Oligonucleotide synthesis method suitable for high-loading resin carrier

Abstract

The invention relates to the technical field of oligonucleotide solid-phase synthesis, and provides an oligonucleotide synthesis method suitable for a high-load resin carrier. According to the method, reagents for synthesizing oligonucleotides are introduced into a nucleic acid synthesizer, reaction cycles are performed according to a deprotection stage, a coupling cycle stage, an oxidation / vulcanization stage and a capping stage, and oligonucleotides are synthesized through a plurality of reaction cycles. The method provided by the invention is simple in steps, easy to operate and suitable for various different high-loading resins, the synthesized crude product is high in purity, and the dosage of reagents is small; moreover, the running program of the nucleic acid synthesizer is strictly controlled, so that efficient and automatic synthesis of short-chain DNA can be realized, and the labor intensity is low. Results of the embodiment show that when DNA with 20 sequences is synthesized by adopting the method disclosed by the invention, the purity of a crude product can reach 78% or above, and high-efficiency synthesis of oligonucleotides can be realized by adopting different high-loading resins as solid-phase carriers.

Description

Technical Field

[0001] The invention relates to the technical field of oligonucleotide solid phase synthesis, and in particular to an oligonucleotide synthesis method suitable for a high-load resin carrier. Background Art

[0002] Oligonucleotides are gene-targeted therapeutic drugs that can be used to treat viruses, tumors, and genetic diseases. They have been a hot topic in drug research in recent years. Oligonucleotides usually refer to RNA or DNA molecules containing 10 to 50 bases and their analogs. According to their drug action mechanism, they are mainly divided into: interfering RNA (small-interfering RNAs, siRNAs), antisense oligonucleotides (antisense oligonucleotides, ASOs) and nucleic acid aptamers (Aptamer). At present, oligonucleotides are basically synthesized by chemical methods, usually by solid phase triester phosphite method, and separated and purified by high performance liquid chromatography. Among them, reversed phase ion pair chromatography is the most commonly used due to its rapid and efficient advantages.

[0003] Compared with traditional small molecule drugs, the use of oligonucleotides as drugs is a completely new treatment method. The potential of RNA therapy in precision medicine has inspired people to apply oligonucleotide drugs to the treatment of cancer, cardiovascular disease and rare diseases. In recent years, oligonucleotide drugs such as Givosiran, Lumasiran and Viltolarsen approved by the FDA have led RNA interference or RNA therapy into the mainstream of drug development.

[0004] The existing oligonucleotide process can achieve high-efficiency synthesis for a single type of high-load resin carrier. If other high-load resin carriers are used, the synthesis efficiency will be greatly reduced. This means that different types of high-load resin carriers require different oligonucleotide synthesis processes to match, and the workload has increased several times. Therefore, it is necessary to develop an efficient oligonucleotide synthesis process suitable for multiple high-load resin carriers to solve the above problems. Summary of the invention

[0005] In view of this, the present invention provides a method for synthesizing oligonucleotides suitable for high-loading resin carriers. The synthesis method provided by the present invention is universal and can be applied to different high-loading carrier resins. It is also simple to operate, highly automated, and the synthesized oligonucleotides have high purity.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] A method for synthesizing oligonucleotides suitable for a high-load resin carrier comprises the following steps:

[0008] The reagents used for synthesizing oligonucleotides are connected to a nucleic acid synthesizer for synthesis to obtain the oligonucleotides; the solid phase carrier used in the nucleic acid synthesizer is a high-load resin; the loading capacity of the high-load resin is ≥200 μmol / g;

[0009] The nucleic acid synthesizer is provided with a first inlet valve, a second inlet valve, a third inlet valve, a fourth inlet valve, a circulation valve, a first column position valve, a second column position valve, a waste valve and a synthesis column; the first inlet valve and the second inlet valve are respectively connected to the third inlet valve through an infusion pipeline; the third inlet valve is connected to the first column position valve through an infusion pipeline; the two ends of the synthesis column are respectively connected to the first column position valve and the second column position valve by an infusion pipeline; the fourth inlet valve is connected to the circulation valve through an infusion pipeline, and the circulation valve is provided with a circulation mode and an open mode. In the circulation mode, the second column position valve, the circulation valve and the first column position valve are connected. In the open mode, the second column position valve, the circulation valve and the waste valve are connected, and the circulation valve is also connected to the first column position valve; the synthesis column is filled with a solid phase carrier;

[0010] The synthesis comprises several reaction cycles; each reaction cycle comprises a deprotection stage, a coupling cycle stage, an oxidation / sulfurization stage and a capping stage performed in sequence;

[0011] During the deprotection stage, the circulation valve is set to an open mode, and the deprotection reagent is injected through the third inlet valve;

[0012] In the coupling cycle stage, the phosphoramidite monomer solution is injected through the first inlet valve, the second inlet valve and the third inlet valve, and the activator is injected through the fourth inlet valve, and then the circulation valve is set to the circulation mode for coupling circulation;

[0013] In the oxidation / sulfurization stage, the circulation valve is set to an open mode, and an oxidizing agent or a sulfiding agent is injected through the fourth inlet valve;

[0014] During the capping stage, the circulation valve is set to an open mode, and the capping reagent is injected through the third inlet valve and the fourth inlet valve.

