Kluyveromyces marxianus INM3116 as well as preparation and application thereof

Abstract

The invention provides Kluyveromyces marxianus INM3116 as well as preparation and application thereof, the Kluyveromyces marxianus INM3116 is preserved in the Guangdong Microbial Culture Collection Center on August 21, 2024, the preservation number is GDMCC NO: 65039, and the preservation address is the 5th floor, No. 59 building, No. 100 Courtyard, Xianlie Middle Road, Guangzhou City, Guangdong Province. The method has the advantages that the content of resveratrol in the bread is increased by the Kluyveromyces marxianus strain, so that the nutritional ingredients of the baked product are more comprehensive; the Kluyveromyces marxianus strain has the capability of producing a flavor substance, namely, 2-furancarboxylic acid methyl ester, and has the characteristic that the Kluyveromyces marxianus strain can be used for producing the 2-furancarboxylic acid methyl ester.

Description

Technical Field

[0001] The invention belongs to the technical field of industrial microorganisms and relates to a strain of Kluyveromyces marxii INM3116 and a preparation method and application thereof. Background Art

[0002] Kluyveromyces marxianus is widely found in nature and has been included in the European food additives book as a food safety yeast. The high sugar and low pH characteristics of grape juice provide good conditions for the growth and reproduction of yeast. After long-term natural selection and evolution, a group of superior wild yeast resources that adapt to environmental conditions and grape varieties have gradually formed and attached to the grape skin. During the fermentation process, yeast can produce a variety of aromatic substances, giving the product a unique flavor; it can also produce various enzymes, vitamins and other active ingredients, enriching the nutritional and probiotic properties of the product.

[0003] Resveratrol is also known as 3,4,5-trihydroxysitlbene, with a molecular formula of C 14 H 12 O 3 , with a relative molecular mass of 228.25. Studies have shown that resveratrol, as an antitoxin secreted by plants when infected by microorganisms, can inhibit the proliferation of a variety of pathogenic microorganisms in animals and plants. Resveratrol can inhibit both Gram-positive and Gram-negative bacteria. In addition, resveratrol has significant antioxidant and anti-inflammatory effects, can efficiently remove reactive oxygen species (ROS), reduce the level of inflammatory factors, and reduce animal oxidative stress and immune stress. As a polyphenol compound, resveratrol can directly remove hydroxyl free radicals, superoxides and other oxidants in in vitro experiments. Resveratrol can also regulate animal sugar and lipid metabolism, prevent and treat fatty liver, improve metabolic disorders caused by diabetes, and regulate intermuscular fat content. It can prevent dyslipidemia and hepatic steatosis caused by a high-fat diet, and at the same time reduce obesity-related metabolic complications and relieve inflammatory responses. Resveratrol has attracted widespread attention due to its multiple biological activities.

[0004] 2-Furancarboxylic acid methyl ester, also known as furoic acid methyl ester, is a food flavoring approved for use in my country. It is a colorless liquid. Boiling point 181°C, relative density 1.179 (22°C), refractive index 1.4682, flash point 73°C. It is soluble in alcohol and ether, slightly soluble in water. It turns yellow in light and has a pleasant smell. It is widely used in food flavors, tobacco flavors, cosmetic flavors and other industries.

[0005] At present, the research directions of the application of resveratrol in food are diverse. Patent: A production process of resveratrol and its application in food, beverage and wine - CN1351985, this invention discloses the use of high content of resveratrol in grape skin as raw material to produce grape skin resveratrol, resveratrol juice, resveratrol capsules, resveratrol oral liquid and resveratrol wine. Patent: Application method of resveratrol in food - CN1817180, this invention discloses a method of adding resveratrol to food ingredients after fully dissolving it in a solvent and mixing it evenly or directly adding it to food ingredients and mixing it evenly, the solvent can be edible ethanol or organic solvent, and the solubility is 0-100%. And none of them involve the application of resveratrol in baked flour products. Patent: A method for preparing resveratrol flour and its use - CN104522495A, this invention discloses a method for adding resveratrol to flour, the flour produced can be used for various pasta, such as noodles, bread, steamed buns, biscuits, and can reduce cholesterol, reduce blood sugar fluctuations, and prevent insulin secretion disorders. However, it does not involve the effect of adding resveratrol alone on the taste of flour. Patent: A method for preparing furoic acid methyl ester by oxidative esterification of furfural - CN118108688A, belongs to the field of organic synthesis. It does not involve the application of methyl 2-furancarboxylate in the food field.

