Monoclonal antibody for resisting babesia dunnii ALD protein and application of monoclonal antibody

Abstract

The invention discloses a monoclonal antibody for resisting Babesia dunnii ALD protein, the monoclonal antibody is secreted by a hybridoma cell strain 2A9, the hybridoma cell strain 2A9 is preserved in the China Center for Type Culture Collection, the preservation number is CCTCC NO: C2024203, the amino acid sequence of the ALD protein is as shown in SEQ ID NO: 2, and the nucleotide sequence of a coding gene is as shown in SEQ ID NO: 1. The invention further discloses an indirect immunofluorescence method which is established by utilizing the monoclonal antibody and is used for detecting the Chang Babesia dunnii, a powerful means and a tool are provided for clinical prevention and control of the Chang Babesia dunnii which is an important zoonozoic parasite, and the indirect immunofluorescence method is of great significance to prevention of disease occurrence.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to a monoclonal antibody against Babesia duncanii and application thereof. Background Art

[0002] Babesia duncani is a blood protozoan that is an obligate parasite in red blood cells. It belongs to the Protista kingdom, the Apicomplexa phylum, the Sporozoa class, the Piroplasma order, the Babesco genus, and is one of the most important pathogens that cause babesiosis in humans and rodents. It is mainly transmitted through the bites of hard ticks, and can also be infected and transmitted through blood transfusions and other routes. The clinical manifestations of the host generally range from asymptomatic to severe. After infection, symptoms such as high fever, headache, chills, hemolytic anemia, jaundice, and hemoglobinuria will appear. In severe cases, it can lead to organ failure and even death in patients who are elderly, immunocompromised, and have undergone splenectomy. The disease is widespread worldwide, seriously affecting the health of humans and animals worldwide.

[0003] Once humans and animals are infected with Babesia Duncanii, they will be immune to the parasite for life. So far, there is no effective vaccine or drug to prevent and treat the disease. Therefore, early diagnosis and treatment are important methods to control the disease. At present, there are no commercial kits available for the detection of Babesia Duncanii, and it mainly relies on laboratory testing. At this stage, the commonly used laboratory diagnostic methods mainly include blood smear staining microscopy, real-time fluorescence quantitative PCR, conventional PCR and cloning sequencing.

[0004] The blood smear staining microscopy method is easy to operate and has low requirements for instruments and equipment, but it requires the tester to have rich experience and be able to distinguish the subtle morphological differences between Babesia and other protozoa. The diagnostic results are highly subjective, with a low detection rate and easy to misdetect and miss. The real-time fluorescence quantitative PCR, conventional PCR and cloning sequencing methods have high sensitivity and accuracy, but they require expensive instruments and equipment, high requirements for the technical and experimental skills of the testers, and a good molecular biology and bioinformatics foundation, resulting in their application remaining at the level of laboratory diagnosis. Therefore, there is an urgent need for a detection method that can detect Duncan Babesia antigens in clinical practice. Obtaining specific and high-affinity monoclonal antibodies is the premise and basis for establishing Duncan Babesia detection. In addition, monoclonal antibodies can also have a wide range of uses in pathogenic mechanism research, vaccine development, etc.

[0005] At present, there is no report on monoclonal antibody against Babesia duncanensis at home and abroad. The research group of the State Key Laboratory of Agricultural Microbiology where the applicant is located selected the aldolase (ALD) gene of Babesia duncanensis. Bioinformatics analysis shows that the gene has good antigenicity and a high expression level, and has a certain application basis. Based on this guiding ideology, the present invention cloned and expressed Babesia duncanensis aldolase (BdALD), immunized mice with recombinant rBdALD, obtained hybridoma cells, and screened to obtain a monoclonal antibody with high affinity. The antibody was verified by immunoblotting and immunofluorescence experiments to have good specificity, high sensitivity, and excellent detection ability of Babesia duncanensis. Summary of the invention

[0006] The purpose of the present invention is to provide a monoclonal antibody against the ALD protein of Babesia duncanii and its application in diagnosing Babesia duncanii disease. The monoclonal antibody can specifically recognize the aldolase in the sugar metabolism pathway of Babesia duncanii and can specifically and sensitively identify Babesia duncanii.

