Protein glutaminase mutants, encoding genes, recombinant vectors, recombinant bacteria and methods of preparation and use
By constructing a glutaminase mutant with high specific enzyme activity and thermostability through site-directed mutagenesis and dual plasmid co-expression system, the problems of low glutaminase activity and poor stability of existing proteins are solved, thereby improving its application effect in plant protein modification.
Patent Information
- Application Number
- CN202311010029.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-08-11
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2043-08-11
AI Technical Summary
Existing protein glutaminases suffer from low activity, low yield, poor thermal stability, and insufficiently effective and specific methods for cleaving the leader peptide, which limits their application in protein modification.
By site-directed mutagenesis of specific amino acid sites in the protein glutaminase, a protein glutaminase mutant was constructed. Using a dual plasmid co-expression system, combined with the HRV3C protease recognition sequence LEVLFQGP, high specific enzyme activity and thermostability were achieved, thus preparing a protein glutaminase with modified functions.
It improves the specific enzyme activity and thermal stability of protein glutamate, enhancing its application effect in modified plant protein, especially improving the emulsifying, solubilizing and foaming properties of plant protein.
Smart Images

Figure CN119464263B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of bioengineering, in particular to a protein glutaminase mutant, a coding gene, a recombinant vector, a recombinant bacteria and a preparation method and application. BACKGROUND
[0002] Protein-glutaminase (PGase or PG for short) is an enzyme with EC3.5.1, which is an amido hydrolase. PG is a novel protein glutaminase that can hydrolyze and remove the amide group of the side chain glutamine of a protein to generate glutamic acid. PG can directly catalyze the deamidation of a macromolecular protein without the need for prior hydrolysis of the protein, and the deamidation process does not cause adverse changes in the structure of the protein. PG has high specificity and only acts on the glutamine of the side chain of a protein, and cannot deamidate asparagine. Therefore, PG is known as the most potential tool for protein modification. For example, PG can deamidate soybean protein isolate in a soybean protein functional beverage to increase the degree of hydrolysis of the soybean protein isolate, thereby increasing the clarity of the soybean protein functional beverage without causing adverse flavors. PG can deamidate egg white to improve the foaming property of the egg white, increase the softness of a cake, and reduce the amount of egg white used.
[0003] Protein-glutaminase is composed of a 114-amino-acid leader peptide and a 185-amino-acid mature peptide. The function of the mature peptide is to perform the biological function of the protein. The function of the leader peptide is to assist the correct folding of the protease, affect its structure and function, and avoid the incorrect folding or aggregation of the protease. In addition, the leader peptide can keep the protease in an inactive state before the protease is released from the cell. Changes in the structure of the leader peptide can greatly change the function of the protein itself. Therefore, to obtain active protein-glutaminase, the leader peptide must be removed. At present, trypsin, neutral protease and alkaline protease are commonly used for cleavage, but the action time is long and the effective cleavage time is not easy to control. In addition, the specificity of these enzymes is not high. For example, trypsin acts on the peptide bond composed of arginine and lysine carboxyl groups, but there are multiple arginine and lysine on the surface of PG, especially in the mature peptide, which can lead to the loss of activity. Therefore, it is particularly important to find an effective method for cleaving the leader peptide. In addition, wild protein-glutaminase has the disadvantages of low activity, low yield and poor thermal stability. In view of this, the present application provides a protein glutaminase mutant, a coding gene, a recombinant vector, a recombinant bacteria and a preparation method and application. SUMMARY
[0004] The technical problem solved by the present application is to provide a protein glutamine enzyme mutant, a coding gene, a recombinant vector, a recombinant bacterium, a preparation method and an application.
[0005] The present application solves the above technical problem, and the first aspect is to provide a protein glutamine enzyme mutant, which has a sequence with amino acid mutation shown in SEQ ID NO: 1, and the amino acid mutation site is any one of 63W, 65I, 87A, 102S, 136M, 144P, 193S, 204F, 211V, 261F, 262G, 264L, 271V, 289M or a combination of at least two mutation sites.
[0006] Among them, the amino acid mutation site 63W means that the glycine (G) at position 63 of the sequence SEQ ID NO: 1 is mutated to tryptophan (W); the others 65I, 87A, 102S, 136M, 144P, 193S, 204F, 211V, 261F, 262G, 264L, 271V, 289M have similar meanings, and will not be described one by one.
[0007] The beneficial effects of the present application are: a series of mutants are obtained by site-directed mutagenesis, and the specific enzyme activity and thermal stability are analyzed, the sequence SEQ ID NO: 1 is modified, it is found that the amino acid mutation occurs at any one of 63W, 65I, 87A, 102S, 136M, 144P, 193S, 204F, 211V, 261F, 262G, 264L, 271V, 289M or a combination of at least two mutation sites, a protein glutamine enzyme mutant (including single-point mutant and combination mutant) is obtained, high specific activity and high thermal stability are achieved, and it has important application value.
