4

[1460]

[1461] To compound 7-3-3 (24.0 g, 17.8 mmol, 1.00 eq) in ACN (120 mL) was added dodecan-1-thiol (4.69 g, 23.1 mmol, 5.55 mL, 1.30 eq) at 0°C, and then TFA (16.2 g, 142 mmol, 10.5 mL, 8.00 eq) was added dropwise at 0°C. The mixture was stirred at 0°C for 1 h. TLC (dichloromethane:methanol=10:1, product: R f =0.55) indicates that compound 7-3-3 is completely consumed and forms two new spots. According to TLC, the reaction is chaotic. The reaction mixture is poured into NaHCO (10.0eq NaHCO in 300mL DI water), then diluted with EtOAc 100mL and extracted with NaHCO aqueous solution 100mL. The combined organic layer is washed with salt water 200mL (100mL x 2), dried over Na SO, filtered and concentrated under reduced pressure to obtain residue.

[1462] The mixture is redissolved in CH3CN:H2O (2: 1, 100mL), and the CH3CN / H2O layer is washed with heptane: tBuOMe=4: 1 (200mL x 4), and then the CH3CN and H2O layer are diluted with EtOAc / MTBE (1 / 3, 120mL). The organic layer is washed with DI water (100mL), the organic layer is washed with brine (100mL), dried over Na2SO4, filtered and concentrated under reduced pressure to obtain a residue. Compound 7-3-4 (16.4g, 14.3mmol, 80.4% yield, 91.2% purity) is obtained as a white solid. The crude product is purified by reverse phase HPLC (pH=7 conditions). Compound 7-3-4 (14.7g, 13.4mmol, 87.4% yield, 95.2% purity) is obtained as a white foam. HPLC (Method A): RT = 7.344 min, and LCMS (Method E): RT = 1.451 min; m / z: [M+H] + =1044.7.

[1463] General procedure for the preparation of compound 7-3-5

[1464]

[1465] Compound 7-3-4 (14.7 g, 14.0 mmol, 1.00 eq) and dA imide (13.2 g, 15.4 mmol, 1.10 eq) were co-evaporated with ACN (100 mL x 3) in a 250 mL single-necked round flask under Ar, and the mixture was added to the single-necked flask. Molecular sieves (4.00 g) were added to ACN (75 mL) under Ar pressure. The mixture was stirred at 25°C for 1 h, and then DCI (2.49 g, 21.1 mmol, 1.50 eq) was added to the mixture. The mixture was stirred at 25°C for 1 h. HPLC (product: RT = 7.344 min; starting material: RT = 8.501 min) showed that the starting material was completely consumed.

[1466] After the coupling reaction was complete, BuOOH (3.62 g, 28.1 mmol, 3.86 mL, 70.0% purity, 2.00 eq) was added to the above solution at 25°C. The mixture was stirred at 25°C for 0.5 h. HPLC (7-3-5, product: RT = 8.232 min; starting material: RT = 8.501 min) showed complete consumption of the starting material. The reaction mixture was poured into a solution of NaHCO3 and Na2SO3 (10.0 eq NaHCO3 and 5.00 eq Na2SO3 in 500 mL DI water), then diluted with EtOAc (200 mL). The two layers were separated, and the organic layer was washed with NaHCO3 (200 mL), brine (100 mL), dried, filtered, and concentrated.

[1467] The crude product is redissolved in DCM (80mL). The crude solvent is slowly added dropwise to the solvent of MTBE (1000mL). The desired product is precipitated. The product of white solid is collected after filtration, and the solid filter cake is washed with isopropyl ether MTBE (50mL x 2). Compound 7-3-5 (30.0g, 13.4mmol, 95.7% yield, 81.6% purity) is obtained as a white solid. The crude product is purified by reversed-phase HPLC (pH=7 conditions). Compound 7-3-5 (24.0g, 13.0mmol, 96.9% yield, 98.8% purity) is obtained as a white solid.

[1468] HPLC (method A): RT = 8.233 min; LCMS (method D): RT = 1.622 min;

[1469] m / z: [M-2H] 2- / 2=906.8.

[1470] General procedure for the preparation of compound 7-3-6

[1471]

[1472] To a solution of compound 7-3-5 (18.3 g, 10.0 mmol, 1.00 eq) in ACN (90 mL) was added dodecan-1-thiol (2.65 g, 13.0 mmol, 3.14 mL, 1.30 eq) at 0°C, and then TFA (9.19 g, 80.5 mmol, 5.97 mL, 8.00 eq) was added dropwise at 0°C. The mixture was stirred at 0°C for 1 h. TLC (DCM:MeOH=10:1, product: R f =0.43) indicated that compound 7-3-5 was completely consumed and two new spots were formed. According to TLC, the reaction showed chaos.

[1473] The reaction mixture is poured into NaHCO (10.0eq NaHCO , in 300mL DI water) in, then diluted with EtOAc100mL and used NaHCO The aqueous solution 100mL extraction. The organic layer is washed with salt water 200mL (100mL x 2) merged, through Na SO Drying, filter and concentrate under reduced pressure to obtain residue. The crude product is redissolved in DCM (80mL). Crude solvent is slowly added dropwise in the solvent of MTBE (1000mL). Required product is precipitated. The product of white solid is collected after filtration, and solid filter cake is washed with isopropyl ether heptane (50mL x 2). Compound 7-3-6 (14.3g, 9.34mmol, 92.7% productive rate, 98.8% purity) is obtained as white solid.

[1474] HPLC (method A): RT = 7.008 min; LCMS (method E): RT = 1.444 min;

[1475] m / z: [M+H] + =1514.8.

[1476] General procedure for the preparation of compound 7-3-7

[1477]

[1478] Compound 7-3-6 (14.3 g, 9.44 mmol, 1.00 eq) and dT imide (7.73 g, 10.3 mmol, 1.10 eq) were co-evaporated with ACN (50 mL x 3) in a 250 mL single-necked round flask under Ar, and the mixture was added to the single-necked flask. Molecular sieves (4.00 g) were added to ACN (75 mL) under Ar pressure. The mixture was stirred at 25°C for 1 h, and then DCI (1.67 g, 14.1 mmol, 1.50 eq) was added to the mixture. The mixture was stirred at 25°C for 1 h. HPLC (product: RT = 8.061 min; starting material: RT = 7.008 min) showed that the starting material was completely consumed.

[1479] After the coupling reaction was complete, BuOOH (2.43 g, 18.8 mmol, 2.59 mL, 70.0% purity, 2.00 eq) was added to the above solution at 25°C. The mixture was stirred at 25°C for 1 h. HPLC (7-3-7, product: RT = 7.856 min; starting material: RT = 8.061 min) showed complete consumption of the starting material. The reaction mixture was poured into a solution of NaHCO3 and Na2SO3 (10.0 eq NaHCO3 and 5.00 eq Na2SO3 in 400 mL DI water), then diluted with EtOAc (200 mL). The two layers were separated, and the organic layer was washed with NaHCO3 (200 mL), brine (100 mL), dried, filtered, and concentrated.

[1480] Compound 7-3-7 (21.9 g, 8.78 mmol, 93.0% yield, 87.1% purity) was obtained as a white solid. The crude product was purified by reverse phase HPLC (pH = 7) to obtain compound 7-3-7 (19.0 g, 8.57 mmol, 97.6% yield, 98.0% purity) as a white foam.

[1481] HPLC (method A): RT = 7.848 min; LCMS (method D): RT = 1.569 min;

[1482] m / z: [M-2H] 2- / 2=1085.5.

[1483] General procedure for the preparation of compound 7-3-8

[1484]

[1485] To a solution of compound 7-3-7 (14.0 g, 6.44 mmol, 1.00 eq) in ACN (70 mL) was added dodecan-1-thiol (1.69 g, 8.37 mmol, 2.01 mL, 1.30 eq) at 0°C, and then TFA (5.87 g, 51.5 mmol, 3.81 mL, 8.00 eq) was added dropwise at 0°C. The mixture was stirred at 0°C for 1 h. TLC (methanol: dichloromethane = 10:1, product: R f=0.41) indicates that compound 7-3-7 is completely consumed and forms two new spots. According to TLC, the reaction is chaotic. The reaction mixture is poured into NaHCO (10.0eq NaHCO in 300mL deionized (DI) water), then diluted with EtOAc 100mL and extracted with NaHCO aqueous solution 100mL. The combined organic layer is washed with brine 200mL (100mL x 2), dried over Na SO, filtered and concentrated under reduced pressure to obtain residue.