[0007] The technical scheme of the present invention is as follows:

[0008] First, the ALD gene of Babesia duncanense was cloned using the cDNA of the WT strain of Babesia duncanense (frozen in liquid nitrogen in our laboratory) as a template, and the gene was expressed in Escherichia coli, and the recombinant protein rBdALD was extracted and purified. Then, mice were immunized with rBdALD protein, and the spleen lymphocytes of the immune mice were fused with mouse myeloma cells to screen out hybridoma cell lines that can secrete monoclonal antibodies. Then, rBdALD and Babesia duncanense were used for screening to obtain hybridoma cell lines that can stably secrete high-affinity monoclonal antibodies. Finally, monoclonal antibodies were prepared in large quantities from hybridoma cells using the mouse in vivo ascites induction method, and the detection effect of monoclonal antibodies on Babesia duncanense was verified using indirect immunofluorescence, and finally a monoclonal antibody that can specifically and sensitively identify Babesia duncanense was obtained.

[0009] The applicant named the cell line that stably secretes the monoclonal antibody as hybridoma cell line 2A9, and deposited it in the China Type Culture Collection of Wuhan University, Wuhan City, Hubei Province on August 26, 2024, with the deposit number CCTCC NO: C2024203.

[0010] SEQ ID NO: 1 is the nucleotide sequence of the ALD gene of Babesia duncanii, with a total length of 1071 bp.

[0011] SEQ ID NO: 2 is the amino acid sequence encoded by the ALD gene of Babesia duncanii, encoding a total of 356 amino acids.

[0012] The monoclonal antibody secreted by the hybridoma cell line 2A9 can be used to prepare a diagnostic kit for Duncan's Babesia infection.

[0013] The present invention further provides a diagnostic kit for Duncan's Babesia infection, which contains the monoclonal antibody secreted by the hybridoma cell line 2A9.

[0014] Furthermore, the kit is an indirect immunofluorescence kit for diagnosing Duncan's Babesia, and the kit also contains a blood smear, a washing solution, a blocking solution, a fluorescent secondary antibody, and a nuclear staining solution.

[0015] The present invention also provides an indirect immunofluorescence method for detecting Babesia duncanii, comprising the following steps:

[0016] 1) preparing blood smears infected with insects;

[0017] 2) Fix and permeabilize blood smears;

[0018] 3) Closed blood smear;

[0019] 4) adding the monoclonal antibody to react;

[0020] 5) Add fluorescent secondary antibody for reaction;

[0021] 6) Observe the cell nuclei using a fluorescence microscope after staining.

[0022] The indirect immunofluorescence method established by the invention can be used for clinical diagnosis of Duncan Babesia infection, and can also be used for laboratory screening and identification of Duncan Babesia for the purpose of non-disease diagnosis.

[0023] The beneficial effects of the present invention are:

[0024] The present invention is the first to prepare a monoclonal antibody using the ALD protein of Babesia duncanii as an immunogen. The ALD protein has strong immunogenicity and high expression level, and is suitable for use as a molecular marker in the diagnosis of Babesia duncanii disease. The present invention screened and finally obtained the monoclonal antibody 2A9, which has high affinity and specificity for the ALD protein. The established indirect immunofluorescence method has the advantages of simple operation, short detection cycle, and low cost. The present invention provides a powerful means and tool for the clinical prevention and control of Babesia duncanii, an important zoonosis parasite, and is of great significance for avoiding the occurrence of the disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 : is the pET-28a-BdALD recombinant plasmid map constructed by the present invention.

[0026] Figure 2:Identification of recombinant rBdALD by Western blot. 1: rBdALD reacts with mouse positive serum; 2: rBdALD reacts with mouse negative serum.

[0027] Figure 3 : SDS-PAGE photos of five monoclonal antibodies after purification. Lane: M. Reference protein; the band indicated by the arrow above is the monoclonal antibody heavy chain band, and the band indicated by the arrow below is the monoclonal antibody light chain band.

[0028] Figure 4 :The specificity of five monoclonal antibodies was identified by Western blot. Lane: M. reference protein; 2A9: whole worm antigen of Babesia dunkanensis reacts with 2A9 monoclonal antibody; 5F12: whole worm antigen of Babesia dunkanensis reacts with 5F12 monoclonal antibody; 5D3: whole worm antigen of Babesia dunkanensis reacts with 5D3 monoclonal antibody; 5H3: whole worm antigen of Babesia dunkanensis reacts with 5H3 monoclonal antibody; 5F1: whole worm antigen of Babesia dunkanensis reacts with 5F1 monoclonal antibody.