[0015] Preferably, the nucleic acid synthesizer is the Bio-Oligo 100 nucleic acid synthesizer produced by Hanbang Technology.

[0016] Preferably, the deprotection reagent is trichloroacetic acid; the injection flow rate of the deprotection reagent is 6.3 to 20 mL / min; and in each reaction cycle, the deprotection stage lasts for 3 to 10 min.

[0017] Preferably, the concentration of the phosphoramidite monomer solution is 0.1 mol / L; the injection flow rate of the phosphoramidite monomer solution is 1.6-2.0 mL / min; the activator is a 5-ethylthiotetrazolyl solution, and the concentration of the 5-ethylthiotetrazolyl solution is 0.25-0.30 mol / L; the injection flow rate of the activator is 2.4-3.0 mL / min; the circulation flow rate of the material in the coupling circulation stage is 10-30 mL / min; in each reaction cycle, the time of the coupling circulation stage is 3-10 min.

[0018] Preferably, the oxidizing agent is a mixture of iodine, water and pyridine, the concentration of iodine in the mixture is 0.05-0.10 mol / L, and the volume ratio of water to pyridine is 1:9; the sulfiding agent includes bisphenylacetyl disulfide and a mixture of 3-methylpyridine / acetonitrile;

[0019] The injection flow rate of the oxidizing agent or the sulfiding agent is independently 6.3 to 12 mL / min;

[0020] In each reaction cycle, the oxidation / sulfurization stage lasts for 1 to 4 minutes.

[0021] Preferably, the capping reagent includes a capping A reagent and a capping B reagent; the capping A reagent is a 1-methylimidazole-acetonitrile mixed reagent, and the volume ratio of 1-methylimidazole to acetonitrile in the 1-methylimidazole-acetonitrile mixed reagent is 1:5; the capping B reagent is an isobutyric anhydride-pyridine-acetonitrile mixed reagent, and the volume ratio of isobutyric anhydride, pyridine and acetonitrile in the isobutyric anhydride-pyridine-acetonitrile mixed reagent is 2:3:5; the capping A reagent is injected from the third inlet valve, and the capping B reagent is injected from the fourth inlet valve.

[0022] Preferably, the injection flow rates of the capping reagent A and the capping reagent B are independently 6.3-12 mL / min; in each reaction cycle, the time of the capping stage is 1-3 min.

[0023] Preferably, the operating temperature of the nucleic acid synthesizer is 10 to 30° C., and the system pressure is -0.1 to 20 bar.

[0024] Preferably, the volume of the synthesis column is 6.3 mL.

[0025] Preferably, the high-load resin is a cross-linked polystyrene resin or a polyamide polyethylene-glycol resin.

[0026] The invention provides an oligonucleotide synthesis method suitable for a high-load resin carrier, comprising the following steps: connecting a reagent used for synthesizing oligonucleotides into a nucleic acid synthesizer for synthesis to obtain the oligonucleotides; the solid phase carrier used in the nucleic acid synthesizer is a high-load resin; the load of the high-load resin is ≥200 μmol / g; the nucleic acid synthesizer is provided with a first inlet valve, a second inlet valve, a third inlet valve, a fourth inlet valve, a circulation valve, a first column position valve, a second column position valve, a waste valve and a synthesis column; the first inlet valve and the second inlet valve are respectively connected to the third inlet valve through an infusion pipeline; the third inlet valve is connected to the first column position valve through an infusion pipeline; the two ends of the synthesis column are respectively connected to the first column position valve and the second column position valve through an infusion pipeline; the fourth inlet valve is connected to the circulation valve through an infusion pipeline; the circulation valve is provided with a circulation mode and an open mode, in which the second column position valve, the circulation ... The valve is connected to the first column position valve, and in the open mode, the second column position valve, the circulation valve and the waste valve are connected, and the circulation valve is also connected to the first column position valve; the synthesis column is filled with a solid phase carrier; the synthesis includes several reaction cycles; each reaction cycle includes a deprotection stage, a coupling cycle stage, an oxidation / sulfurization stage and a capping stage performed in sequence; in the deprotection stage, the circulation valve is set to an open mode, and a deprotection reagent is injected through the third inlet valve; in the coupling cycle stage, a phosphoramidite monomer solution is injected through the first inlet valve, the second inlet valve and the third inlet valve, and an activator is injected through the fourth inlet valve, and then the circulation valve is set to a circulation mode for coupling cycle; in the oxidation / sulfurization stage, the circulation valve is set to an open mode, and an oxidizing agent or a sulfiding agent is injected through the fourth inlet valve; in the capping stage, the circulation valve is set to an open mode, and a capping agent is injected through the third inlet valve and the fourth inlet valve. The present invention adopts a nucleic acid synthesizer to synthesize oligonucleotides through several reaction cycles. The method is simple, easy to operate, and applicable to a variety of different high-load resins. The crude product of the synthesis has high purity and a small amount of reagents. In addition, the operation program of the nucleic acid synthesizer of the present invention is strictly controlled, and the efficient automatic synthesis of short-chain DNA can be achieved with low labor intensity. The results of the embodiment show that the purity of the crude product of 20 sequences of DNA can reach more than 78% by adopting the method of the present invention, and different high-load resins are used as solid phase carriers to achieve efficient synthesis of oligonucleotides. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 Schematic diagram of the operation in the deprotection stage;