[1486] The crude product was redissolved in DCM (80 mL). The crude solvent was slowly added dropwise to a solvent of MTBE (1000 mL). The desired product was precipitated. The product was collected as a white solid after filtration, and the solid filter cake was washed with isopropyl ether MTBE (50 mL x 2). Compound 7-3-8 (11.5 g, 6.00 mmol, 93.1% yield, 97.6% purity) was obtained as a white solid.

[1487] HPLC (Method A): RT = 6.705 min.

[1488] General procedure for the preparation of deoxy-TTACC pentamer 7-3-9

[1489]

[1490] Compound 7-3-8 (11.5 g, 6.14 mmol, 1.00 eq) and dT imide (5.03 g, 6.76 mmol, 1.10 eq) were co-evaporated with ACN (50 mL x 3) in a 250 mL single-necked round flask under Ar, and the mixture was added to the single-necked flask. Molecular sieves (4.00 g) were added, and ACN (75 mL) was added under Ar pressure. The mixture was stirred at 25°C for 1 hour, and then DCI (1.67 g, 14.1 mmol, 1.50 eq) was added to the mixture. The mixture was stirred at 25°C for 1 hour. HPLC (product: RT = 7.730 min; starting material: RT = 6.705 min) showed that the starting material was completely consumed.

[1491] After the coupling reaction was complete, BuOOH (1.58 g, 12.2 mmol, 1.68 mL, 70.0% purity, 2.00 eq) was added to the above solution. The mixture was stirred at 25°C for 1 h. HPLC (product: RT = 7.517 min; starting material: RT = 7.730 min) showed complete consumption of the starting material. The reaction mixture was poured into a solution of NaHCO3 and Na2SO3 (10.0 eq NaHCO3 and 5.00 eq Na2SO3 in 500 mL DI water), then diluted with EtOAc (200 mL). The two layers were separated, and the organic layer was washed with NaHCO3 (200 mL), brine (100 mL), dried, filtered, and concentrated.

[1492] The crude product was redissolved in DCM (80 mL). The crude solvent was slowly added dropwise to a solution of MTBE (800 mL). The desired product precipitated. The product was collected by filtration as a white solid, and the solid filter cake was washed with MTBE (50 mL x 2). LCMS: Product: RT = 1.443 min.

[1493] The crude product was purified by reverse phase HPLC (pH=7 condition).

[1494] 7-3-9 (deoxy-TTACC 5-mer) was obtained as a light yellow solid (14.3 g, 5.47 mmol, 89.3% yield, 96.8% purity).

[1495] HPLC (method B): RT = 11.993, 12.120, 12.240 min; LCMS (method D):

[1496] RT = 1.443 min; m / z: [M-2H] 2- / 2=1263.7.

[1497] General procedure for the preparation of DMTr-TTACC-OH7-3-10

[1498]

[1499] To a solution of compound 7-3-9 (7.20 g, 2.84 mmol, 1.00 eq) in ACN (35 mL) and then pyridine, hydrofluoric acid (813 mg, 28.4 mmol, 739 uL, 70.0% purity, 10.0 eq) and imidazole (3.87 g, 56.8 mmol, 20.0 eq) in THF (12 mL) were added dropwise at 0°C. The mixture was stirred at 0°C for 3 h. TLC (dichloromethane:methanol = 10:1, purity: R f=0.30) indicated that compound 7-3-9 was completely consumed and two new spots were formed. According to TLC, the reaction showed chaos.

[1500] The reaction mixture was dissolved in EtOAc (50 mL).The organic layer was washed with saturated NaHCO3 (100 mL x 2), brine (100 mL) and dried over anhydrous Na2SO4, filtered and concentrated under vacuum.

[1501] The crude product was redissolved in DCM (5 mL). The crude solvent was slowly added dropwise to a solvent of MTBE (300 mL). The desired product was precipitated. The product was collected as a white solid after filtration, and the solid filter cake was washed with isopropyl ether MTBE (50 mL x 2).

[1502] Compound 7-3-10DMTr-TTACC-OH was obtained as a white solid (6.00 g, 2.33 mmol, 82.0% yield, 89.1% purity).

[1503] HPLC (Method B): RT = 6.449, 6.591 min; LCMS (Method F): RT = 1.312 min; m / z: [M+2H] 2+ / 2=1147.4.

[1504] Preparation of compound 7-3-10a

[1505]

[1506] Compound 7-3-10a was synthesized from 7-3-10 using a procedure similar to the above phosphoramidite synthesis. HPLC-MS (Method G): RT = 8.174, 8.251, 8.420, 8.494 min; m / z: [M-2H] 2- / 2=1245.4.

[1507] Preparation of HO-TTACC-OTBDPS 7-3-11

[1508]

[1509] To a solution of compound 7-3-9 (6.60 g, 2.61 mmol, 1.00 eq) in ACN (35 mL) was added dodecan-1-thiol (791 mg, 3.91 mmol, 936 uL, 1.50 eq) at 0°C, and then TFA (2.38 g, 20.8 mmol, 1.54 mL, 8.00 eq) was added dropwise at 0°C. The mixture was stirred at 0°C for 1 h. TLC (DCM:MeOH=10:1, product: R f=0.35) indicates that compound 7-3-9 is completely consumed and forms two new spots. According to TLC, the reaction is chaotic. The reaction mixture is poured into NaHCO (10.0eq NaHCO in 100mL DI water), then diluted with EtOAc 50mL and extracted with NaHCO aqueous solution 100mL. The combined organic layer is washed with brine 200mL (100mL x 2), dried over Na SO, filtered and concentrated under reduced pressure to obtain residue.

[1510] The crude product was redissolved in DCM (80 mL). The crude solvent was slowly added dropwise to a solvent of MTBE (300 mL). The desired product was precipitated. The product was collected as a white solid after filtration, and the solid filter cake was washed with isopropyl ether MTBE (50 mL x 2). Compound 7-3-11 (HO-TTACC-OTBDPS) (5.35 g, 2.37 mmol, 90.7% yield, 98.6% purity) was obtained as a white solid.

[1511] HPLC (method B): RT = 9.508, 9.650 min; LCMS (method D): RT = 1.444 min; m / z: [M-2H] 2- / 2=1113.3.

[1512] 3. General Procedure for Preparation of 5'-UTTC Tetramers or 5'-DMTr-UTTC-OH or 5'-OH-UTTC-TBDPS Tetramers (Fragment 3)

[1513] General procedure for the preparation of compound 7-4-2

[1514]

[1515] To a solution of compound 7-4-1 (40.0 g, 61.7 mmol, 1.00 eq) in DCM (200 mL) was added imidazole (21.0 g, 308 mmol, 5.00 eq). The mixture was a pale yellow homogeneous solution. TBDPSCl (22.0 g, 80.2 mmol, 20.6 mL, 1.30 eq) was added. The mixture was stirred at 25°C for 16 h. TLC (petroleum ether:ethyl acetate = 2:1, product: R f =0.46) indicated that compound 7-4-1 was completely consumed and formed a new spot. According to TLC, the reaction was clean.

[1516] Propan-2-ol (4.73 mL, 1.00 eq) was added and the mixture was stirred for 0.5 hours. The above mixture was cooled to 0°C in an ice-water bath. Dodecan-1-thiol (16.2 g, 80.2 mmol, 19.2 mL, 1.30 eq) was added and the mixture was stirred at 0°C for 15 minutes. TFA (56.3 g, 494 mmol, 36.5 mL, 8.00 eq) was added dropwise at 0°C. The mixture was stirred at 0°C for 1 hour. TLC (petroleum ether: ethyl acetate = 2:1, R f =0.24) indicates that the starting mixture is completely consumed and forms a new spot. According to TLC, the reaction is clean. The reaction mixture is poured into NaHCO (10.0eq NaHCO in 500mL DI water), then diluted with DCM 100mL and extracted with NaHCO The aqueous solution 200mL. The organic layer merged is washed with salt water 200mL (100mL x 2), through Na SO Drying, filter and under reduced pressure concentrate to obtain resistates.