[0029] Figure 5 :Analysis of the luminescence rate of insects after incubation with five monoclonal antibodies. Monoclonal antibody: five monoclonal antibodies obtained in this study; Hoechst: nuclear dye (blue); Merge: merging of two layers.

[0030] Figure 6 : Detection of the specificity of monoclonal antibodies using indirect immunofluorescence. DETAILED DESCRIPTION

[0031] The technical scheme of the present invention is further described in detail below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not used to limit the scope of protection of the present invention. Various modifications or equivalent substitutions made by those skilled in the art on the basis of the following examples should also be regarded as falling within the scope of protection of the present invention. The experimental methods for which specific conditions are not indicated in the following examples are usually implemented according to conventional conditions or reference books such as "Molecular Cloning Laboratory Guide" (New York: Cold Spring Harbor Laboratory, 1989), or implemented according to the methods recommended in the operating manual provided by the manufacturer. The materials whose sources are not indicated in the examples are all commonly used materials well known in the art.

[0032] Example 1: Preparation of Babesia duncanii rBdALD recombinant protein

[0033] 1.1 Cloning and expression of the ALD gene of Babesia duncanii

[0034] The corresponding gene was cloned using PCR primers, and the cDNA of the WT strain of Babesia duncanii was used as a template to amplify the target fragment using cloning primers (BdALD-F1 / BdALD-R1). After sequencing to confirm that the sequence was correct, the ALD target fragment and the pET-28a prokaryotic expression vector were double-digested and connected after enzyme digestion and identified using primers (BdALD-F2 / BdALD-R1) for prokaryotic expression.

[0035] The specific primer sequences are as follows (the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. (Wuhan Branch):

[0036] BdALD-F1 / BdALD-R1

[0037] Upstream primer: BdALD-F1:GCGC GGATCC ATGGTTGTTTTGTCTCAAGA (the underlined part is the BamH1 restriction site)

[0038] Downstream primer: BdALD-R1:GCTA CTCGAG GTAAATGTACTTGGCCTCGA (the underlined part is the XholI restriction site)

[0039] BdALD-F2 / BdALD-R1

[0040] Upstream primer: BdALD-F2:TAATACGACTCACTATAGGG

[0041] Downstream primer: BdALD-R1: GCTACTCGAGGTAAATGTACTTGGCCTCGA

[0042] The PCR reaction system for cloning the BdALD gene is as follows:

[0043]

[0044] PCR reaction conditions: 95°C for 3 min; 95°C for 15 sec, 52°C for 15 sec, 72°C for 1 min; 72°C for 5 min; 35 cycles.

[0045] The PCR product amplified with the BdALD-F1 / BdALD-R1 primers was recovered and digested with BamH1 and XholI. At the same time, the pET-28a plasmid (Merck Serono Co., Ltd., i.e. Merck) was also double-digested with BamH1 and XholI. The digested BdALD gene and the pET-28a plasmid were connected with Ligation Mix to obtain a recombinant plasmid (pET-28a-BdALD). The plasmid map is shown in Figure 1 .

[0046] After transforming DH5α E. coli with the recombinant plasmid, place it in a 37℃ shaker (180r / min) for 12 hours. After the extracted plasmid is identified and sequenced correctly by T7, transform it into BL21 E. coli and transfer it into 6mL of fresh liquid culture medium containing Kan resistance at a ratio of 1:100. Place it in a 37℃ shaker and shake it overnight at 180r / min; after T7 identification and sequencing are correct, transform BL21 E. coli, and culture the E. coli in LB liquid culture medium to OD=0.6, take 1mL of bacterial solution as a pre-induction control, and at the same time add IPTG inducer at a ratio of 1:1000 to induce the expression of the target protein, and induce expression at 37℃ shaker for 3-4 hours. Take 1mL of bacterial solution for treatment. The sample was processed by centrifuging at 8000r / min for 2min, discarding the supernatant, and then adding 30μL of phosphate buffer (PBS, formula: KCl 0.2g, NaCl 8g, Na2HPO4 1.44g, KH2PO40.24g, 1000mL distilled water, pH=7.6) and 30μL of loading buffer (1MTris-HCl (pH=6.8) 1mL, 200mM DDT 0.31g, 4% SDS 0.4g, 0.2% bromophenol blue 0.02g, 20% glycerol 2mL, 7mL ultrapure water) to resuspend. Boil in 100℃ boiling water for 10min. Use SDS-PAGE gel electrophoresis to identify whether it is expressed.