[0008] On the basis of the above technical solution, the present application can also be improved as follows.
[0009] Further, the protein glutaminase mutant is G63W, L65I, G87A, T102S, S144P, A193S, Y204F, T211V, S261F, Y264L, I271V / I204F, T211V / Y204F, Y204F / G63W, Y204F / L65I, Y204F / G87A, Y204F / T102S, Y204F / S144P, Y204F / A193S, I271V / T211V, T211V / Y204F / Y264L, T211V / Y204F / A193S, T211V / Y204F / A193S / G87A, T211V / Y204F / Y264L / S144P or T211V / Y204F / Y264L / L65I. For example, the protein glutaminase mutant I271V / T211V is that the threonine (T) at the 211th position of SEQ ID NO: 1 is mutated to valine (V), and the isoleucine (I) at the 271th position is mutated to valine (V).
[0010] Further, the protein glutaminase mutant is I271V / T211V.
[0011] The beneficial effect of the above further scheme is that, compared with the wild type, the I271V / T211V mutant obtained by the present application has an enzyme activity increased by 4.14 times, and the thermal stability is also greatly improved; therefore, the I271V / T211V mutant provided by the present application is more conducive to meet the needs of social production, and has better utilization value in plant protein modification.
[0012] The second aspect of the present application is to provide an encoding gene, which encodes the protein glutaminase mutant of any one of the above.
[0013] The third aspect of the present application is to provide a recombinant plasmid, which comprises a recombinant plasmid I for expressing HRV3C protease and a recombinant plasmid II connected with the encoding gene.
[0014] Further, the plasmid vector of the recombinant plasmid I is pEVOL, and the plasmid vector of the recombinant plasmid II is pET28a.
[0015] The fourth aspect of the present application is to provide a recombinant bacterium comprising the recombinant plasmid described above. Preferably, the recombinant bacterium is Escherichia coli BL21 (DE3) strain.
[0016] The fifth aspect of the present application is to provide a method for directly preparing active protein glutaminase, comprising the following steps:
[0017] (1) preparing the recombinant plasmid I and the recombinant plasmid II as described above, transforming the recombinant plasmid I and the recombinant plasmid II into a host to obtain the recombinant bacteria as described above;
[0018] (2) inducing and culturing the recombinant bacteria by an inducer to obtain bacteria containing intracellular expression of the recombinant plasmid I and the recombinant plasmid II, crushing the bacteria to obtain a crude enzyme solution;
[0019] (3) separating and purifying the crude enzyme solution to obtain the protein glutamine enzyme mutant.
[0020] The HRV3C protease (recombinant type) is a recombinant protease modified by genetic engineering, which specifically recognizes the Leu-Glu-Val-Leu-Phe-Gln-Gly-Pro (LEVLFQGP) eight amino acid sequence, and is high in specificity and activity for cutting (the cutting site is between Gln-Gly), and contains GST and His labels, and can be removed by GSH resin or nickel column after the action is completed.
[0021] The beneficial effects of the above scheme are that the HRV3C protease recognition sequence LEVLFQGP is added to the N-terminal of the mature peptide of the protein glutamine enzyme, and the recombinant plasmid I and the recombinant plasmid II, i.e. a double-plasmid co-expression system, is used to directly produce active protein glutamine enzyme single-point mutants and combined mutants, and the specific enzyme activity and thermal stability of the mutants are greatly improved.
[0022] Further, the inducer in step (2) is IPTG and arabinose; and the crude enzyme solution in step (3) is sequentially separated and purified by a nickel column and a desalting column. The IPTG (Isopropyl beta-D-Thiogalactoside) is used to induce the expression of the protein glutamine enzyme of the recombinant plasmid II, and the specific amount can be 0.1 mM; and the arabinose is used to induce the expression of the HRV3C protein of the recombinant plasmid II, and the specific amount can be 0.2 wt.%.
[0023] The sixth aspect of the present application provides the application of the protein glutamine enzyme mutant, and the protein glutamine enzyme mutant is used for modifying plant proteins. Specifically, the emulsifying property, solubility, foaming property, allergenicity and the like of the plant proteins are changed. BRIEF DESCRIPTION OF DRAWINGS
[0024] Figure 1 It is a purification electrophoretogram of the protein glutamine enzyme mutant of the present application;
[0025] Figure 2 It is the specific enzyme activity determination of the protein glutamine enzyme mutant of the present application;
[0026] Figure 3 Thermal stability determination of the glutaminase mutants of the present application;
[0027] Figure 4 Thermal stability determination of the glutaminase wild type and I271V / T211V mutants of the present application;
[0028] Figure 5 Optimum temperature determination of the glutaminase wild type and I271V / T211V mutants of the present application. DETAILED DESCRIPTION
[0029] The principles and features of the present application are described below, and the examples are used only to explain the present application and not to limit the scope of the present application. If a specific technique or condition is not mentioned in the examples, it is performed according to the technique or condition described in the literature in the art or according to the product manual. If the manufacturer of the reagent or instrument is not mentioned, it is a conventional product that can be purchased through a regular channel.