[1517] The crude product is dissolved in 100mL DCM, slowly drips crude product solution from funnel to the solvent mixture of heptane / TBME (v / v 9: 1,1200mL) to carry out precipitation process.This process requires approximately 0.5 hour.The pure product in the form of white solid is collected with Buchner funnel, the solvent mixture washing product filter cake with heptane (100mL x 2) is concentrated into dryness.Compound 7-4-2 (34.8g, 56.1mmol, 91.0% productive rate, 94.2% purity) of white solid is obtained.

[1518] HPLC (Method A): RT = 7.136 min, and LCMS (Method F): RT = 1.570 min; m / z: [M+H] + =584.2

[1519] General procedure for the preparation of compound 7-4-3

[1520]

[1521] Compound 7-4-2 (15.0 g, 25.7 mmol, 1.00 eq) and dT amidite (21.0 g, 28.2 mmol, 1.10 eq) were co-evaporated with ACN / DCM (1 / 1, 100 mL x 3) in a 250 mL single-necked round flask under Ar, and the mixture was added to the single-necked flask. Molecular sieves (6.50 g) were added to ACN (60 mL) and DCM (60 mL) under Ar pressure. The mixture was stirred at 25° C. for 1 h, and then DCI (4.55 g, 38.5 mmol, 1.50 eq) was added to the mixture. The mixture was stirred at 25° C. for 1 h. HPLC (product: RT = 8.233 min) indicated that compound 7-4-2 was completely consumed.

[1522] After the coupling reaction was complete, BuOOH (6.62 g, 51.3 mmol, 7.04 mL, 70.0% purity, 2.00 eq) was added to the above solution at 25°C. The mixture was stirred at 25°C for 0.5 h. HPLC (product: RT = 7.764, 7.826 min) indicated the reaction was complete. The reaction mixture was poured into a solution of NaHCO3 and Na2SO3 (10.0 eq NaHCO3 and 5.00 eq Na2SO3 in 400 mL of DI water). The mixture was then diluted with DCM (200 mL) and the two layers were separated. The organic layer was washed with NaHCO3 (200 mL), brine (100 mL), dried, filtered, and concentrated.

[1523] Compound 7-4-3 (36.0 g, 24.9 mmol, 97.1% yield, 86.2% purity) was obtained as a white solid. HPLC: product: RT = 7.764, 7.826 min; LCMS: compound 7-4-3, RT = 1.602 min. The crude compound 3 was used in the next step.

[1524] Compound 7-4-3 (10.0 g, 6.93 mmol, 86.2% purity) was purified by reverse phase MPLC (pH = 7, MeCN / water). Compound 7-4-3 (8.00 g, 6.19 mmol, 89.2% yield, 96.1% purity) was obtained as a white foam. HPLC (Method A): RT = 7.792, 7.845 min, LCMS (Method F): RT = 1.602 min; m / z: [M+H] + =1243.4.

[1525] General procedure for the preparation of compound 7-4-4

[1526]

[1527] To a solution of compound 7-4-3 (26.0 g, 20.9 mmol, 1.00 eq) in ACN (120 mL) was added dodecan-1-thiol (5.50 g, 27.18 mmol, 6.51 mL, 1.30 eq) cooled to 0°C, and then TFA (19.0 g, 167 mmol, 12.3 mL, 8.00 eq) was added dropwise at 0°C. The mixture was stirred at 0°C for 1 h. TLC (dichloromethane:methanol = 10:1, product: R f =0.46) indicates that compound 7-4-3 is completely consumed and forms a new spot. According to TLC, the reaction is clean. The reaction mixture is poured into NaHCO solution (10.0eq NaHCO in 400mL DI water), then the mixture is diluted with EtOAc (300mL), and the two layers are separated. The organic layer is washed with NaHCO (200mL), brine (200mL), dried over NaSO, filtered and concentrated under reduced pressure to obtain residue.

[1528] The mixture was redissolved in CH3CN:H2O (2:1, 100 mL), and the CH3CN / H2O layer was washed with heptane:tBuOMe=4:1 (200 mL x 4), and then the CH3CN and H2O layers were diluted with EtOAc / MTBE (1 / 3, 120 mL). The organic layer was washed with DI water (100 mL), the organic layer was washed with brine (100 mL), dried over Na2SO4, filtered and concentrated under reduced pressure to give a residue.

[1529] Compound 7-4-4 (17.0 g, 16.7 mmol, 80.0% yield, 92.6% purity) was obtained as a white foam.

[1530] HPLC (Method A): RT = 5.977 min, and LCMS (Method E): RT = 1.241 min; m / z: [M+H] + =941.5.

[1531] General procedure for the preparation of compound 7-4-5

[1532]

[1533] Compound 7-4-4 (17.0 g, 18.0 mmol, 1.00 eq) and dT imide (14.8 g, 19.8 mmol, 1.10 eq) were co-evaporated with ACN (100 mL x 3) in a 250 mL single-necked round flask under Ar, and the mixture was added to the single-necked flask. Molecular sieves (4.50 g) were added to the mixture, and ACN (85 mL) was added under Ar pressure. The mixture was stirred at 25°C for 1 hour, and then DCI (3.20 g, 27.1 mmol, 1.50 eq) was added to the mixture. The mixture was stirred at 25°C for 1 hour. HPLC (product: RT = 7.451 min; starting material: RT = 5.977 min) showed that the starting material was completely consumed.

[1534] After the coupling reaction was complete, BuOOH (4.65 g, 36.1 mmol, 4.95 mL, 70.0% purity, 2.00 eq) was added to the above solution. The mixture was stirred at 25°C for 0.5 h. HPLC (product: RT = 7.810 min; starting material: RT = 7.451 min) showed complete consumption of the starting material. The reaction mixture was poured into a solution of NaHCO₃ and Na₂SO₃ (10.0 eq NaHCO₃ and 5.00 eq Na₂SO₃ in 400 mL DI water), then diluted with EtOAc (200 mL). The layers were separated, and the organic layer was washed with NaHCO₃ (200 mL), brine (100 mL), dried, filtered, and concentrated. Compound 7-4-5 (34.0 g, 17.2 mmol, 95.2% yield, 81.0% purity) was obtained as a white foam.

[1535] Compound 7-4-5 (24.0 g, 15.0 mmol, 81.0% purity) was purified by reverse phase HPLC (pH=7; MeCN / water) to obtain compound 7-4-5 (17.8 g, 11.1 mmol, 89.7% yield, 98.2% purity) as a white foam.

[1536] HPLC (Method A): RT = 7.179 min, and LCMS (Method D): RT = 1.530 min; m / z: [MH] - =1599.6.

[1537] General procedure for the preparation of compound 7-4-6

[1538]

[1539] To a solution of compound 7-4-5 (12.6 g, 7.87 mmol, 1.00 eq) in ACN (65 mL) was added dodecan-1-thiol (2.07 g, 10.2 mmol, 2.45 mL, 1.30 eq) at 0°C, and then TFA (7.18 g, 62.9 mmol, 4.66 mL, 8.00 eq) was added dropwise at 0°C. The mixture was stirred at 0°C for 1 h. TLC (dichloromethane:methanol=10:1, product: R f=0.36) indicates that compound 7-4-5 is completely consumed and forms a new spot. According to TLC, the reaction is clean. The reaction mixture is poured into NaHCO (10.0eq NaHCO in 200mL DI water), then diluted with EtOAc 100mL and extracted with NaHCO aqueous solution 100mL. The combined organic layer is washed with salt water 200mL (100mL x 2), through Na SO dried, filtered and concentrated under reduced pressure to obtain residue.

[1540] The crude product was dissolved in 100 mL of DCM and the crude product solution was slowly added dropwise from a funnel to a solvent mixture of heptane / TBME (v / v 9:1, 500 mL) to carry out a precipitation process. This process required approximately 0.5 hours. The pure product obtained as a white solid was collected using a Buchner funnel, and the product filter cake was washed with a solvent mixture of heptane (100 mL x 2) and concentrated to dryness.

[1541] Compound 7-4-6 was obtained as a white solid (11.0 g, 7.75 mmol, 98.4% yield, 91.4% purity).

[1542] HPLC (Method A): RT = 5.661 min, and LCMS (Method F): RT = 1.365 min; m / z: [M+H] + =1298.4.