[0047] 1.2 Purification of rBdALD protein

[0048] After the recombinant BL21 E. coli was induced to express according to the above method, the bacterial solution was centrifuged at 8000r / min for 10min, the supernatant was discarded, and it was washed once with 500mL PBS and centrifuged at 8000r / min for 10min, and then washed again with 500mL PBS. After discarding the supernatant, 30mL PBS was added to resuspend and crushed using a hydraulic crusher. After crushing, centrifuge at 12000r / min for 30min, take 40μL of supernatant, add 50μL 2x loading buffer and 10μL DTT, vortex mix, and boil in boiling water for 10min as the supernatant group. Take a little precipitate, add 30μL PBS and 40μL loading buffer and boil for 10min as the precipitate group. After SDS-PAGE gel electrophoresis, it was determined that most of the rBdALD was expressed in the supernatant.

[0049] Specifically, the purification steps are as follows:

[0050] (1) Add 4 mL of Ni-NTA metal chelated His protein purification medium filler to the affinity chromatography column;

[0051] (2) Add 12 mL of ddH2O to the affinity chromatography column for washing;

[0052] (3) Add 12 mL of His-binding buffer (NaCl 17.532 g, Tris-base 1.21 g, NaH2PO4·2H2O 7.8 g, dH2O to 1 L, adjust pH to 8.0) to equilibrate the column;

[0053] (4) Add the protein expression supernatant filtered through a 0.45 μm pore size filter and collect the first few drops of filtered liquid, numbered 1;

[0054] (5) Add 50 mL of His-binding buffer to wash the column and collect the first few drops of liquid, numbered 2;

[0055] (6) Add 10 mL of different concentrations of imidazole (5%-100% imidazole gradient elution) (100% imidazole solution: 2.72 g imidazole dissolved in 100 mL His-Binding Buffer) to elute the target protein, collect the first few drops, and number them 3;

[0056] (7) Add 50 μL of SDS to each tube numbered 1 to 3 and boil for 10 min;

[0057] (8) Prepare SDS-PAGE polyacrylamide gel, add 10 μL / well of the treated sample, and perform electrophoresis (DC voltage of the concentrated gel is 80 volts, and DC voltage of the separation gel is 120 volts). After the electrophoresis is completed, remove the gel and stain it with Coomassie Brilliant Blue overnight. Then decolorize it to confirm that the purified target protein is obtained.

[0058] 1.3 Identification of the reactogenicity of the recombinant protein rBdALD

[0059] The purified recombinant protein rBdALD was first subjected to SDS-PAGE electrophoresis, and then transferred to the NC membrane at 110V. After 2 hours, the NC membrane was blocked with TBST-5% skim milk powder for 2 hours, and washed 3 times with TBST, each time for 5 minutes; the NC membrane was placed in 1:100 diluted Duncan Babesia positive serum and negative serum, respectively, incubated at room temperature for 1 hour, washed 3 times with TBST, each time for 5 minutes; the secondary antibody (1:5000 diluted goat anti-mouse IgG) was added, incubated at room temperature for 1 hour, washed 3 times with TBST, each time for 5 minutes, and then ECL was added for color development. Western blot results showed that the purified rBdALD had a specific reaction with positive serum at 40kDa, but had no reaction with negative serum (see Figure 2 ).

[0060] Example 2: Preparation of monoclonal antibodies

[0061] 1.1 Immunization of mice

[0062] BALB / C mice were immunized with the Babesia duncanii rBdALD antigen prepared above, and the immunization procedure was as follows:

[0063] (1) On day 0, blood was collected and serum was collected as negative serum for primary immunization. 80 μg / mouse of Babesia duncanii rBdALD antigen was added with Freund's complete adjuvant and injected subcutaneously at multiple points on the back of the neck, 0.2 mL / mouse.

[0064] (2) On day 14, the first booster immunization was performed with 80 μg / mouse of rBdALD antigen of Babesia duncanii plus Freund's incomplete adjuvant, injected subcutaneously at multiple points on the back of the neck, 0.2 mL / mouse.

[0065] (3) On day 28, the second booster immunization was performed with 80 μg / mouse of rBdALD antigen of Babesia duncanii plus Freund's incomplete adjuvant, injected subcutaneously at multiple points on the back of the neck, 0.2 mL / mouse.