[0006] The above patents focus on product functionality, involving the preparation of resveratrol, the development of resveratrol flour raw materials, the application of resveratrol final product nutritional value enhancement, and the preparation system of 2-furancarboxylic acid methyl ester. However, they ignore the fact that flavor strongly affects the acceptability of food, especially in dough fermentation, because lactic acid bacteria participate, sour substances will be produced, and organic acids have a strong impact on the overall flavor structure of the product. Therefore, in the development of products, taking into account both flavor and nutrition will be more in line with the market.

[0007] Studies have shown that resveratrol is a polyphenol antitoxin widely found in natural plants, and has multiple functions such as antibacterial, anti-oxidative stress, anti-aging, and regulating sugar and lipid metabolism. 1) The addition of resveratrol alone will lead to a decrease in the taste of bread, and 2) the extraction of resveratrol involves organic solvents, which consumers are reluctant to use. These directly affect consumers' acceptance of the product. Summary of the invention

[0008] In view of the above problems, the present invention provides a strain of Kluyveromyces marxii INM3116 and its preparation and application. The strain is used to ferment grape juice to produce fermented grape juice and create a low pH environment. The fermented grape juice not only contains rich resveratrol, but also has no adverse effect on gluten formation when added to dough as an ingredient. The prepared bread has excellent sensory evaluation and stable resveratrol content during storage. It does not affect the internal organizational structure of the product, and can achieve a perfect combination of nutrition and sensory properties.

[0009] The purpose of the invention is achieved through the following scheme: a strain of Kluyveromyces marxianus, Kluyveromyces marxianus INM3116, which was deposited in Guangdong Provincial Microbiological Culture Collection Center on August 21, 2024, with the deposit number: GDMCC NO: 65039, and the deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province.

[0010] Furthermore, the colony characteristics of Kluyveromyces marxianus are as follows: after culturing on a PDA plate for 48 hours, colonies with a diameter of 1.0 to 5.0 mm, white color, oval shape, smooth and moist surface, neat edges, and raised areas are formed.

[0011] A method for preparing Kluyveromyces marxii.

[0012] Step 1: Isolation of Kluyveromyces marxianus:

[0013] Kluyveromyces marxianus was isolated and screened from raisin samples. The grape juice was squeezed and cultured in an incubator at 28°C. The fermentation broth was diluted 10 1 -10 7 times, and evenly spread the fermentation broth of different dilution concentrations on the PDA medium, and culture it in an incubator at 28°C for 48 hours, and then select white colonies on the PDA medium for screening;

[0014] Step 2: Screening of Kluyveromyces marxianus:

[0015] The obtained Kluyveromyces marxianus was cultured to the logarithmic growth phase, and the final concentration of the strain was 1×10 7 CFU / mL, and then inoculated into grape juice at a 1% inoculation amount, and placed in a 28°C incubator for 48 hours to obtain the fermentation liquid.

[0016] An application of Kluyveromyces marxii yeast is provided. According to the bread making process, fermentation liquid which has been fermented by Kluyveromyces marxii for 48 hours is added, and the added amount is 10% of the total amount of wheat, so as to improve the content of resveratrol and 2-furancarboxylic acid methyl ester in bread and the taste of bread.

[0017] The invention discloses an application of Kluyveromyces marxii to effectively increase the content of methyl 2-furancarboxylate in grape juice after fermentation.