[1543] General procedure for preparing UTTC tetramer 7-4-7

[1544]

[1545] Compound 7-4-6 (11.0 g, 8.47 mmol, 1.00 eq) and MOE T amide (7.63 g, 9.32 mmol, 1.10 eq) were co-evaporated with ACN (100 mL x 3) in a 250 mL single-necked round flask under Ar, and the mixture was added to the single-necked flask. Molecular sieves (3.00 g) were added to ACN (55 mL) under Ar pressure. The mixture was stirred at 25°C for 1 hour, and then DCI (1.50 g, 12.7 mmol, 1.50 eq) was added to the mixture. The mixture was stirred at 25°C for 1 hour. HPLC (product: RT = 7.056, 7.180 min; starting material: RT = 5.661 min) showed that the starting material was completely consumed.

[1546] After the coupling reaction was complete, BuOOH (2.18 g, 16.9 mmol, 2.32 mL, 70.0% purity, 2.00 eq) was added to the above solution. The mixture was stirred at 25°C for 0.5 h. HPLC (product: RT = 6.897, 6.961 min; starting material: RT = 7.056, 7.180 min) showed complete consumption of the starting material. The reaction mixture was poured into a solution of NaHCO3 and Na2SO3 (10.0 eq NaHCO3 and 5.00 eq Na2SO3 in 500 mL DI water), then diluted with EtOAc (200 mL). The layers were separated, and the organic layer was washed with NaHCO3 (200 mL), brine (200 mL), dried, filtered, and concentrated.

[1547] The crude product was redissolved in DCM (50 mL). The crude solvent was slowly added dropwise to a solvent of MTBE (600 mL). The desired product was precipitated. The product was collected as a white solid after filtration, and the solid filter cake was washed with isopropyl ether MTBE (50 mL x 2). The crude solid was purified by reverse phase HPLC (pH = 7 conditions; MeCN / water). Compound 7-4-7 (UTTC tetramer) (14.5 g, 7.06 mmol, 83.3% yield, 98.9% purity) was obtained as a white solid.

[1548] HPLC (method B): RT = 10.638, 10.822 min, and LCMS (method D): RT = 1.396 min; m / z: [MH] - =1014.3.

[1549] General procedure for the preparation of 7-4-8(DMTr-UTTC-OH)

[1550]

[1551] To a solution of 7-4-7 (6.60 g, 3.25 mmol, 1.00 eq) in ACN (35 mL) and then pyridine was added dropwise hydrofluoric acid (928 mg, 32.4 mmol, 844 uL, 70.0% purity, 10.0 eq) and imidazole (4.42 g, 64.9 mmol, 20.0 eq) in THF (8 mL) at 0°C. The mixture was stirred at 0°C for 3 h. TLC (dichloromethane:methanol = 10:1, product: R f =0.33) indicated that compound 7-4-7 was completely consumed and two new spots were formed. According to TLC, the reaction showed chaos.

[1552] The reaction mixture is dissolved in EtOAc (20mL).With saturated NaHCO for organic layer (50mL x 2) aqueous solution, salt solution (20mL) washing, and pass through anhydrous Na sO 4 drying, filter and concentrate under vacuum.Crude product is redissolved in DCM (5mL).Crude solvent is slowly added dropwise in the solvent of MTBE (300mL).Precipitate required product.Collect the product of white solid after filtration, and solid filter cake is washed with isopropyl ether MTBE (50mL x 2).

[1553] Compound 7-4-8 (DMTr-UTTC-OH) was obtained as a white solid (5.57 g, 2.90 mmol, 89.3% yield, 93.4% purity).

[1554] HPLC (method B): RT = 4.461, 4.761 min, and LCMS (method D): RT = 1.237 min; m / z: [MH] - =1791.5.

[1555] General procedure for the preparation of 7-4-8a (fragment 3)

[1556]

[1557] Compound 7-4-8a was synthesized from 7-4-8 using a procedure similar to the above phosphoramidite synthesis. HPLC-MS (Method G): RT = 7.335, 7.446, 7.583, 7.637 min; m / z: [MH] for compound 7-4-8a - =1991.6.

[1558] General procedure for the preparation of 7-4-9(HO-UTTC-OTBDPS)

[1559]

[1560] To a solution of 7-4-7 (6.00 g, 2.95 mmol, 1.00 eq) in ACN (30 mL) was added dodecan-1-thiol (896 mg, 4.43 mmol, 1.06 mL, 1.50 eq), and then TFA (2.69 g, 23.6 mmol, 1.75 mL, 8.00 eq) was added dropwise at 0°C. The mixture was stirred at 0°C for 1 h. TLC (DCM:MeOH=10:1, product: R f =0.35) indicated that 7-4-7 was completely consumed and two new spots were formed. According to TLC, the reaction showed chaos.

[1561] The reaction mixture was poured into NaHCO (10.0 eq NaHCO in 100 mL DI water), then diluted with EtOAc 50 mL and extracted with NaHCO aqueous solution 100 mL. The combined organic layers were washed with brine 200 mL (100 mL x 2), dried over NaSO, filtered and concentrated under reduced pressure to give a residue.

[1562] The crude product was redissolved in DCM (80 mL). The crude solvent was slowly added dropwise to a solvent of MTBE (300 mL). The desired product was precipitated. The product was collected as a white solid after filtration, and the solid filter cake was washed with isopropyl ether MTBE (50 mL x 2).

[1563] Compound 7-4-9 (HO-UTTC-OTBDPS) was obtained as a white solid (4.97 g, 2.86 mmol, 96.6% yield and 99.3% purity).

[1564] HPLC (Method B): RT = 6.895 min; LCMS (Method F): RT = 1.323 min; m / z: [M+H] + =1729.6.

[1565] C. Convergent Synthesis of Target Oligonucleotide ASO 9-1

[1566] HPLC-MS method for the synthesis of ASOs 9-1 and 9-2 and their intermediates 7a-e.

[1567] Column: ACQUITY UPLC Oligonucleotide BEH C18 column, 1.7μm, 2.1mm X 150mm;

[1568] Column temperature: 35°C;

[1569] Mass ranges from 200 to 2300;

[1570] MS polarity: negative

[1571] Mobile phase:

[1572] Solution A: 5 mM tributylamine acetate (TBuAA) in 10% CH CN, 1 μ m EDTA;

[1573] Solution B: 5 mM TBuAA in 80% CH3CN, 1 μM EDTA

[1574] gradient:

[1575]

[1576]

[1577] ASO 9-1 was synthesized using a convergent synthesis procedure similar to the method disclosed above for the synthesis of ASO 9. General procedure for preparing compound 7-a

[1578]

[1579] Fragment 1 was coupled with 2 using a similar procedure as disclosed above to synthesize 7-a. After deprotection of the LHPG group using aminolysis, 7-a was characterized by HPLC and mass spectrometry; HPLC-MS: RT = 7.247 min and m / z = 1831.5 (see Figure 21 ).

[1580] General procedure for the preparation of compound 7-b

[1581]

[1582] Compound 7-b was synthesized from 7-a using the detritylation method disclosed above. After deprotection of the LHPG group using aminolysis, 7-b was characterized by HPLC and mass spectrometry; HPLC-MS: RT = 6.250 min and m / z = 1680.4 (see Figure 22 )

[1583] General procedure for preparing compound 7-c

[1584]

[1585] Fragment 3 was coupled with 7-b using a similar procedure as disclosed above to synthesize 7-c. After deprotection of the LHPG group using aminolysis, 7-c was characterized by HPLC and mass spectrometry; HPLC-MS: RT = 7.627 min and m / z = 1650.6 (see Figure 23 )

[1586] General procedure for the preparation of compound 7-d

[1587]

[1588] 7-d was synthesized from 7-c using the detritylation method disclosed above. After deprotection of the LHPG group using aminolysis, 7-d was characterized by HPLC and mass spectrometry; HPLC-MS: RT = 7.801 min and m / z = 1549.9 (see Figure 24 ).

[1589] General procedure for the preparation of compound ASO-9-1

[1590]

[1591] ASO-9-1 was synthesized by coupling fragment 7-d with fragment 4 using a similar procedure as disclosed for the synthesis of ASO 9. ASO-9-1 was confirmed by HPLC-MS: RT = 10.224 min and m / z: = 2168.0 (see Figure 25 ).

[1592] D. Convergent Synthesis of Target Oligonucleotide ASO-9-2

[1593]

[1594] ASO 9-2 was synthesized using a convergent synthesis procedure similar to that disclosed above for the synthesis of ASO 9 and ASO-9-1.