[0066] (4) On day 42, the third booster immunization was performed with 80 μg / mouse of rBdALD antigen of Babesia duncanii plus Freund's incomplete adjuvant, injected subcutaneously at multiple points on the back of the neck, 0.2 mL / mouse.

[0067] (5) After 50 days, the serum was collected for titer measurement using an indirect ELISA method, i.e., the plate was coated with the rBdALD antigen of Babesia duncanii, and the mouse serum dilution was added and incubated at 37°C. After washing, the plate was added with HRP-labeled goat anti-mouse secondary antibody (purchased from Southern Biotech) and incubated at 37°C. After washing, TMB substrate was added for color development, and the plate with the highest titer was selected for continued boosting immunization for fusion.

[0068] (6) Day 54: Pre-fusion shock immunization with 50 μg / mouse rBdALD antigen of Babesia duncanii, injected directly intraperitoneally, 0.2 mL / mouse.

[0069] (7) Day 57, spleen cells were harvested and prepared for fusion.

[0070] 1.2 Preparation of hybridoma cells: PEG-mediated fusion method

[0071] Preparation of SP2 / 0 tumor cells:

[0072] (1) The frozen SP2 / 0 tumor cells were centrifuged at 1000 r / min to remove the freezing solution, and then revived with 1640 basal medium (containing 20% ​​fetal bovine serum, 1% double antibody storage solution, final concentration: streptomycin 100 μg / mL, penicillin 100 μg / mL), added to a T25 cell culture flask, and cultured at 37°C with 5% CO2 and saturated humidity.

[0073] Preparation of feeder cells:

[0074] (1) Take a 6-8 week old non-immunized BALB / C mouse, remove the eyeball and bleed it, then kill the mouse, soak it in 75% alcohol solution for 5 minutes, and the collected serum is the negative serum.

[0075] (2) Fix the mouse's limbs and cut the skin with ophthalmic scissors and ophthalmic forceps; use another set of ophthalmic scissors and ophthalmic forceps to cut a small hole in the peritoneum, add 3 mL of basal culture medium, blow and beat a few times, aspirate and place into a sterile 50 mL conical bottom centrifuge tube, which are the peritoneal macrophages.

[0076] (3) Fix the mouse's limbs, cut the peritoneum with ophthalmic scissors and forceps, remove the spleen and place it in a dish filled with incomplete culture medium, gently wash it, and peel off the surrounding connective tissue.

[0077] (4) Move the spleen to another dish containing incomplete culture medium, make a hole in the spleen with a syringe, and gently blow the culture medium with a syringe until only a layer of skin is left in the spleen. Resuspend the cells in HAT culture medium and count them until the cell density reaches 1×10 5 100 μL of cell suspension was added to a 96-well cell culture plate for culture.

[0078] (5) Transfer the spleen cell suspension in the plate to a centrifuge tube. Filter the cell suspension using a 100-200 mesh cell sieve, centrifuge at 1000 rpm for 10 min, and discard the supernatant.

[0079] (6) Resuspend the precipitate with the previously prepared HAT complete medium (20% fetal bovine serum + 1% double antibody (streptomycin and penicillin) + 1 / 50 volume of HAT (50×) + 1640 basal medium) (i.e., feeder cell culture medium) and add 10 5 / hole use.

[0080] Preparation of splenocytes from immunized mice:

[0081] The mice that had been boosted with immunization were killed by cervical dislocation, and the spleens were taken out to prepare spleen cells. The operation was the same as that of preparing spleen cells in feeder cells. Finally, the spleen cells were resuspended in 1640 basal medium for later use.

[0082] Cell fusion:

[0083] (1) Resuspend SP2 / 0 cells and immune mouse spleen cells in incomplete medium 1640, count them using a cell counting plate, add immune mouse spleen cells and myeloma cells SP2 / 0 in a ratio of 5:1-10:1 to a 50 mL centrifuge tube, and centrifuge at 1000 rpm for 10 min. At this time, prepare warm water at about 37°C.

[0084] (2) After centrifugation, discard the supernatant and the liquid on the tube wall (which can be dried with sterile paper), gently tap the precipitate from the mixed centrifugation of SP2 / 0 and immunized mice to loosen it, and immerse the bottom of the centrifuge tube in 37°C warm water.

[0085] (3) Take out 1 ml of the incubated fusion agent PEG 1450 from the incubator and evenly drop it into the mixed cell pellet within 60 seconds (stirring gently while adding).