[0028] Figure 2 It is a schematic diagram of the operation of the coupling cycle stage;

[0029] Figure 3 It is a schematic diagram of the operation of the oxidation / sulfurization stage;

[0030] Figure 4 It is a schematic diagram of the operation of the capping stage;

[0031] Figure 1 to Figure 4 Middle: V1-first inlet valve, V2-second inlet valve, V3-third inlet valve, V4-fourth inlet valve, V5-circulation valve, V6-first column position valve, V7-second column position valve, V8-waste valve; P01-first infusion pump, P02-second infusion pump, PT01-pressure sensor, Cd01-conductivity sensor, UV01-ultraviolet detector, L-synthetic column. DETAILED DESCRIPTION

[0032] The present invention provides a method for synthesizing oligonucleotides suitable for a high-load resin carrier, comprising the following steps:

[0033] The reagents used for synthesizing oligonucleotides are connected to a nucleic acid synthesizer for synthesis to obtain the oligonucleotides; the solid phase carrier used in the nucleic acid synthesizer is a high-load resin; the loading capacity of the high-load resin is ≥200 μmol / g;

[0034] The nucleic acid synthesizer is provided with a first inlet valve, a second inlet valve, a third inlet valve, a fourth inlet valve, a circulation valve, a first column position valve, a second column position valve, a waste valve and a synthesis column; the first inlet valve and the second inlet valve are respectively connected to the third inlet valve through an infusion pipeline; the third inlet valve is connected to the first column position valve through an infusion pipeline; the two ends of the synthesis column are connected to the first column position valve and the second column position valve by an infusion pipeline respectively; the fourth inlet valve is connected to the circulation valve through an infusion pipeline; the circulation valve is provided with a circulation mode (Recycle) and an open mode (Regent), in which the second column position valve, the circulation valve and the first column position valve are connected, and in the open mode, the second column position valve, the circulation valve and the waste valve are connected, and the circulation valve is also connected to the first column position valve; the synthesis column is filled with a solid phase carrier;

[0035] The synthesis comprises several reaction cycles; each reaction cycle comprises a deprotection stage, a coupling cycle stage, an oxidation / sulfurization stage and a capping stage performed in sequence;

[0036] During the deprotection stage, the circulation valve is set to an open mode, and the deprotection reagent is injected through the third inlet valve;

[0037] In the coupling cycle stage, the phosphoramidite monomer solution is injected through the first inlet valve, the second inlet valve and the third inlet valve, and the activator is injected through the fourth inlet valve, and then the circulation valve is set to the circulation mode for coupling circulation;

[0038] In the oxidation / sulfurization stage, the circulation valve is set to an open mode, and an oxidizing agent or a sulfiding agent is injected through the fourth inlet valve;

[0039] During the capping stage, the circulation valve is set to an open mode, and the capping reagent is injected through the third inlet valve and the fourth inlet valve.

[0040] In the present invention, the first inlet valve, the second inlet valve, the third inlet valve, the fourth inlet valve, the circulation valve, the first column position valve, the second column position valve and the waste valve are preferably electric switching valves, and are preferably provided with n injection ports, n ≥ 6, numbered in sequence as ports 1 to n. In a specific embodiment of the present invention, the first inlet valve, the second inlet valve, the third inlet valve, the fourth inlet valve, the first column position valve, the second column position valve and the waste valve are preferably provided with 8 injection ports, numbered in sequence as ports 1 to 8, and the circulation valve is preferably provided with 6 injection ports, numbered in sequence as ports 1 to 6. In the present invention, among the 8 injection ports of the first inlet valve, ports 2, 3, 5, 6 and 8 are respectively used to introduce different phosphoramidite monomers, and the corresponding phosphoramidite monomers are respectively denoted as A, C, G, T and X (X represents the spare monomer injection port), and ports 1, 4 and 7 are used to introduce acetonitrile (ACN), as shown in FIG. Figure 1 As shown; among the 8 injection ports of the second inlet valve, ports 2, 3, 5, 6, and 8 are respectively used to introduce different phosphoramidite monomers, and the corresponding phosphoramidite monomers are respectively recorded as a, c, g, u, and Y (u and Y represent spare monomer injection ports), and ports 1, 4, and 7 are used to introduce acetonitrile, as shown in detail Figure 1 to Figure 4 As shown; among the 8 injection ports of the third inlet valve, port 1 is connected to the first inlet valve, port 8 is connected to the second inlet valve, port 3 is used to introduce capping A reagent (CAP-A), port 4 is used to introduce deprotection reagent (DETRIT), port 5 is used to introduce acetonitrile, and ports 6 and 7 are used to introduce different phosphoramidite monomers, and the corresponding phosphoramidite monomers are respectively denoted as Z and Q, as shown in FIG. Figure 1 to Figure 4 As shown; in the fourth inlet valve, ports 1 and 4 are used to introduce acetonitrile, port 2 is used to introduce a sulfiding agent (THIO), port 3 is used to introduce a capping B reagent (CAP-B), port 5 is used to introduce an oxidizing agent (OX), port 6 is a spare port (EXTRA), port 7 is used to introduce a diethylamine-acetonitrile mixture (DEA), and port 8 is used to introduce an activating agent, as shown in FIG. Figure 1 to Figure 4 As shown; in the above-mentioned injection port, the acetonitrile inlet is used to introduce acetonitrile for pipeline cleaning.