[1595]

[1596] Compound 7-e was synthesized by coupling fragment 5-4 with fragment 7-b using the coupling procedure disclosed above, followed by the detritylation method disclosed above. After deprotection of the LHPG group using aminolysis, 7-e was characterized by HPLC and mass spectrometry; HPLC-MS: RT = 7.773 min and m / z = 1570.9 (see Figure 26 )

[1597] General procedure for the preparation of compound ASO-9-2

[1598]

[1599] ASO-9-2 was synthesized by coupling fragment 7-e with fragment 4 using a similar procedure as disclosed for the synthesis of ASO 9 and ASO-9-1. ASO-9-2 was confirmed by HPLC-MS: RT = 9.917 min and m / z: = 2189.4 (see Figure 27 ).

[1600] Example 8. Synthesis of stereospecific oligonucleotides using PSI chemistry

[1601] For the Prep-HPLC method described below, the mobile phase solvents are described in the format [AB], where A refers to mobile phase A and B refers to mobile phase B. For example, mobile phase [TEAB (10 mM)-ACN] means that 10 mM TEAB was used as mobile phase A and HPLC grade acetonitrile was used as mobile phase B.

[1602] The following analytical methods were used to synthesize the compounds and oligonucleotides described in Example 8.

[1603] HPLC method:

[1604]

[1605] LC-MC method:

[1606]

[1607] 1.1 Linear synthesis of dTdAdCdC fragment

[1608]

[1609] Preparation of compound 8.2

[1610] Compound dC (10 g, 15.44 mmol, 1 eq) was azeotroped with ACN (10 mL x 2). Under N₂, DBU (3.06 g, 20.07 mmol, 3.03 mL, 1.3 eq) was added to a solution of compound dC (10 g, 15.44 mmol, 1 eq) and the PSI reagent, compound 8.1 (8.96 g, 20.07 mmol, 1.3 eq) in ACN (60 mL) at 0°C. The mixture was stirred at 25°C for 0.5 h. TLC (petroleum ether / ethyl acetate = 2:1, Rf = 0.54) indicated complete consumption of compound dC. The mixture was filtered through a short pad of silica gel, and the silica gel was then washed with EA (60 mL x 2). The organic phase was washed with saturated KH₂PO₄ (30 mL), saturated NaHCO₃ (30 mL), and brine (30 mL x 2), dried over anhydrous Na₂SO₄, filtered, and the solvent removed under vacuum. The crude product was purified by chromatography (SiO2, petroleum ether / ethyl acetate = 50 / 1 to 1 / 1). Compound 8.2 (7.3 g, 8.00 mmol, 51.83% yield, 98% purity) was obtained as a white solid. IPC (in-process control): TLC (petroleum ether / ethyl acetate = 2:1, product (R f )=0.54) HPLC showed RT=8.666.

[1611] Preparation of compound 8.4

[1612] Compound 8.3 (4 g, 6.85 mmol, 1 eq) was azeotroped with ACN (10 mL x 2). Molecular sieves 3A (1 g, 1.00 eq) were added to compound 8.3 (3.5 g, 6.00 mmol, 1 eq) in ACN (24 mL) at 25°C. The mixture was stirred at 25°C for 0.5 h. Compound 8.2 (5.90 g, 6.60 mmol, 1.1 eq) and DBU (2.74 g, 17.99 mmol, 2.71 mL, 3 eq) were then added at 25°C. The mixture was stirred at 25°C for 0.5 h. LCMS (product: RT = 1.469 min) indicated that compound 8.2 was completely consumed. The mixture was diluted with ethyl acetate (10 mL) and 20% citric acid (10 mL). The organic phase was washed with H2O (10 mL), saturated NaHCO3 (10 mL), brine (10 mL), dried over anhydrous Na2SO4, filtered, and the solvent removed under vacuum. The crude product was used without purification. Compound 8.4 [(m / zH + )=1307.6,9.48g,crude].

[1613] The stereoselectivity of compound 8.4 was tested by superfluid chromatography (SFC) (described below). Compound 8.4 showed a single peak at RT = 2.30 min (see Figure 28 No other peaks were detected. Stereoselectivity was >99.5%.

[1614] SFC method:

[1615] Instrument: CAS-TJ-ANA-SFC-1 (Waters SFC-MS)

[1616] Column: chiralcel OD-3, 4.6*100mm, 3um

[1617] Mobile phase: A for SFC CO2, and B for EtOH (0.05% IPAm)

[1618] Gradient: B 40% in 10 min

[1619] Flow rate: 4.0 mL / min

[1620] Column temperature: 35°C

[1621] Wavelength: 220nm

[1622] System back pressure: 100 bar

[1623] For comparison, a racemic sample was synthesized by amidite chemistry as a standard, which had two retention times: 2.79 min and 4.33 min (see Figure 29 ).

[1624]

[1625] Preparation of compound 8.5

[1626] To a solution of compound 8.4 (7.85 g, 5.99 mmol, 1 eq) in DCM (55 mL) at 25°C under N₂ was added 2,2-dichloroacetic acid (5.18 g, 40.18 mmol, 3.3 mL, 6.70 eq). The mixture was stirred at 25°C for 1 hour. LCMS (product: RT = 1.352 min) indicated complete consumption of compound 8.4. The mixture was diluted with TEAB (10 mL) and DCM (10 mL). The organic phase was washed with H₂O (10 mL), saturated NaHCO₃ (10 mL), and brine (10 mL x 2), dried over anhydrous Na₂SO₄, filtered, and the solvent removed under vacuum. The residue was purified by preparative HPLC (neutral conditions) (column: YMC-Triart Prep C₁8 250*50 mm*10 μm; mobile phase: [TEAB (10 mM)-ACN]; B%: 45%-65%, 22 min). Compound 8.5 (3.8 g, 3.70 mmol, 61.68% yield, 98% purity) was obtained as a white solid. MS (mH + ) / z=1005.4,

[1627] Preparation of compound 8.7

[1628] Compound 8.5 (3.5 g, 3.48 mmol, 1 eq) was azeotroped with ACN (10 mL x 2). Molecular sieves 1,2-dimethyl-1,3-dihydro-1,3-dihydro-2-nitropropene were added to a solution of compound 8.5 (3.5 g, 3.48 mmol, 1 eq) in ACN (25 mL) at 25 °C. (0.5 g, 3.48 mmol, 1.00 eq). The mixture was stirred at 25°C for 0.5 h. Compound 8.6 (4.71 g, 5.21 mmol, 1.5 eq) and DBU (1.59 g, 10.43 mmol, 1.57 mL, 3 eq) were then added at 25°C. The mixture was stirred at 25°C for 0.5 h. LCMS (product: RT = 1.314 min, (mH +) / z=1740.4) indicated that compound 8.5 was completely consumed. The mixture was diluted with DCM (10 mL) and 20% citric acid (10 mL x 2). The organic phase was washed with H2O (10 mL), NaHCO3 (10 mL), and brine (10 mL), dried over anhydrous Na2SO4, filtered, and the solvent removed under vacuum. The crude product was purified by preparative HPLC (instrument: Shimadzu 20AP; column: YMC-Actus Triart C18 150*30mm*5um; mobile phase: [TEAB (10 mM)-ACN]; B%: 20%-60%, 12 min). Compound 8.7 (2.7 g, 53.79% yield, 97% purity) was obtained as a yellow solid.

[1629] Preparation of compound 8.9

[1630] Compound 8.7 (1 g, 694.20 umol, 1 eq) was azeotroped with ACN (5 mL x 2). Molecular sieves were added to compound 8.7 (1 g, 694.20 umol, 1 eq) in ACN (7 mL) at 25 °C. (0.5 g, 208.26 umol, 1.00 eq). The mixture was stirred at 25°C for 0.5 h. Compound 8.8 (1.10 g, 1.39 mmol, 2 eq) and DBU (317.06 mg, 2.08 mmol, 313.92 uL, 3 eq) were then added at 25°C. The mixture was stirred at 25°C for 0.5 h. LCMS (product: RT = 1.254 min) indicated that compound 8.7 was completely consumed. The mixture was diluted with DCM (30 mL) and pH = 3 citric acid (20 mL). The organic phase was washed with H2O (20 mL), TEAB (20 mL), and brine (20 mL), dried over anhydrous Na2SO4, filtered, and the solvent was removed under vacuum. The crude product was used without purification. Compound 8.9 (MS (m-2H) was obtained as a yellow solid. + ) / z=807.3, 2.1 g, 75.49% LCMS purity).