[0086] (4) After adding, continue to stir gently for 30 seconds and let stand for 1 minute. Then slowly add 10 mL of RPMI-1640 basal medium preheated at 37°C. Add 1 mL dropwise in the first minute, 1 mL in the second minute, 3 mL in the third to fourth minutes, and 5 mL in the fifth minute. Stir gently each time you add. Finally, slowly add 30 mL of RPMI1640 basal medium.

[0087] (5) After gently inverting to mix, centrifuge at 1000 rpm for 5 min, discard the supernatant, and resuspend the pellet with feeder cell solution.

[0088] (6) Use a spray gun to evenly spread the resuspended liquid into a 96-well cell culture plate, 100 μl / well, and place the plate in a 5% CO2, 37°C incubator for culture.

[0089] On the second day, observe for contamination. On the fourth day, add one drop of HAT medium. On the 8th to 10th day, remove 100 μL of medium from each well and replace with 100 μL of HT medium.

[0090] 1.3 Screening of hybridoma cells

[0091] The antibody detection was performed by indirect ELISA method. The recombinant protein rBdALD was coated, 500 ng per well, incubated at 4°C overnight, and washed 3 times with PBST (phosphate buffered saline containing 0.5% Tween-20, i.e. PBS) after being taken out the next day, and blocked with 5% BSA in a 37°C incubator for 1 hour after being patted dry, and washed 3 times with PBST after being taken out. 100 μL of hybridoma cell supernatant was added, and SP2 / 0 cell supernatant was used as a control group. The cells were incubated at 37°C for 60 min, washed 3 times with PBST, and 1:5000 diluted goat anti-mouse IgG-HRP was added. The cells were incubated at 37°C for 60 min, washed 5 times with PBST, and 100 μL / well of colorimetric solution (Biosharp) (substrate buffer: TMB stock solution = 19:1, and 30% H2O2 0.2 μL / ml) was added. The cells were colorimetrically protected from light for 10 min. 50 μL of stop solution (0.25% HF) was added to each well to terminate the reaction, and the OD value was measured at a wavelength of 630 nm using an enzyme reader.

[0092] Cloning of hybridoma cells:

[0093] (1) Prepare mouse feeder cells and plate them into 96-well plates.

[0094] (2) Gently blow off the hybridoma cells to be cloned with a 200 μL pipette tip and count them.

[0095] (3) The cells were diluted to three concentrations with HT complete medium (20% fetal bovine serum + 1% double antibody (streptomycin and penicillin) + 1 / 50 volume of HT (50×) + 1640 basal medium), i.e., 50, 10, and 5 cells per milliliter of medium. The three concentrations of cell suspension were added to a 96-well cell culture plate at 100 μl / well, so that each well contained 5, 1, and 0.5 cells, respectively.

[0096] (4) On the 4th day, the cell suspension was replaced and the cell growth in each well was observed and recorded.

[0097] (5) On days 7-10, when the cells have grown to 1 / 5-1 / 3 of the visual field, test the antibody titer of the hybridoma cells and select wells with high antibody titer, good colony morphology, and single colony growth to continue monocloning.

[0098] (6) After three subclonings, the positive hybridoma cells are transferred to a 24-well cell culture plate for culture, and HT medium is added to the original wells. When the cells in the 24-well plate grow well, the hybridoma cells are frozen.

[0099] Cryopreservation and thawing of hybridoma cells:

[0100] (1) Cryopreservation of hybridoma cells

[0101] It is very important to freeze the hybridoma cells in the original well and the subclone cells obtained from each cloning in time. The freezing method of hybridoma cells is the same as that of other cell lines. In principle, the number of cells in each cryopreservation tube should be 1×10 6 More than one, but the number of hybridoma cells in the original well can be different due to different culture environments. Cell freezing solution formula (volume ratio): 90% fetal bovine serum, 10% DMSO (dimethyl sulfoxide). It is best to pre-cool the freezing solution, and be sure to move gently and quickly during operation. When freezing, it can be immediately reduced from room temperature to 0℃ and placed in a -70℃ ultra-low temperature refrigerator, and transferred to liquid nitrogen the next day. It can also be frozen using a cell freezing device. Frozen cells should be revived regularly to check the activity of the cells and the stability of the secreted antibodies. Cells can be stored in liquid nitrogen for several years or longer.