[0018] Application of Kluyveromyces marxii to improve the resveratrol content of bread after baking.

[0019] Application of Kluyveromyces marxii for preparing bread enriched with resveratrol.

[0020] An application of Kluyveromyces marxii yeast in making toast.

[0021] The invention discloses an application of Kluyveromyces marxii yeast in making meal packs.

[0022] The invention discloses an application of Kluyveromyces marxii yeast in making European bread.

[0023] Advantages of the present invention: 1. The Kluyveromyces marxianus strain of the present invention can increase the resveratrol content of bread, making the nutritional components of baked products more comprehensive.

[0024] 2. The Kluyveromyces marxianus strain of the present invention has the ability to produce the flavor substance 2-furancarboxylic acid methyl ester, which makes the baked product more flavorful during storage.

[0025] 3. The Kluyveromyces marxianus of the present invention has the characteristics of improving the aroma and taste of the product. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 For 10 7 Total ion current of methyl 2-furancarboxylate in bread made with different inoculum concentrations.

[0027] Figure 2 This is a morphological diagram of the culture medium for Kluyveromyces marxianus.

[0028] Figure 3 This is a Gram staining microscopic examination of Kluyveromyces marxianus. DETAILED DESCRIPTION

[0029] The present invention will be further described below in conjunction with specific embodiments:

[0030] Unless otherwise specified, the experimental methods used in the following embodiments are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0031] Example 1, see attached Figure 1-3, a strain of Kluyveromyces marxianus, Kluyveromyces marxianus INM3116, which was deposited in Guangdong Provincial Microbiological Culture Collection Center on August 21, 2024, with the deposit number: GDMCC NO: 65039, and the deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province.

[0032] The colony characteristics of a strain of Kluyveromyces marxianus are as follows: after culturing on a PDA plate for 48 hours, colonies with a diameter of 1.0 to 5.0 mm, white color, oval shape, smooth and moist surface, neat edges and raised areas are formed.

[0033] A method for preparing Kluyveromyces marxii.

[0034] Step 1: Isolation of Kluyveromyces marxianus:

[0035] Kluyveromyces marxianus was isolated and screened from raisin samples. The grape juice was squeezed and cultured in an incubator at 28°C. The fermentation broth was diluted 10 1 -10 7 times, and evenly spread the fermentation broth of different dilution concentrations on the PDA medium, and culture it in an incubator at 28°C for 48 hours, and then select white colonies on the PDA medium for screening;

[0036] Step 2: Screening of Kluyveromyces marxianus:

[0037] The obtained Kluyveromyces marxianus was cultured to the logarithmic growth phase, and the final concentration of the strain was 1×10 7 CFU / mL, and then inoculated into grape juice at a 1% inoculation amount, and placed in a 28°C incubator for 48 hours to obtain the fermentation liquid.

[0038] An application of Kluyveromyces marxii yeast is provided. According to the bread making process, fermentation liquid which has been fermented by Kluyveromyces marxii for 48 hours is added, and the added amount is 10% of the total amount of wheat, so as to improve the content of resveratrol and 2-furancarboxylic acid methyl ester in bread and the taste of bread.

[0039] The invention discloses an application of Kluyveromyces marxii to effectively increase the content of methyl 2-furancarboxylate in grape juice after fermentation.

[0040] Application of Kluyveromyces marxii to improve the resveratrol content of bread after baking.

[0041] A method for preparing Kluyveromyces marxii.

[0042] 1. Processing of raw materials

[0043] Take 10g of raisins, clean the dust on the surface, add them to 100g of grape juice, ferment at 28℃ for 48h, dilute the fermentation liquid by 10 1 -10 7 The bacterial solution was evenly spread on the PDA medium to observe the colony morphology. The colonies with different morphologies were picked out and further separated and purified on PDA, and numbered as PDA1-PDA15.