[1631] Preparation of compound 8A

[1632] To a solution of compound 8.9 (1.43 g, 693.12 μmol, 1 eq) in DCM (12 mL) was added 2,2-dichloroacetic acid (1.13 g, 8.77 mmol, 720.00 μL, 12.65 eq) under N₂ at 25°C. The mixture was stirred at 25°C for 1 hour. LCMS (product: RT = 1.168 min) showed complete consumption of the starting material. The mixture was diluted with TEAB (15 mL) and DCM (25 mL). The organic phase was washed with H₂O (20 mL) and brine (20 mL), dried over anhydrous Na₂SO₄, filtered, and the solvent removed under vacuum. The crude product was purified by preparative HPLC (neutral conditions) (column: YMC-Actus Triart C₁8 150*30 mm*5 μm; mobile phase: [TEAB (10 mM)-ACN]; B%: 10%-40%, 10 min). Compound 8A [(m-2H + ) / z=879.6, 522 mg, 41.0% two-step yield, 97.6% purity) and characterized by HPLC and MS (see Figure 30 ).

[1633] 1.1.1 Coupling conditions during TACC tetramer synthesis:

[1634] Based on the IPC after the coupling reaction, the conversion of the coupling step is complete. The coupling step conditions and HPLC purity of the different stages are summarized as follows:

[1635]

[1636]

[1637] In summary, tetrameric oligonucleotides were synthesized using a liquid-phase linear extension method employing PSI reagents. Detritylation with DCA resulted in the trimerization of the adenosine. Detritylation of the trimer was achieved by an acidic treatment step using 20% ​​citric acid. Coupling efficiency decreased as the oligonucleotides grew longer. Additional PSI-amidite and DBU equivalents were required at later stages of the coupling. Under the coupling conditions, particularly with DBU treatment, the presence of benzyl and isobutyryl protecting groups was not disturbed.

[1638] 1.2 Linear extension of the MOE-fragment DMTO-AGUCU-OH using PSI chemistry

[1639] There are no reports on the synthesis of MOE-oligo using PSI reagents. PSI chemistry was applied to the coupling reaction of 2'MOE nucleosides, and a liquid-phase synthesis method for the extension of 2'MOE oligo 8B was developed.

[1640]

[1641]

[1642] Synthesis of compound 8.2.2

[1643] To a solution of compound 8.2.1 (5.00 g, 6.93 mmol, 1 eq) and PSI reagent (4.02 g, 9.01 mmol, 1.3 eq) in ACN (35 mL) was added DBU (1.37 g, 9.01 mmol, 1.36 mL, 1.3 eq) at 0 ° C. The mixture was stirred at 25 ° C for 0.5 h. TLC (petroleum ether: ethyl acetate = 0: 1, Rf = 0.82) indicated that the reactant 8.2.1 was completely consumed. The mixture was filtered through a short silica gel pad, and the silica gel was then washed with EA (80 mL x 2). The filtrate was washed with saturated KH2PO4 (100 mL), saturated NaHCO3 (100 mL), and brine (100 mL), dried over anhydrous Na2SO4, filtered and concentrated. The residue was purified by chromatography (SiO2, petroleum ether / ethyl acetate = 30 / 1 to 0 / 1). Compound 8.2.2 [(mH + ) / z=966.4, 5.5 g, 5.51 mmol, 79.55% yield, 97% purity].

[1644] Synthesis of compound 8.2.4

[1645] Compound 8.2.2 (5.00 g, 9.01 mmol, 1 eq) was azeotroped with ACN (40 mL x 2), and compound 8.2.3 (9.60 g, 9.92 mmol, 1.1 eq) was co-evaporated with ACN (40 mL x 2). To a solution of compound 8.2.2 (5 g, 9.01 mmol, 1 eq) and compound 8.2.3 (9.60 g, 9.92 mmol, 1.1 eq) in ACN (35 mL) was added DBU (4.12 g, 27.04 mmol, 4.08 mL, 3 eq) at 25°C. The mixture was stirred at 25°C for 0.5 h. LCMS indicated complete consumption of compound 8.2.2. The mixture was diluted with EA (150 mL) and 20% citric acid (80 mL). The organic layer was washed with saturated NaHCO3 (150 mL), H2O (150 mL), brine (150 mL x 2), dried over anhydrous Na2SO4, filtered, and the solvent removed under vacuum. The crude product was used in the next step without purification. Compound 8.2.4 [(mH + ) / z=1353.6, 12.21 g, crude product].

[1646] Synthesis of compound 8.2.5

[1647] To a solution of compound 8.2.4 (12.21 g, 9.01 mmol, 1 eq) in DCM (85 mL) at 25°C was added 2,2-dichloroacetic acid (8.01 g, 62.10 mmol, 5.1 mL, 6.89 eq). The mixture was stirred at 25°C for 1 h. LCMS indicated complete consumption of compound 8.2.4. The mixture was slowly added to TEAB (150 mL) and extracted with DCM (150 mL). The organic layer was then washed with saturated NaHCO₃ (150 mL), H₂O (150 mL), and brine (150 mL), dried over anhydrous Na₂SO₄, filtered, and the solvent removed under vacuum. The crude product was purified by preparative HPLC: Column: Agela DuraShell C18 250*50 mm*10 μm; Mobile phase: [TEAB (10 mM)-ACN]; B%: 30%-53% over 22 min. Compound 8.2.5[(mH + ) / z=1050.5, 6.9 g, 6.36 mmol, 70.57% yield, 97% purity].

[1648] Synthesis of compound 8.2.7

[1649] Compound 8.2.5 (4.50 g, 4.28 mmol, 1 eq) was azeotroped with ACN (40 mL x 2), and compound 8.2.6 (5.55 g, 6.42 mmol, 1.5 eq) was co-evaporated with ACN (40 mL x 2). To a solution of compound 8.2.5 (4.5 g, 4.28 mmol, 1 eq) in ACN (30 mL) at 25°C was added molecular sieves 3A (2.40 g, 4.28 mmol, 1.00 eq). The mixture was stirred at 25°C for 0.5 h. Compound 8.2.6 (5.55 g, 6.42 mmol, 1.5 eq) was then added at 25°C. DBU (1.95 g, 12.83 mmol, 1.93 mL, 3 eq) was slowly added at 25°C. The mixture was stirred at 25°C for 0.5 h. LCMS indicated complete consumption of 8.2.5. The mixture was diluted with DCM (200 mL) and pH ~3 citric acid (150 mL). The organic phase was washed with NaHCO (200 mL), H O (200 mL), and brine (200 mL), dried over anhydrous Na SO, filtered, and the solvent removed under vacuum. The crude product was used in the next step without purification. Compound 8.2.7 (9.3 g, crude) was obtained as a yellow solid.

[1650] Synthesis of compound 8.2.8

[1651] To a solution of compound 8.2.7 (7.48 g, 4.28 mmol, 1 eq) in DCM (60 mL) was added 2,2-dichloroacetic acid (7.85 g, 60.88 mmol, 5 mL, 14.23 eq) at 25°C. The mixture was stirred at 25°C for 1 h. LCMS indicated complete consumption of compound 8.2.7. The mixture was diluted with DCM (150 mL) and quenched with TEAB (150 mL). The organic phase was washed with NaHCO (150 mL), H2O (150 mL), brine (150 mL), dried over anhydrous Na2SO4, filtered, and the solvent removed under vacuum. The crude product was triturated with TBME (250 mL), then filtered, and the solid was washed with TEAB. The crude product was purified by preparative HPLC: column: YMC-Triart Prep C18 250*50mm*10um; mobile phase: [TEAB (10mM)-ACN]; B%: 25%-48%, 22min. Compound 8.2.8 [(mH + ) / z=1444.5, 3.3 g, 2.21 mmol, 51.74% yield, 97% purity].