[0041] In a specific embodiment of the present invention, the third inlet valve, the first column position valve and the circulation valve are preferably all connected to the pressure sensor, and the pipeline connecting the third inlet valve and the pressure sensor is preferably provided with a first infusion pump, and the pipeline connecting the circulation valve and the pressure sensor is preferably provided with a second infusion pump; the pipeline connecting the second column position valve and the circulation valve is preferably provided with a conductivity detection device; the pipeline connecting the circulation valve and the waste valve is provided with an ultraviolet detector; the first infusion pump and the second infusion pump are preferably plunger pumps.

[0042] In the present invention, the volume of the synthesis column is preferably 6.3 mL; in a specific embodiment of the present invention, the upper and lower ends of the synthesis column are preferably connected to the injection ports of the first column position valve and the second column position valve. In a specific embodiment of the present invention, when the first column position valve and the second column position valve have 8 injection ports, 7 synthesis columns can be connected between the first column position valve and the second column position valve, specifically, the upper and lower ends of the first synthesis column are connected to port 1 of the first column position valve and the second column position valve, the upper and lower ends of the second synthesis column are connected to port 2 of the first column position valve and the second column position valve, and so on; when performing synthesis, it is specifically synthesized in one synthesis column.

[0043] In a specific embodiment of the present invention, the synthesizer is preferably Hanbang Technology Bio-Oligo 100 nucleic acid synthesizer; the Hanbang Technology Bio-Oligo 100 nucleic acid synthesizer occupies a small space, has a high degree of automation, and has low labor intensity. By strictly controlling the operating program of the automatic synthesis system of the Hanbang Oligo-100 nucleic acid synthesizer, efficient automated synthesis of oligonucleotides can be achieved.

[0044] In the present invention, the loading capacity of the high loading resin is ≥200 μmol / g, preferably 200-500 μmol / g, and further preferably 200 μmol / g, 340 μmol / g or 350 μmol / g; the high loading resin is preferably a cross-linked polystyrene resin or a polyamide polyethylene-ethylene glycol resin; the cross-linked polystyrene resin is preferably a polystyrene-divinylbenzene cross-linked resin, which uses divinylbenzene as a cross-linking agent to cross-link monodisperse polystyrene microspheres, and is a spatial network structure in three dimensions, and the reactant molecules can move freely inside the resin; in a specific embodiment of the present invention, the model of the high loading resin is preferably NittoPhase HL UnyLinker TM 350. Lanxiao Seplife Unylinker-OH Resin or Nankai Hecheng Resins with Unylinker Pre-loaded.

[0045] In the present invention, the synthesis includes several reaction cycles; each reaction cycle includes a deprotection stage, a coupling cycle stage, an oxidation / sulfurization stage and a capping stage performed in sequence; the operation schematic diagram of the deprotection stage, the coupling cycle stage, the oxidation / sulfurization stage and the capping stage is as shown in Figure 1 to Figure 4 As shown below; combined Figure 1 to Figure 4 Provide detailed description of each stage.

[0046] In the present invention, in the deprotection stage, the circulation valve is set to an open mode, and the deprotection reagent is injected through the third inlet valve; in a specific embodiment of the present invention, the deprotection reagent is preferably injected from port 4 of the third inlet valve, the deprotection reagent enters the first column position valve, then enters the synthesis column, reacts with the solid phase carrier, and then flows into the second column position valve, and then enters the waste valve after passing through ports 3 and 4 of the circulation valve; in the deprotection stage, the solid phase carrier reacts with the deprotection reagent to remove the DMT group on the solid phase carrier to expose the 5' hydroxyl group for the next coupling step.