[0030] Example 1: Construction of a dual plasmid co-expression system and expression and purification of active protein glutaminase
[0031] 1. Construction of a dual plasmid co-expression system
[0032] MBP-HRV3C fragment was constructed in pEVOL vector (purchased from Addgene Inc.) and PG fragment was constructed in pET28a vector (purchased from Addgene Inc.), in which HRV3C recognition sequence LEVLFQGP was added between the leader peptide and mature peptide of PG by inverse PCR, and the primer sequences used were as follows: F-MPG-SUB: 5’ AAGTTTTGTTCCAAGGTCCAGCCTCAGTGATTCCGGATGTTG 3’ P-PRO-PG-SUB: 5’ TGGACCTTGGAACAAAACTTCCAATTCTTTTGTAAGAATCGTTTT 3’ and the inverse PCR system was as shown in Table 1 using pET28a-PG as a template.
[0033] Table 1 Inverse PCR system
[0034] Component Volume ddH2O up to 50 μL 2x Phanta Flash Master Mix 25 μL Upstream primer (10 μM) 2 μL Downstream primer (10 μM) 2 μL Template 1 μL
[0035] PCR reaction conditions: 98℃ pre-denaturation 30s, 98℃ denaturation 30s, 55℃ annealing 5s, 72℃ extension 35s, 25 cycles, finally 72℃ extension 10min. The PCR product was detected by 0.8% agarose gel electrophoresis for yield and specificity, and purified by DNA purification kit. The purified PCR product was subjected to demethylation with DpnI, and transformed into E. coli DH5a cloning competent cells (purchased from Genview Biotechnology Co., Ltd.) to obtain the correct recombinant vector pET28a-Pgsub carrying the nucleotide sequence of SEQ ID NO. 1.
[0036] 2. Expression and purification of active protein glutaminase
[0037] The pEVOL-MBP-HRV3C and pET28a-PGsub were co-transformed into BL21(DE3) expression strain to obtain recombinant bacteria pEVOL-MBP-HRV3C+pET28a-PGsub. The recombinant bacteria were picked and cultured in LB medium containing 50mg / mL kanamycin and 10mg / mL chloramphenicol at 37℃ for 6h to obtain seed liquid. The seed liquid was inoculated into 100mL LB medium at an inoculation amount of 1%, and cultured at 37℃ until OD600=0.6-0.8, and then 0.1mM IPTG and 0.2% arabinose were added, and the culture was transferred to 18℃ for further culture for 18-20h. 600
[0038] The bacteria were collected by centrifugation at 4000rpm for 10min, resuspended in pH7.5 50mM Tris-HCl buffer, and treated with ultrasonic disrupter at a power ratio of 42% for 2s on and 2s off for a total of 10min. The bacteria were centrifuged at 12000rpm for 10min to obtain the supernatant. The supernatant was purified by nickel column and desalted column. The purification buffers were buffer A (20mM imidazole, 50mM Tris, 500mM NaCl, pH7.5), buffer B (50mM imidazole, 50mM Tris, 500mM NaCl, pH7.5), and buffer C (500mM imidazole, 50mM Tris, 500mM NaCl, pH7.5). The desalting buffer was pH7.5 50mM Tris-HCl buffer.
[0039] SDS-PAGE electrophoresis showed that the purified PG, proenzyme had a molecular weight of 34KDa, the mature peptide had a molecular weight of 20KDa, and the leader peptide had a molecular weight of 14KDa, as shown in Figure 1
[0040] Example 2: Construction and expression and purification of protein glutaminase mutants
[0041] The recombinant plasmid pET28a-PGsub nucleotide sequence was used as a template to design primers containing mutation sites (Table 2).
[0042] PCR reaction conditions: 98°C pre-denaturation for 30 s, 98°C denaturation for 30 s, 55°C annealing for 5 s, 72°C extension for 35 s, 25 cycles, and finally 72°C extension for 10 min. The PCR product was detected for yield and specificity by 0.8% agarose gel electrophoresis, and purified using a DNA purification kit. The purified PCR product was subjected to demethylation with DpnI and transformed into E. coli DH5a clonal competent cells (purchased from Genview Biologic) to obtain correct recombinant vectors by sequencing three transformants.