[0102] (2) Cell recovery method

[0103] Carefully remove the cryopreserved tube from liquid nitrogen and place it in a 37°C water bath to thaw the frozen cells within 1 minute. Wash the cells twice with 1640 basal medium and culture them in an incubator at 37°C and 5% (v / v) CO2. When the cells form colonies, detect the antibody activity.

[0104] Expansion preparation of monoclonal antibodies (in vivo ascites induction method):

[0105] Preparation of ascites: BALB / C mice were first intraperitoneally injected with 0.5 mL of Freund's incomplete adjuvant, and 7 days later, 1×10 6 Hybridoma cells can produce ascites 10 days after inoculation. Closely observe the health status and ascites signs of the animals. When the ascites is as much as possible and before the mice die, kill the mice and use a syringe to suck the ascites into a test tube. Generally, 5 to 10 mL of ascites can be obtained from one mouse, which can be collected repeatedly several times. The content of monoclonal antibodies in the ascites can reach 5 to 10 mg / mL. This is the most commonly used method at present. Cells in the ascites can also be frozen and stored. After recovery, they can be transferred to the abdominal cavity of mice to produce ascites quickly and in large quantities.

[0106] 1.4 Purification and identification of monoclonal antibodies

[0107] 1.4.1 Monoclonal Antibody (MAB) Purification

[0108] (1) Take an appropriate amount of Protein G suspension and load it into the chromatography column. Wash the equilibrated column with 10 column volumes of equilibration / washing buffer (0.15 M NaCl, 20 mM Na2HPO4, pH 7.0).

[0109] (2) After high-speed centrifugation of the antibody-containing ascites, mix the supernatant with the equilibration / washing buffer, adjust the pH and ion concentration, and slowly add it to the chromatography column.

[0110] (3) Wash with 10-15 column volumes of equilibration / wash buffer to remove non-specifically adsorbed impurities until no protein is detected in the effluent.

[0111] (4) Use 5-10 column volumes of elution buffer (0.1 M glycine, pH 3.0), clamp the outflow tube, let it stand for 5 minutes, then collect the effluent, and repeat three times.

[0112] (5) After elution, the antibody was neutralized by adding 2 / 5 volume of neutralizing solution (1 M Tris-HCl, pH 8.5).

[0113] (6) The antibody was concentrated to the required volume using a 10K ultrafiltration tube, the concentration was measured, and stored at -20°C.

[0114] (7) The concentration of the purified monoclonal antibody was measured using a BCA protein test kit (purchased from Bio-Tech). The monoclonal antibody was identified by SDS-PAGE. The results are shown in Figure 3 .

[0115] 1.4.2 Identification of monoclonal antibody specificity using Western blot

[0116] The whole protein of Babesia duncanii and purified rBdALD were subjected to SDS-PAGE electrophoresis and semi-dry transferred to nitrocellulose membrane (110V, 2h), blocked with 5% skim milk at room temperature for 2h, washed with TBST three times, incubated with purified monoclonal antibodies 2A9 (3.6mg / mL), 5F12 (1.5mg / mL), 5D3 (8.5mg / mL), 5H3 (4.7mg / mL), and 5F1 (1.8mg / mL) as primary antibodies at 4°C overnight, washed three times with TBST, incubated with 1:2000 diluted HRP-sheep anti-mouse IgG for 1 hour, washed three times with TBST, washed three times with TBS, and developed with ECL chemiluminescence. The results showed that all five monoclonal antibodies could react with the whole worm antigen of Babesia duncanii, but only 2A9 produced a specific target band, which could recognize the purified rBdALD (40 kDa) and the 40 kDa protein in Babesia duncanii, with good specificity; 5F12, 5D3, 5H3, and 5F1 produced non-target bands, and their affinity with the whole worm antigen of Babesia duncanii was not high ( Figure 4 ).