[0044] 2. Preliminary screening of bacterial strains

[0045] The 15 strains were inoculated into malt juice medium at 1% inoculum and cultured at 28°C for 48h. The final cell density reached 10 7 CFU / mL. Take bacterial solution from each tube, inoculate into grape juice at 1% inoculum, culture at 28℃ for 48h, centrifuge at 8000r / min for 10min, and obtain supernatant as sample for physical and chemical index detection. The results are shown in Table 1.

[0046] Resveratrol Content:

[0047] 1) Take 100 mL of the above supernatant sample, with a solid-liquid ratio of 1:15, and extract twice. Add different concentrations of ethanol, propylene glycol or butanediol as extraction solvents into a round-bottom flask, place it in an electric heating jacket connected to a condenser for hot reflux extraction, and each extraction time is 3 hours. After extraction, the solution is cooled to room temperature and filtered, centrifuged at 3500r / min for 15 minutes, and then filtered to obtain the supernatant, which is the extract.

[0048] 2) Preparation of reference solution: Accurately weigh 0.200 mg of resveratrol reference substance, add liquid mobile phase to a 10 mL brown volumetric flask, shake well to prepare a resveratrol and reference substance stock solution with a mass concentration of 0.02 mg / mL, and store at 4°C for later use.

[0049] 3) Chromatographic conditions: Aglient C18 column (250 mm×4.6 mm, 5 μm), mobile phase: methanol (A)-water (B), gradient elution (0-30 min, 40%→100% A; 30-35 min, 100% A; 35-40 min, 100%→40% A). Detection wavelength: 304 nm, flow rate: 0.8 mL / min, injection volume: 10 μL, column temperature: 25°C.

[0050] 4) Dilute the resveratrol mixed standard reference stock solution into 2, 1, 0.5, 0.25, 0.2, and 0.02 μg / mL injection solutions, and perform injection analysis respectively. Draw a standard curve with the concentration of resveratrol in the injection solution as the abscissa and the peak area value of the characteristic peak as the ordinate, and calculate the concentration of resveratrol.

[0051] 2-Furancarboxylic acid methyl ester content:

[0052] The extraction method used was a 50 / 30um, DVB / CAR / PDMS, Stableflex solid phase microextraction head. 5 g of sample was placed in a 30 mL headspace bottle, in a 60 °C water bath, and extracted for 40 min.

[0053] For gas chromatography-mass spectrometry detection, an HP-Innowax (30 m × 250 μm, 0.25 μm) capillary column was selected. The GC conditions were: helium as carrier gas, the carrier gas flow rate was set to 1 mL / min, non-split injection, and the injection port temperature was 250 °C.

[0054] The MS conditions were as follows: ion source temperature 230°C, MS quadrupole temperature 150°C, electron energy 70 eV, mass spectrometry scanning range 45-500, and full scan mode.

[0055] The column oven temperature program was as follows: 50°C for 1 min, then increased to 150°C at 6°C / min, then increased to 240°C at 8°C / min and maintained for 5 min.

[0056] The mass spectrometry database method was used to identify the compounds. Each peak was compared with the NIST Library mass spectrometry database by computer, and the material matching degree greater than 800 was used as the qualitative basis.

[0057] Internal standard quantitative method: accurately add a certain amount of 2-furancarboxylic acid methyl ester standard to the ethanol solution to form 0, 20, 40, 60, 80, 100 μg / 100g standard solutions, and calculate the 2-furancarboxylic acid methyl ester content based on the peak area ratio.

[0058] Table 1 Analysis of resveratrol and 2-furancarboxylic acid methyl ester produced by fermentation

[0059]

[0060]

[0061] Strains PDA4, PDA9 and PDA16 with lower pH and higher contents of resveratrol and 2-furancarboxylic acid methyl ester were selected for rescreening.