[0047] In the present invention, the deprotection reagent is preferably trichloroacetic acid; the injection flow rate of the deprotection reagent is preferably 6.3-20 mL / min, more preferably 9-15.7 mL / min; in each reaction cycle, the time of the deprotection stage is preferably 3-10 min, more preferably 4-7 min; in a specific embodiment of the present invention, it is preferred to end the protection stage when the time reaches the requirement and the UV value of the wastewater entering the waste valve is lower than 100. The present invention fully contacts the deprotection reagent with the solid phase carrier through the deprotection stage to improve the reaction efficiency. The UV value is preferably detected by an ultraviolet detector, and the wavelength of the ultraviolet detector is preferably 350 nm and 260 nm.

[0048] In the present invention, in the coupling cycle stage, the phosphoramidite monomer solution is injected through the first inlet valve, the second inlet valve and the third inlet valve, and the activator is injected through the fourth inlet valve, and then the circulation valve is set to the circulation mode for coupling circulation; the phosphoramidite monomer is specifically a DMT-modified phosphoramidite monomer, and the present invention has no special requirements for the specific type of the phosphoramidite monomer, and it can be selected according to the sequence of the target oligonucleotide. In the present invention, it is preferred to first pass the phosphoramidite monomer solution, and then pass the activator, and then set the circulation valve to the circulation mode, and the liquid in the pipeline circulates; in a specific embodiment of the present invention, different types of phosphoramidite monomer solutions are preferably passed from different inlets, and the activator is preferably passed to the 8th port of the fourth inlet valve; after the phosphoramidite monomer solution is passed, it enters the first column position valve, then enters the synthesis column, and then enters the second column position valve. After the activator is passed, it enters the first column position valve through the circulation valve, and then enters the synthesis column and the second column position valve. After the circulation valve mode of the circulation valve is turned on, the circulating liquid circulates between the first column position valve, the synthesis column, the second column position valve, and the circulation valve.

[0049] In the present invention, the phosphoramidite monomer solution is preferably obtained by drying the phosphoramidite monomer and then dissolving it in acetonitrile; the concentration of the phosphoramidite monomer solution is preferably 0.1-0.2 mol / L, more preferably 0.1 mol / L; the present invention preferably adds molecular sieves to the phosphoramidite monomer solution to remove moisture in the solution, and the added molecular sieves are based on covering a layer at the bottom of the reagent bottle; the molecular sieve is preferably Kolma 3A spherical molecular sieve; the present invention has no special requirements on the type of the phosphoramidite monomer, and the corresponding phosphoramidite monomer can be selected according to the base sequence of the target oligoanhydride; the injection flow rate of the phosphoramidite monomer is preferably 1.6-2.0 mL / min.

[0050] In the present invention, the activator is preferably a 5-ethylthiotetrazolyl (ETT) solution, and the concentration of the 5-ethylthiotetrazolyl solution is preferably 0.25-0.3 mol / L; the injection flow rate of the activator is preferably 2.4-3.0 mL / min; the circulation flow rate of the material in the coupling cycle stage is preferably 10-30 mL / min, more preferably 15-21 mL / min; in each reaction cycle, the time of the coupling cycle stage is 3-10 min, more preferably 4-6 min; in the coupling cycle stage, the liquid flow direction of the material in the synthesis column flows from top to bottom, and the solvent in the circulation pipeline circulates, so that the mixture of the monomer and the activator can fully contact with the solid phase carrier, ensuring that the monomer can be successfully mounted; in the coupling cycle stage, the phosphoramidite is activated under the action of the activator and coupled with the solid phase carrier to extend the oligonucleotide chain.

[0051] In the oxidation / sulfurization stage, the circulation valve is set to an open mode, and an oxidizing agent or a sulfiding agent is injected through the fourth inlet valve; in a specific embodiment of the present invention, the oxidizing agent is preferably injected from port 5 of the fourth inlet valve, and the sulfiding agent is preferably injected from port 2 of the fourth inlet valve; after the oxidizing agent or the sulfiding agent is injected, it enters the first column position valve through ports 1 and 2 of the circulation valve, then enters the synthesis column to react with the solid phase carrier, then enters the second column position valve, and then enters the waste liquid valve after passing through ports 3 and 4 of the circulation valve; the phosphite structure formed in the coupled circulation stage is unstable, and is converted into a stable phosphite structure by the oxidizing agent or the sulfiding agent in the oxidation / sulfurization stage.

[0052] In the present invention, the oxidizing agent is a mixture of iodine, water and pyridine, the concentration of iodine in the mixture is preferably 0.05-0.1 mol / L, and the volume ratio of water to pyridine is preferably 1:9; the sulfiding agent preferably includes bisphenylacetyl disulfide (PADS) and a 3-methylpyridine / acetonitrile mixture, the volume ratio of the bisphenylacetyl disulfide and the 3-methylpyridine / acetonitrile mixture is preferably 1:1; the volume ratio of 3-methylpyridine to acetonitrile in the 3-methylpyridine / acetonitrile mixture is preferably 1:1; the injection flow rate of the oxidizing agent or the sulfiding agent is independently preferably 6.3-12 mL / min, more preferably 6.3-7.2 mL / min; in each reaction cycle, the time of the oxidation / sulfidation stage is preferably 1-4 min, more preferably 1-3 min, and further preferably 1.7 min.