[0117] Example 3: Identification of Babesia Duncanii using indirect immunofluorescence

[0118] 1 μL of blood stained with Babesia duncanii was used to prepare a blood smear, which was fixed with paraformaldehyde at room temperature for 30 minutes, and then permeabilized with 0.5% TritonX-100 for 5-10 minutes; after washing with PBS for 3 times, the slides were blocked with a PBS solution containing 3% (m / v) bovine serum albumin (BSA, purchased from Sigma) at 37°C for 30 minutes; after washing with PBS for three times, 2A9, 5F12, 5D3, 5H3, and 5F1 monoclonal antibodies diluted with a PBS solution containing 3% (m / v) BSA were added, and the slides were incubated overnight at 4°C; after washing with PBS for three times, 488-labeled goat anti-mouse IgG fluorescent secondary antibody diluted with a PBS solution containing 3% (m / v) BSA was added, and the slides were incubated at 37°C for 1 hour; after washing with PBS for three times, the cell nuclei were stained with Hoechst, and the staining was performed at room temperature for 10 minutes; after washing with PBS for three times, the slides were sealed with an anti-fluorescence quencher, and the experimental results were observed under an upright fluorescence microscope. The nucleus of Babesia Duncaniensis appears blue (Hoechst), and the ALD of Babesia Duncaniensis stained with BdALD monoclonal antibody appears green. The blue nucleus of Babesia Duncaniensis in red blood cells and the ALD protein present in the cytoplasm of Babesia Duncaniensis can be seen superimposed (Merge).

[0119] like Figure 5 As shown in the figure, the image observation results under the upright fluorescence microscope were statistically analyzed. The luminescence rate of monoclonal antibody 2A9 can reach 92.9%, which can be used as a molecular marker for identifying the cytoplasm of Babesia Duncanii. Although monoclonal antibodies 5H3, 5D3 and 5F12 can also identify the cytoplasm of Babesia Duncanii, the antibody affinity is not high and the luminescence rate is low. The luminescence rate of monoclonal antibody 5D3 is 35.2%, the luminescence rate of monoclonal antibody 5F12 is 13.3%, and the luminescence rate of monoclonal antibody 5H3 is 22.2%. However, monoclonal antibody 5F1 cannot identify the cytoplasm of Babesia Duncanii. Therefore, 2A9 was finally selected as a molecular marker for identifying the cytoplasm of Babesia Duncanii.

[0120] In addition, 1 μL of blood infected with Babesia duncanii and 1 μL of blood infected with Babesia gibbsii were used to prepare blood smears, and the operation was performed using 2A9 according to the above method, and the experimental results were observed under an upright fluorescence microscope. Figure 6 As shown, the nuclei of Babesia duncanii and Babesia gibsoni appear blue (Hoechst), and the ALD of Babesia duncanii stained with BdALD monoclonal antibody 2A9 appears green (2A9). The blue nuclei of Babesia duncanii in red blood cells and the ALD protein present in the cytoplasm of Babesia duncanii can be seen when the two are superimposed (Merge), while the ALD of Babesia gibsoni stained with BdALD monoclonal antibody 2A9 shows no green fluorescence (2A9).

Claims

1. A monoclonal antibody against Babesia duncani ALD protein, which is secreted by hybridoma cell line 2A9, and the hybridoma cell line 2A9 is deposited in the China Center for Type Culture Collection with a deposit number of CCTCC NO: C2024203. The amino acid sequence of the ALD protein is shown in SEQ ID NO: 2, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO:

1.

2. A hybridoma cell line 2A9, deposited in China Center for Type Culture Collection with the deposit number CCTCC NO: C2024203.

3. A method for preparing the monoclonal antibody according to claim 1, characterized in that: The monoclonal antibody is prepared in large quantities by using the hybridoma cell line 2A9 with the deposit number of CCTCCNO: C2024203 and the mouse in vivo ascites induction method.

4. Use of the monoclonal antibody according to claim 1 in the preparation of a diagnostic kit for Duncan's Babesia.

5. A diagnostic kit for Duncan's Babesia infection, comprising the monoclonal antibody according to claim 1.

6. The diagnostic kit according to claim 5, characterized in that: The kit is an indirect immunofluorescence kit for diagnosing Duncan's Babesiosis. The kit also contains a blood smear, a washing solution, a blocking solution, a fluorescent secondary antibody, and a nuclear staining solution.

7. The diagnostic kit according to claim 6, characterized in that: The fluorescent secondary antibody is goat anti-mouse IgG labeled with 488, and the nuclear staining solution is Hoechst.

8. A method for detecting Babesia duncanii for non-diagnostic purposes, characterized in that The following steps are involved: 1) preparing blood smears infected with insects; 2) Fix and permeabilize blood smears; 3) Closed blood smear; 4) adding the monoclonal antibody according to claim 1 to react; 5) Add fluorescent secondary antibody for reaction; 6) Observe the cell nuclei using a fluorescence microscope after staining.

Images