[0062] 3. Strain rescreening

[0063] The three yeast strains PDA4, PDA9 and PDA16 selected in the initial screening were reactivated and cultured. When the bacterial concentration reached 10 7 CFU / mL, it was inoculated into grape juice at a 1% inoculation amount, fermented at 28°C for 48h, and the fermented grape juice was added to the medium seed at 10% of the total amount of wheat. Bread was made according to the national standard GB / T14612-2008 and subjected to sensory evaluation and resveratrol content test. The results are shown in Table 2.

[0064] Table 2 Sensory analysis and hardness of fermented bread

[0065] Species name Bread Appearance taste Average sensory score Resveratrol content (mg / 100g) PDA4 4.00 4.50 4.25 0.06±0.03 PDA9 4.50 4.50 4.50 0.05±0.03 PDA16 4.50 5.00 4.75 0.07±0.02

[0066] From the results in Table 2, we can see that the bread made from PDA16 has the highest average sensory score and the highest resveratrol content. As the target strain, the morphology of this strain on the PDA plate medium is observed as follows: Figure 2 As shown, the colony diameter is 1.0 to 5.0 mm, white, oval, with a convex, smooth and moist surface and neat edges. After Gram staining, the results are as follows: Figure 3 shown.

[0067] The PDA16 obtained by the above screening was subjected to 16SrDNA sequencing and identification. After comparative analysis, the 16S region sequence obtained from the strain of the present invention is 100% similar to Kluyveromyces marxianus. It can be determined that the strain is a strain of Kluyveromyces marxianus, which can be used in the food fermentation industry. It is named Kluyveromyces marxianus INM3116, and the strain was deposited in the Guangdong Provincial Microbiological Culture Collection Center on August 21, 2024, with a preservation number of CGMCC No65039. Therefore, in this application, Kluyveromyces marxianus INM3116 and PDA16 refer to the same strain. The PDA16 strain of the present invention has been genetically identified, and its gene sequence is as follows:

[0068] TGCATATCCAAAAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAG

[0069] CGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCG

[0070] ACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCG

[0071] TGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTTGTTTGGGAATGCAG

[0072] CTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAG

[0073] TACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAAATTGTTGA

[0074] AAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTT

[0075] TAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGA

[0076] ATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCAAGGATGCTGGCGTAATGGTTAAATG

[0077] CCGCCCGTCTTGAA

[0078] Example 2 Kluyveromyces marxianus INM3116

[0079] Genetic stability test

[0080] The Kluyveromyces marxianus INM3116 in Example 1 was propagated on malt juice liquid medium for 10 generations, and the first, fifth and tenth generation strains were respectively propagated at a bacterial concentration of 10 7CFU / mL, 1% inoculation amount was inoculated in grape juice, fermented at 28°C for 48h, and the fermented grape juice was added to the medium seed at 10% of the total amount of wheat. Bread was made according to the national standard GB / T14612-2008, and physical and chemical indexes were tested to detect the content of resveratrol and 2-furancarboxylic acid methyl ester. The method was referred to Example 1. At the same time, sensory evaluation was carried out to determine its stability in passage, and the specific data are shown in Table 3.

[0081] Table 3 Results of the stability test for passage

[0082]

[0083] The results in Table 3 show that the fermentation performance of Kluyveromyces marxianus INM3116 strains of different generations is normal, the contents of 2-furancarboxylic acid methyl ester and resveratrol vary within 10%, the strain has good genetic stability and meets the requirements for production and use.

[0084] Example 3 Preparation of Resveratrol-Rich Bread with Kluyveromyces marxianus INM3116

[0085] Kluyveromyces marxianus INM3116 was inoculated at a concentration of 10 4 -10 8 CFU / mL, inoculated into grape juice at 1% inoculation amount, fermented at 28°C for 48h, and added the fermented grape juice into the medium seed at 10% of the total amount of wheat. Made bread according to the national standard GB / T 14612-2008 and tested for physical and chemical indicators, tested resveratrol content, 2-furancarboxylic acid methyl ester content, bread hardness, the method was referenced to Example 1. PDA1 was used as the control strain, and the results are shown in Tables 4 and 5.