[1652] Synthesis of compound 8.2.10

[1653] Compound 2.18 (3.3 g, 2.28 mmol, 1 eq) was azeotroped with ACN (20 mL x 2), and compound 8.2.9 (3.29 g, 3.42 mmol, 1.5 eq) was co-evaporated with ACN (20 mL x 2). To a solution of compound 8.2.8 (3.3 g, 2.28 mmol, 1 eq) in ACN (20 mL) at 25°C was added molecular sieves 3A (1.6 g, 2.28 mmol, 1 eq). The mixture was stirred at 25°C for 0.5 h. Compound 8.2.9 (3.29 g, 3.42 mmol, 1.5 eq) and DBU (1.74 g, 11.41 mmol, 1.72 mL, 5 eq) were then added at 25°C. The mixture was stirred at 25°C for 0.5 h. LCMS indicated that compound 8.2.8 was completely consumed. The mixture was diluted with DCM (50 mL) and 20% citric acid (50 mL). The organic phase was washed with TEAB (50 mL), dried over anhydrous Na2SO4, filtered, and the solvent removed under vacuum. The crude product was purified by preparative HPLC: column: Agela DuraShell C18 250*50mm*10um; mobile phase: [TEAB (10mM)-ACN]; B%: 15%-45%, 22 min. Compound 8.2.10 [(m-2H +) / z=967.1, 3.1 g, 1.54 mmol, 67.38% yield, 96% purity).

[1654] Synthesis of compound 8.2.12

[1655] Compound 8.2.10 (2.1 g, 1.08 mmol, 1 eq) was azeotroped with ACN (20 mL x 2), and compound 8.2.11 (2.12 g, 2.17 mmol, 2 eq) was co-evaporated with ACN (20 mL x 2). To a solution of compound 8.2.10 (2.1 g, 1.08 mmol, 1 eq) in ACN (14 mL) at 25 °C was added molecular sieves (1.2 g, 1.08 mmol, 1.00 eq). The mixture was stirred at 25 ° C for 0.5 h. Compound 8.2.11 (2.12 g, 2.17 mmol, 2 eq) and DBU (495.42 mg, 3.25 mmol, 490.51 uL, 3 eq) were then added at 25 ° C. The mixture was stirred at 25 ° C for 0.5 h. LCMS indicated that compound 8.2.10 was completely consumed. The mixture was filtered through 3A MS, and the filter cake was washed with ACN (5 mL). The crude product was purified by preparative HPLC (column: YMC-Triart Prep C18 250*50mm*10um; mobile phase: [TEAB (10 mM)-ACN]; B%: 18%-50%, 22 min. Compound 8.2.12 [(m-2H + ) / z=1371.8, 1.92 g, 678.28 umol, 62.53% yield, 97% purity] and characterized by HPLC and LCMS (see Figure 31 ).

[1656] Synthesis of compound 8B

[1657] To a solution of compound 8.2.12 (0.18 g, 65.56 umol, 1 eq) in THF (2 mL) was added TBAF (1 M, 196.67 uL, 3 eq) at 25 ° C. The mixture was stirred at 25 ° C for 24 hours. LCMS indicated that compound 8.2.12 was completely consumed. The mixture was washed with TEAB (10 mL), diluted with DCM (10 mL), dried over anhydrous Na2SO4, then filtered and concentrated. The crude product was purified by preparative HPLC (column: YMC-Actus Triart C18150*30mm*5um; mobile phase: [TEAB (10 mM)-ACN]; B%: 30%-60%, 12 min). Compound 8B [(m-3H +) / z=834.8, 0.124 g, 47.48 umol, 72.42% yield, 96% purity), and characterized by HPLC and LCMS (see Figure 32 ).

[1658] 1.2.1 Coupling conditions of MOE fragment

[1659] Based on the IPC after the coupling reaction, the conversion of the coupling step is complete. The coupling step conditions and HPLC purity of the different stages are summarized as follows:

[1660]

[1661] In summary, pentameric oligonucleotides were synthesized by liquid-phase linear extension of 2'-MOE amidites using PSI reagents. Detritylation with DCA resulted in the removal of adenosine trimming. Trimer detritylation was achieved via an acidic treatment step with 20% citric acid. Similar to the extension of deoxyoligonucleotides, coupling efficiency decreased with oligonucleotide length. Additional PSI amidites and DBU equivalents were required at the later stages of the coupling.

[1662] 1.3 Convergence and synthesis of fragments

[1663]

[1664] Fragment 8C was synthesized by combining fragments 8A and 8B-2. Fragment 8B-2 was synthesized from 8B-1 and the synthesis of fragment 8A was as described above.

[1665]

[1666] Synthesis of UdTdTdC fragment 8B-2

[1667] The formation of the UdTdTdC fragment was provided during the synthesis of ASO 9 by cleavage of the cyanoethyl group by amine treatment of the tetramer fragment obtained by amidite chemistry, followed by coupling with the PSI reagent (10 eq) in ACN at 0°C. The product 8B-2 is extremely water-sensitive. If the treatment is exposed to air, the product will be hydrolyzed by moisture.

[1668]

[1669] Two types of amines for cleaving cyanoethyl groups were screened, namely 2-methylpropane-2-amine and TEA. The results are listed in the following table:

[1670]

[1671] Convergent synthesis of ASO 8C

[1672]

[1673] Compound 8A (0.05 g, 28.40 umol, 1 eq) was azeotroped with ACN (2 mL*2). Compound 8B-2 (164.32 mg, 85.19 umol, 3 eq) was azeotroped with ACN (2 mL*2). Molecular sieves were added to compound 8B-2 in ACN (0.1 mL) at 25°C. (0.015 g, 1.00 eq). The mixture was stirred at 25°C for 0.5 h. Compound 8A (0.05 g, 28.40 μmol, 1 eq) and DBU (30.26 mg, 198.78 μmol, 29.96 μL, 7 eq) were premixed in ACN (0.2 mL) to prepare a mixture. This mixture was then added dropwise to compound 8B-2 (164.32 mg, 85.19 μmol, 3 eq) in ACN (0.1 mL) under Ar at 25°C. The mixture was stirred at 25°C for 0.5 h. LCMS and HPLC showed that the starting material was consumed by more than 90%. The reaction mixture was filtered. The mixture was purified by preparative HPLC (neutral conditions, column: Phenomenex Gemini-NX 80*30mm*3um; mobile phase: [water (10mM NH4HCO3)-ACN]; B%: 25%-55%, 7min). Compound 8C [(m-4H + ) / z=879.4, 40.0 mg, 9.77 umol, 34.4% yield, 86% purity] and characterized by HPLC and LCMS (see Figure 33 ).

[1674] In summary, PSI chemistry was successfully applied to the liquid-phase synthesis of deoxytetramers and 2'-MOE pentamers, as well as the convergent liquid-phase synthesis of stereocontrolled ASOs. Convergent coupling reactions are very sensitive to moisture. A pre-azeotropic addition of HO with ACN is necessary to ensure high conversion. Furthermore, the DBU concentration is crucial for conversion, with a recommended 0.64 M (10% DBU to ACN volume ratio) for high conversion.

[1675] Example 9. Deprotection of ASO full-length product

[1676]

[1677] First, the cyanoethyl group was deprotected by dissolving 64 g of protected ASO 9 in 640 ml of CH3CN:Et3N=1:1 solution. 25After stirring at 400 ° C for two hours, the solvent was removed by rotary evaporation. The crude product was taken to the next step for deprotection of LHPG and amine protecting groups. 500 ml of concentrated NH3 / H2O was added to the crude mixture, and the reaction mixture was stirred at 25 ° C until the solid was completely dissolved (about 20-30 minutes). After dissolving the solid in NH3 / H2O, the mixture was transferred to a 1 L glass pressure flask and then heated at 65 ° C for 5 hours. The reaction mixture was cooled to room temperature, and the deprotected ASO 9 was prepared for downstream purification. In this operation, all protecting groups on ASO 9 (except 5'-DMTr) were deprotected. The DMTr group was removed after downstream HIC purification.

[1678] The present invention relates to:

[1679] 1. A liquid phase method for preparing a compound of formula (AI) or a salt thereof:

[1680]

[1681] It comprises the compound of formula (AII) or a salt thereof:

[1682]

[1683] Deprotection, wherein the deprotection reaction is carried out in an anhydrous or substantially anhydrous solution, and wherein:

[1684] R 1 is independently at each occurrence a nucleobase, wherein the NH2 of said nucleobase (if present) is protected by an amine protecting group;

[1685] R 2 In each occurrence, independently selected from the group consisting of H, halo, and optionally C 1-6 Alkoxy-substituted C 1-6 a group consisting of alkoxy groups;

[1686] R 4 Each occurrence is independently H or R 2 The alkoxy groups form a ring;

[1687] R 15 is a hydroxyl protecting group;

[1688] R 16 C independently at each occurrence 1-6 Alkyl, C 2-6 alkenyl, phenyl or benzyl, each of which is optionally substituted with -CN, -NO2 or halogen; or

[1689] R 16 for

[1690] z is 0 or an integer from 1 to 200;

[1691] X is independently O or S at each occurrence; and

[1692] Y is a hydrophobic hydroxyl protecting group containing an alkyl chain.