[0053] In the present invention, in the capping stage, the circulation valve is set to an open mode, and the capping reagent is injected through the third inlet valve and the fourth inlet valve; the capping reagent preferably includes a capping A reagent and a capping B reagent; the capping A reagent is preferably a 1-methylimidazole-acetonitrile mixed reagent, and the volume ratio of 1-methylimidazole and acetonitrile in the 1-methylimidazole-acetonitrile mixed reagent is preferably 1:5; the capping B reagent is preferably an isobutyric anhydride-pyridine-acetonitrile mixed reagent, and the volume ratio of isobutyric anhydride, pyridine and acetonitrile in the isobutyric anhydride-pyridine-acetonitrile mixed reagent is preferably 2:3:5; the capping A reagent is preferably injected from the third inlet valve, and the capping B reagent is preferably Selected from the fourth inlet valve for injection; in a specific embodiment of the present invention, it is preferred to inject the cap A reagent through port 3 of the third inlet valve, and the cap B reagent through port 3 of the fourth inlet valve, and the cap A reagent and the cap B reagent are injected at the same time; after the cap A reagent is injected from the third inlet valve, it enters the first column position valve, then enters the synthesis column, and then enters the second column position valve, and then passes through ports 3 and 4 of the circulation valve to enter the waste valve; after the cap B reagent is injected from the fourth inlet valve, it enters the first column position valve through ports 1 and 2 of the circulation valve, then enters the synthesis column, and then enters the second column position valve, and then passes through ports 3 and 4 of the circulation valve to enter the waste valve.

[0054] In the present invention, the injection flow rates of the capped A reagent and the capped B reagent are independently preferably 6.3-12 mL / min, more preferably 6.3 mL / min; in each reaction cycle, the time of the capping stage is preferably 1-3 min, more preferably 1-2 min.

[0055] In the present invention, the operating temperature of the nucleic acid synthesizer is preferably 10 to 30° C., more preferably 25° C., and the system pressure is preferably -0.1 to 20 bar, more preferably 0 to 20 bar, and further preferably 10 bar.

[0056] In the present invention, each time a reaction cycle is performed, the base of the oligonucleotide chain is extended by one, and the number of reaction cycles can be determined according to the sequence of the target oligonucleotide; in a specific embodiment of the present invention, after the first reaction cycle is completed, each valve port is preferably switched to the initial state, and the deprotection stage, coupling cycle stage, oxidation / sulfurization stage and capping stage are repeated to complete the next reaction cycle until all sequence synthesis is completed.

[0057] In a specific embodiment of the present invention, after the last step of deprotection in the sequence, diethylamine-acetonitrile solution is preferably introduced to remove the cyanoethyl protecting group of phosphoric acid; the decyanoethylation process is preferably as follows: the circulation valve is set to an open mode, and the diethylamine-acetonitrile solution is injected through port 7 of the fourth inlet valve; the volume ratio of diethylamine and acetonitrile in the diethylamine-acetonitrile solution is preferably 1:4; the injection flow rate of the diethylamine-acetonitrile solution is preferably 3.0-3.5 mL / min, and the injection time is preferably 9.0-10.0 min.

[0058] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0059] In the following embodiment 1, the first inlet valve is a V1 valve, the second inlet valve is a V2 valve, the third inlet valve is a V3 valve, the fourth inlet valve is a V4 valve, the circulation valve is a V5 valve, the first column position valve is a V6 valve, the second column position valve is a V7 valve, and the waste liquid valve is a V8 valve.

[0060] The sequence of the oligonucleotide synthesized in the following examples is as follows: TTGCATGTAGCTGACCAGCA (SEQ ID NO: 1).

[0061] Example 1

[0062] Take 1.716 g of DMT-modified phosphoramidite monomers A, C, G, and T, respectively, add anhydrous acetonitrile to make the concentration of the monomer solution 0.1 mol / L, stir well, add molecular sieves (Kolema 3A spherical), and obtain 20 mL of each of the four phosphoramidite monomer solutions for coupling cycles.

[0063] The deprotection reagent used in this embodiment is trichloroacetic acid; the activating agent is 0.25 mol / L ETT solution; the oxidizing reagent is an iodine solution-water-pyridine mixture, wherein the iodine concentration is 0.05 mol / L, and the volume ratio of water to pyridine is 1:9; the capping reagent A is a mixture of 1-methylimidazole and acetonitrile, wherein the volume ratio of 1-methylimidazole to acetonitrile is 1:5, and the capping reagent B is a mixture of isobutyric anhydride, pyridine and acetonitrile, wherein the volume ratio of isobutyric anhydride, pyridine and acetonitrile is 2:3:5.