[0086] Table 4 Contents of resveratrol and 2-furancarboxylic acid methyl ester in bread

[0087]

[0088] Table 5 Bread sensory evaluation results

[0089]

[0090]

[0091] Note: Each item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0092] From the results in Tables 4 and 5, it can be seen that fermentation with Kluyveromyces marxianus INM3116 can significantly increase the content of 2-furancarboxylic acid methyl ester and resveratrol in bread, and the more the inoculation amount, the higher the content of 2-furancarboxylic acid methyl ester and resveratrol; however, too high or too low inoculation concentration of Kluyveromyces marxianus INM3116 will affect the sourness, sweetness and taste of bread. The most suitable inoculation concentration is 1.0×10 7 CFU / mL, this concentration can produce sufficient resveratrol content and improve the flavor and taste of whole grain bread, such as Figure 1 , which is the total ion current of methyl 2-furancarboxylate in bread made at this inoculation concentration.

[0093] Example 4: Making toast with Kluyveromyces marxianus INM3116

[0094] Kluyveromyces marxianus INM3116 was inoculated at a concentration of 10 7 CFU / mL, inoculated into grape juice at 1% inoculation amount, fermented at 28℃ for 48h, and added the fermented grape juice into the medium seed at 10% of the total amount of wheat. Toast was made according to the national standard GB / T 14612-2008. PDA1 was used as the control group and toast was made in the same way. After fermentation, the method in Example 1 was used to detect the content of methyl 2-furancarboxylate and resveratrol stored for 1, 4, and 7 days, and professional appraisers were invited to conduct sensory evaluation of the toast flavor. The results are recorded in Table 6.

[0095] Table 6 Resveratrol, 2-furancarboxylic acid methyl ester detection and toast sensory evaluation results

[0096]

[0097] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0098] From the results in Table 6, we can see that after 10 7 CFU / mL Kluyveromyces marxianus INM3116 can significantly increase the content of 2-furancarboxylic acid methyl ester and resveratrol in toast; in addition, it can also improve the sensory evaluation of toast, increase the aroma of toast, improve the flavor and taste of toast, and make the toast fragrant, sweet and sour.

[0099] Example 5 Preparation of meal buns with Kluyveromyces marxianus INM3116

[0100] Kluyveromyces marxianus INM3116 was inoculated at a concentration of 10 7 CFU / mL, inoculated in grape juice at 1% inoculation amount, fermented at 28℃ for 48h, and added the fermented grape juice to the medium seed at 10% of the total amount of wheat. Made into meal packs according to the national standard GB / T 14612-2008. PDA1 was used as the control group, and meal packs were made in the same way. After fermentation, the 2-furancarboxylic acid methyl ester, resveratrol content, and hardness stored for 1, 4, and 7 days were tested according to the method in Example 1. At the same time, professional appraisers were invited to conduct sensory evaluation of the flavor of the meal packs, and the results are recorded in Table 7.

[0101] Table 7 Resveratrol, 2-furancarboxylic acid methyl ester detection and sensory evaluation results of meal packs

[0102]

[0103] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0104] From the results in Table 7, we can see that after 10 7 CFU / mL Kluyveromyces marxianus INM3116 can significantly increase the content of 2-furancarboxylic acid methyl ester and resveratrol in the fermented dough when making meal buns; in addition, it can also improve the sensory evaluation of the meal buns, increase the aroma, and enhance the flavor and taste.

[0105] Example 6: Production of European bread using Kluyveromyces marxianus INM3116

[0106] Kluyveromyces marxianus INM3116 was inoculated at a concentration of 10 7 CFU / mL, inoculated into grape juice at 1% inoculation amount, fermented at 28℃ for 48h, and added the fermented grape juice to the medium seed at 10% of the total amount of wheat. European bread was made according to the national standard GB / T 14612-2008. PDA1 was used as the control group, and European bread was made in the same way. After fermentation, the 2-furancarboxylic acid methyl ester, resveratrol content, and hardness stored for 1, 4, and 7 days were tested according to the method in Example 1. At the same time, professional appraisers were invited to conduct sensory evaluation of the flavor of the dinner buns, and the results are recorded in Table 8.