[1693] 2. The method according to embodiment 1, wherein R 15 It is 4,4'-dimethoxytrityl.

[1694] 3. The method according to embodiment 1 or 2, wherein the deprotection reaction is carried out in the presence of a desiccant.

[1695] 4. The method of embodiment 3, wherein the desiccant is a molecular sieve.

[1696] 5. The method according to embodiment 4, wherein the size of the molecular sieve is

[1697] 6. The method of embodiment 1 or 2, wherein the anhydrous or substantially anhydrous solution is obtained by removing water using azeotropic distillation prior to the deprotection reaction.

[1698] 7. The method of any one of embodiments 1-6, wherein the deprotection reaction is carried out in the presence of a cation scavenger comprising a -SH group, a silane group, a siloxane group, a polystyrene group, a furan group, a pyrrole group, or an indole group.

[1699] 8. The method of embodiment 7, wherein the cation scavenger is a compound of formula RSH, wherein R is alkyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, each of which is optionally substituted.

[1700] 9. The method according to embodiment 8, wherein RSH is CH3(CH2)5SH, CH3(CH2) 11 SH, cyclohexanethiol, CH3CH2OC(=O)CH2CH2SH.

[1701] 10. The method of any one of embodiments 1-9, wherein the deprotection reaction is performed by reacting the compound of formula (AII) with a detritylation agent.

[1702] 11. The method of embodiment 10, wherein the detritylation agent is a strong organic acid.

[1703] 12. The method of embodiment 10, wherein the detritylation agent is CF3COOH, CCl3COOH, CHCl2COOH, CH2ClCOOH, H3PO4, methanesulfonic acid, benzenesulfonic acid, CClF2COOH, CHF2COOH, or PhSO2H.

[1704] 13. The method of embodiment 11, wherein the detritylation agent is CH2ClCOOH.

[1705] 14. The method of embodiment 10, wherein the detritylation agent is CF3COOH or CHCl2COOH.

[1706] 15. The method of any one of embodiments 1-14, wherein Y is represented by the formula:

[1707]

[1708] Where X is C 1-10 Alkyl, wherein one or more CH2 groups are independently replaced by C(O), C(O)NH2, cycloalkyl or C 1-6 Heterocyclyl replacement; and X1 is C 1-25 Alkyl or C 1-25 Alkoxy.

[1709] 16. The method according to embodiment 15, wherein Y is represented by the following formula:

[1710]

[1711] 17. The method of any one of embodiments 1-16, wherein:

[1712] Each R 2 are independently mj, k H, F or optionally C 1-4 Alkoxy-substituted C 1-4 alkoxy;

[1713] R 4 is H; and

[1714] R 16 It is -CH2CH2CN.

[1715] 18. The method of any one of embodiments 1-17, wherein the compound of formula (AI) is not purified by chromatography.

[1716] 19. The method of any one of embodiments 1-17, wherein the compound of formula (AI) is purified by selective precipitation and / or extraction.

[1717] 20. A liquid phase method for preparing an oligonucleotide fragment of formula (I) or a salt thereof,

[1718]

[1719] It includes the following steps:

[1720] 1) the compound of formula (I'A) or a salt thereof:

[1721]

[1722] Deprotection to form a compound of formula (IA) or a salt thereof:

[1723]

[1724] 2) reacting a compound of formula (IA) or a salt thereof with a compound of formula (A1) or a salt thereof:

[1725]

[1726] Reaction to form a compound of formula (IB) or a salt thereof:

[1727] and

[1728] 3) sulfiding or oxidizing the compound of formula (IB) or its salt with a sulfiding agent or an oxidizing agent to form a compound of formula (IC) or its salt:

[1729]

[1730] 4) deprotecting the compound of formula (IC) or a salt thereof to form a compound of formula (ID) or a salt thereof:

[1731]

[1732] 5) Starting from the compound of formula (ID), repeating steps 2), 3) and 4) n-2 times to obtain a fragment of formula (I) or a salt thereof, wherein:

[1733] R 1 is independently at each occurrence a nucleobase, wherein the NH2 of said nucleobase (if present) is protected by an amine protecting group;

[1734] R 2 In each occurrence, independently selected from the group consisting of H, halo, and optionally C 1-6 Alkoxy-substituted C 1-6 a group consisting of alkoxy groups;

[1735] R 4 Each occurrence is independently H or R 2 The alkoxy groups form a ring;

[1736] R 15 is a hydroxyl protecting group;

[1737] R 16 C independently at each occurrence 1-6 Alkyl, C 2-6alkenyl, phenyl or benzyl, each of which is optionally substituted with -CN, -NO2 or halogen; or

[1738] R 16 for

[1739] R 17a and R 17b Independently C 1-6 alkyl;

[1740] n is an integer from 2 to 20;

[1741] X is independently O or S at each occurrence;

[1742] Y is a hydrophobic hydroxyl protecting group containing an alkyl chain.

[1743] 21. The method of embodiment 20, wherein the fragment of formula (I) is not purified by chromatography.

[1744] 22. The method of embodiment 21, wherein the fragment of formula (I) is purified by selective precipitation and / or extraction.

[1745] 23. The method of any one of embodiments 20-22, wherein the reaction product of any of steps 1), 2), 3) and 4) is not purified using chromatography.

[1746] 24. The method of any one of embodiments 20-23, wherein the reaction product of any one of steps 1), 2), 3) and 4) is purified by selective precipitation.

[1747] 25. The method of any one of embodiments 20-24, wherein Y is

[1748]

[1749] 26. The method according to any one of embodiments 20-25, wherein any one of the deprotection reactions in step 1) and step 4) is performed as defined in embodiment 2-14.

[1750] 27. A convergent liquid phase method for preparing target oligonucleotides comprising the following steps:

[1751] a) making an oligonucleotide frag...

Claims

1. A liquid phase method for preparing a compound of formula (AI) or a salt thereof: It comprises the compound of formula (AII) or a salt thereof: Deprotection, wherein the deprotection reaction is carried out in an anhydrous or substantially anhydrous solution, and wherein: R 1 is independently at each occurrence a nucleobase, wherein the NH2 of said nucleobase, if present, is protected by an amine protecting group; R 2 independently selected at each occurrence from H, halo and optionally C 1-6 Alkoxy substituted C 1-6 A group consisting of alkoxy groups; R 4 Each occurrence is independently H or R 2 The alkoxy groups form a ring; R 15 is a hydroxyl protecting group; R 16 C independently at each occurrence 1-6 Alkyl, C 2-6 alkenyl, phenyl or benzyl, each of which is optionally substituted with -CN, -NO2 or halogen; or R 16 for z is 0 or an integer from 1 to 200; X is independently O or S at each occurrence; and Y is a hydrophobic hydroxyl protecting group containing an alkyl chain.

2. The method of claim 1, wherein R 15 It is 4,4'-dimethoxytrityl.

3. The method of claim 1 or 2, wherein the deprotection reaction is carried out in the presence of a desiccant.

4. The method of claim 3, wherein the desiccant is a molecular sieve.

5. The method of claim 4, wherein the size of the molecular sieve is 6. The method of claim 1 or 2, wherein the anhydrous or substantially anhydrous solution is obtained by removing water using azeotropic distillation prior to the deprotection reaction.

7. The method of any one of claims 1 to 6, wherein the deprotection reaction is carried out in the presence of a cation scavenger comprising a -SH group, a silane group, a siloxane group, a polystyrene group, furan, pyrrole or indole.

8. The method of claim 7, wherein the cation scavenger is a compound of formula RSH, wherein R is alkyl, cycloalkyl, heterocycloalkyl, aryl or heteroaryl, each of which is optionally substituted.

9. The method of claim 8, wherein RSH is CH3(CH2)5SH, CH3(CH2) 11 SH, cyclohexanethiol, CH3CH2OC(=O)CH2CH2SH.

10. The method according to any one of claims 1 to 9, wherein the deprotection reaction is performed by reacting the compound of formula (AII) with a detritylation agent.

Images