[0064] Get NittoPhase HLUnyLinker TM 0.28g of 350 carrier was loaded into a 6.3mL synthesis column, and the upper and lower ends of the synthesis column were connected to the No. 1 port of the V6 and V7 valves as column position 1. The remaining reaction reagents were connected to the corresponding pump inlet valve ports. The wavelengths of the UV detectors were set to 350nm and 260nm, respectively. The Bio-Oligo 100 nucleic acid synthesizer of Hanbang Technology was operated according to the procedures of deprotection, coupling cycle, oxidation / sulfurization and capping. After each reaction cycle, the valve port position was switched back to the initial state and the next reaction cycle was carried out until all sequence synthesis was completed. After the sequence synthesis was completed, the diethylamine-acetonitrile solution was injected through the No. 7 port of the fourth inlet valve to remove the cyanoethyl protecting group of the phosphoric acid; the volume ratio of diethylamine and acetonitrile in the diethylamine-acetonitrile solution was 1:4; the injection flow rate of the diethylamine-acetonitrile solution was 3.0mL / min, and the injection time was 10.0min.

[0065] Among them, in the deprotection stage, the deprotection reagent is injected through the port 4 of the V3 valve; in the coupled circulation stage, the corresponding phosphoramidite monomer solution is first injected through the middle V1~V3 valves, and the activator is injected through the port 8 of the V4 valve, and then the V5 valve is set to the Recycle mode, and the liquid in the pipeline circulates; in the oxidation stage, the oxidizing reagent is injected through the reagent valve V4 valve port 5; in the capping stage, the capping A reagent is injected through the port 2 of the V3 valve, and the capping B reagent is injected through the port 3 of the V4 valve, and both are injected at the same time.

[0066] System parameter settings are shown in Table 1.

[0067] Table 1 Oligonucleotide synthesis process parameter settings

[0068]

[0069] The system completed the synthesis of the oligonucleotide sequence after running 20 reaction cycles, and the purity of the crude synthetic product was calculated to be 79% after the processing was completed.

[0070] Example 2

[0071] Take 1.716 g of DMT-modified phosphoramidite monomers A, C, G, and T, respectively, add anhydrous acetonitrile to make the concentration of the monomer solution 0.1 mol / L, stir well, add molecular sieves, and add molecular sieves (Kolema 3A spherical) to obtain 20 mL of each of the four phosphoramidite monomer solutions for coupling cycles;

[0072] Take 0.28g of Seplife Unylinker-OH Resin resin carrier (loading capacity of 340.8umol / g) and load it into a 6.3mL synthesis column. Connect the upper and lower ends of the synthesis column to port 1 of the V6 and V7 valves as column position 1. The remaining reaction reagents are connected to the corresponding pump inlet valve ports. The UV detector wavelengths are set to 350nm and 260nm respectively. The Bio-Oligo100 nucleic acid synthesizer of Hanbang Technology operates according to the procedures of deprotection, coupling cycle, oxidation / sulfurization and capping. After each reaction cycle, the valve port is switched back to the initial state for the next reaction cycle until all sequence synthesis is completed.

[0073] The reagents used in each stage and the injection method are the same as those in Example 1.

[0074] The operating procedure and operating parameters of the Bio-Oligo 100 nucleic acid synthesizer of Hanbang Technology were the same as those of Example 1. The system completed the synthesis of the sequence after running 20 macrocycles, and the purity of the crude synthetic product was calculated to be 78% after the processing was completed.

[0075] Example 3

[0076] Take 1.716 g, 1.544 g, 1.680 g, and 1.490 g of DMT-modified phosphoramidite monomers A, C, G, and T, respectively, add 20 mL of anhydrous acetonitrile to make the concentration of the monomer solution 0.1 mol / L, stir well, add molecular sieves (Colema 3A spherical), and obtain 20 mL of each of the four phosphoramidite monomer solutions for coupling cycles.

[0077] Take 0.28g of Nankai Hecheng Resins with Unylinker Pre-loaded (loading capacity of 350umol / g) and load it into a 6.3mL synthesis column. Connect the upper and lower ends of the synthesis column to port 1 of the V6 and V7 valves as column position 1. Connect the remaining reaction reagents to the corresponding pump inlet valve ports. Set the UV detector wavelengths to 350nm and 260nm respectively. The Hanbang Technology Bio-Oligo100 nucleic acid synthesizer operates according to the procedures of deprotection, coupling cycle, oxidation / sulfurization and capping. After each reaction cycle, the valve port is switched back to the initial state for the next reaction cycle until all sequence synthesis is completed.

[0078] The reagents used in each stage and the injection method are the same as those in Example 1.

[0079] The operating procedures and operating parameters of the Bio-Oligo 100 nucleic acid synthesizer of Hanbang Technology were the same as those of Example 1. The system completed the synthesis of the sequence after running 20 macrocycles, and the purity of the crude synthetic product was calculated to be 79% after the processing was completed.