[0107] Table 8 Resveratrol, 2-furancarboxylic acid methyl ester detection and European bread sensory evaluation results

[0108]

[0109] Note: Each sensory evaluation item has a full score of 10 points, with a scoring interval of 0.1, and the comprehensive score is the sum of the values ​​of each item.

[0110] From the results in Table 8, we can see that after 10 7 CFU / mL Kluyveromyces marxianus INM3116 can significantly increase the content of resveratrol and 2-furancarboxylic acid methyl ester in making European bread; in addition, it can also improve the flavor and taste of European bread.

[0111] Based on the results of the above embodiments, the Kluyveromyces marxianus INM3116 provided by the present invention is applied to the production of toast, dinner rolls, and European bread. On the basis of not changing the existing process, the resveratrol and 2-furancarboxylic acid methyl ester content of the relevant products can be significantly increased, and the aroma and taste of the products can also be improved, thereby significantly improving the product quality.

[0112] The above-mentioned embodiments only express several implementation methods of the present invention, and the description is relatively specific and detailed, but it cannot be understood as limiting the scope of the invention patent. It should be pointed out that for ordinary technicians in this field, several modifications and improvements can be made without departing from the concept of the present invention. Therefore, the protection scope of the patent of the present invention shall be based on the attached claims.

Claims

1. A strain of Kluyveromyces marxii, characterized in that: Kluyveromyces marxianus INM3116, the strain was deposited in the Guangdong Provincial Microbiological Culture Collection Center on August 21, 2024, with the deposit number: GDMCC NO: 65039, and the deposit address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, Guangdong Province.

2. The Kluyveromyces marxii strain according to claim 1, characterized in that: The colony characteristics of Kluyveromyces marxianus are as follows: after culturing on a PDA plate for 48 hours, colonies with a diameter of 1.0 to 5.0 mm, white color, oval shape, smooth and moist surface, neat edges and raised areas are formed.

3. A method for preparing Kluyveromyces marxii according to claim 1, characterized in that: Step 1: Isolation of Kluyveromyces marxianus: Kluyveromyces marxianus was isolated and screened from raisin samples. The grape juice was squeezed and cultured in an incubator at 28°C. The fermentation broth was diluted 10 1 -10 7 times, and evenly spread the fermentation broth of different dilution concentrations on the PDA medium, and culture it in an incubator at 28°C for 48 hours, and then select white colonies on the PDA medium for screening; Step 2: Screening of Kluyveromyces marxianus: The obtained Kluyveromyces marxianus was cultured to the logarithmic growth phase, and the final concentration of the strain was 1×10 7 CFU / mL, and then inoculated into grape juice at a 1% inoculation amount, and placed in a 28°C incubator for 48 hours to obtain the fermentation liquid.

4. A use of Kluyveromyces marxii according to claim 1, characterized in that: According to the bread making process, the fermentation liquid that has been fermented by Marx Kluyveri for 48 hours is added, and the added amount is 10% of the total amount of wheat, so as to improve the content of resveratrol and 2-furancarboxylic acid methyl ester in the bread and the taste of the bread.

5. A use of the Kluyveromyces marxii yeast according to claim 1 to effectively increase the content of methyl 2-furancarboxylate in grape juice after fermentation.

6. Use of the Kluyveromyces marxii yeast according to claim 1 to increase the resveratrol content in baked bread.

7. Use of the Kluyveromyces marxianus according to claim 1 for preparing bread rich in resveratrol.

8. Use of the Kluyveromyces marxii yeast according to claim 1 for making toast.

9. Use of the Kluyveromyces marxii according to claim 1 for making meal packs.

10. Use of the Kluyveromyces marxii yeast according to claim 1 for making European bread.

Images