[0080] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A method for synthesizing oligonucleotides suitable for high-load resin carriers, characterized in that: The following steps are involved: The reagents used for synthesizing oligonucleotides are connected to a nucleic acid synthesizer for synthesis to obtain the oligonucleotides; the solid phase carrier used in the nucleic acid synthesizer is a high-load resin; the loading capacity of the high-load resin is ≥200 μmol / g; The nucleic acid synthesizer is provided with a first inlet valve, a second inlet valve, a third inlet valve, a fourth inlet valve, a circulation valve, a first column position valve, a second column position valve, a waste valve and a synthesis column; the first inlet valve and the second inlet valve are respectively connected to the third inlet valve through an infusion pipeline; the third inlet valve is connected to the first column position valve through an infusion pipeline; the two ends of the synthesis column are respectively connected to the first column position valve and the second column position valve by an infusion pipeline; the fourth inlet valve is connected to the circulation valve through an infusion pipeline, and the circulation valve is provided with a circulation mode and an open mode. In the circulation mode, the second column position valve, the circulation valve and the first column position valve are connected. In the open mode, the second column position valve, the circulation valve and the waste valve are connected, and the circulation valve is also connected to the first column position valve; the synthesis column is filled with a solid phase carrier; The synthesis comprises several reaction cycles; each reaction cycle comprises a deprotection stage, a coupling cycle stage, an oxidation / sulfurization stage and a capping stage performed in sequence; During the deprotection stage, the circulation valve is set to an open mode, and the deprotection reagent is injected through the third inlet valve; In the coupling cycle stage, the phosphoramidite monomer solution is injected through the first inlet valve, the second inlet valve and the third inlet valve, and the activator is injected through the fourth inlet valve, and then the circulation valve is set to the circulation mode for coupling circulation; In the oxidation / sulfurization stage, the circulation valve is set to an open mode, and an oxidizing agent or a sulfiding agent is injected through the fourth inlet valve; During the capping stage, the circulation valve is set to an open mode, and the capping reagent is injected through the third inlet valve and the fourth inlet valve.

2. The synthesis method according to claim 1, characterized in that The nucleic acid synthesizer is the Bio-Oligo 100 nucleic acid synthesizer produced by Hanbang Technology.

3. The synthesis method according to claim 1, characterized in that The deprotection reagent is trichloroacetic acid; the injection flow rate of the deprotection reagent is 6.3-20 mL / min; in each reaction cycle, the deprotection stage lasts for 3-10 min.

4. The synthesis method according to claim 1, characterized in that The concentration of the phosphoramidite monomer solution is 0.1 mol / L; the injection flow rate of the phosphoramidite monomer solution is 1.6-2.0 mL / min; the activator is a 5-ethylthiotetrazolyl solution, and the concentration of the 5-ethylthiotetrazolyl solution is 0.25-0.30 mol / L; the injection flow rate of the activator is 2.4-3.0 mL / min; the circulation flow rate of the material in the coupling circulation stage is 10-30 mL / min; in each reaction cycle, the time of the coupling circulation stage is 3-10 minutes.

5. The synthesis method according to claim 1, characterized in that The oxidizing agent is a mixture of iodine, water and pyridine, the concentration of iodine in the mixture is 0.05-0.1 mol / L, and the volume ratio of water to pyridine is 1:9; the sulfiding agent includes bisphenylacetyl disulfide and a mixture of 3-methylpyridine / acetonitrile; The injection flow rate of the oxidizing agent or the sulfiding agent is independently 6.3 to 12 mL / min; In each reaction cycle, the oxidation / sulfurization stage lasts for 1 to 4 minutes.

6. The synthesis method according to claim 1, characterized in that The capping reagent includes a capping A reagent and a capping B reagent; the capping A reagent is a 1-methylimidazole-acetonitrile mixed reagent, and the volume ratio of 1-methylimidazole to acetonitrile in the 1-methylimidazole-acetonitrile mixed reagent is 1:5; the capping B reagent is an isobutyric anhydride-pyridine-acetonitrile mixed reagent, and the volume ratio of isobutyric anhydride, pyridine and acetonitrile in the isobutyric anhydride-pyridine-acetonitrile mixed reagent is 2:3:5; the capping A reagent is injected from the third inlet valve, and the capping B reagent is injected from the fourth inlet valve.

7. The synthesis method according to claim 6, characterized in that The injection flow rates of the capping reagent A and the capping reagent B are independently 6.3-12 mL / min; in each reaction cycle, the time of the capping stage is 1-3 min.

8. The synthesis method according to claim 1 or 2, characterized in that: The operating temperature of the nucleic acid synthesizer is 10 to 30° C., and the system pressure is -0.1 to 20 bar.

9. The synthesis method according to claim 1, characterized in that The volume of the synthesis column was 6.3 mL.

10. The synthesis method according to claim 1, characterized in that The high-load resin is a cross-linked polystyrene resin or a polyamide polyethylene-ethylene glycol resin.

Images