[0043] Table 2 Mutant primer sequences
[0044]
[0045]
[0046] The pEVOL-MBP-HRV3C and PG series of correct mutants were co-transformed into BL21 (DE3) expression strains to obtain mutant recombinant bacteria. The recombinant bacteria were picked and cultured in LB medium containing 50 mg / mL kanamycin and 10 mg / mL chloramphenicol at 37°C for 6 h to obtain a seed solution. The seed solution was inoculated into 100 mL of LB medium at a 1% inoculation amount, and the culture was incubated at 37°C until the OD 600 = 0.6-0.8, 0.1 mM IPTG and 0.2% arabinose were added, and the culture was transferred to 18°C for further incubation for 18-20 h.
[0047] The bacteria were collected by centrifugation at 4000 rpm for 10 min, resuspended in pH 7.5 50 mM Tris-HCl, and treated with an ultrasonic disrupter at a power ratio of 42% for 2 s on and 2 s off for a total of 10 min. The supernatant was obtained by centrifugation at 12000 rpm for 10 min. The supernatant was purified using a nickel column and desalted using a desalting column. The purification buffers were buffer A (20 mM imidazole, 50 mM Tris, 500 mM NaCl, pH 7.5), buffer B (50 mM imidazole, 50 mM Tris, 500 mM NaCl, pH 7.5), and buffer C (500 mM imidazole, 50 mM Tris, 500 mM NaCl, pH 7.5). The desalting buffer was pH 7.5 50 mM Tris-HCl buffer.
[0048] Example 3: Determination of specific enzyme activity, optimum temperature, and thermal stability of the glutaminase mutant
[0049] 1. Determination of specific enzyme activity
[0050] Definition: The amount of enzyme required to produce 1 μmol of ammonia per minute under certain conditions is defined as one unit of enzyme activity (u).
[0051] Reagents: Potassium dihydrogen phosphate, disodium hydrogen phosphate, trichloroacetic acid, phenol, sodium nitroprusside, potassium hydroxide, anhydrous potassium carbonate, sodium hypochlorite (food grade), Cbz-Gln-Gly (M=337), ammonium chloride;
[0052] Reagent preparation: (1) Phosphate buffer (0.176 mol / L pH 6.5): weigh 23.95 g of potassium dihydrogen phosphate, dissolve in water, and dilute to 1000 ml (Solution I); weigh 24.98 g of disodium hydrogen phosphate, dissolve in water, and dilute to 1000 ml (Solution II); add an appropriate amount of Solution I to Solution II and adjust the pH to 6.5.
[0053] (2) Trichloroacetic acid solution: weigh 65.36 g of trichloroacetic acid, dissolve in water, and dilute to 1000 ml.
[0054] (3) Color reagent A: weigh 40.06 g of phenol and 0.15 g of sodium nitroprusside, dissolve in water, and dilute to 1000 ml; store at 4°C in the dark.
[0055] (4) Color reagent B: weigh 49.94 g of KOH, dissolve in water, and dilute to 1000 ml; store at 4°C.
[0056] (5) Color reagent C: weigh 200.04 g of anhydrous potassium carbonate and 8.33 ml of sodium hypochlorite (food grade), add water to make 1000 ml, and prepare fresh each time. (6) Substrate solution (10 mM Cbz-Gln-Gly, M=337): weigh 0.337 g of Cbz-Gln-Gly, dissolve in 0.176 mol / L, pH 6.5 phosphate buffer, and dilute to 100 ml.
[0057] Standard curve drawing: 0.5349 g of ammonium chloride (105°C oven 2 hours) was weighed, dissolved in water, and diluted to 1000 ml. Then 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 mL was taken in a test tube, and water was added to 10 ml, so that the final concentration in each test tube was 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 μmol / ml, respectively. 0.24 ml of the above ammonium chloride solution was taken, 0.96 ml of water was added, mixed well, then 1.2 ml of A solution was added in turn, mixed well, 0.6 ml of color developing agent B was added, mixed well, then 1.2 ml of C was added, mixed well, 37°C water bath for 20 min, flow cooling with water as reference (i.e. 0.18 ml of ammonium chloride solution was replaced by water), A630 nm measured OD value.
[0058] Enzyme activity determination: (1) Sample: 0.1 ml of sample solution was taken into a test tube, 37°C water bath for 5 min; then 1 ml of substrate solution preheated at 37°C for 10 min was added, 37°C water bath for 30 min, then 1 ml of trichloroacetic acid solution was added immediately, mixed well, and the reaction was terminated, and then the ammonia content was determined. (2) Blank: 0.1 ml of sample solution was added to 1 ml of trichloroacetic acid solution, mixed well, 37°C water bath for 30 min, then 1 ml of substrate solution was added, mixed well. 0.12 ml of the above sample and blank reaction solution was taken, 0.48 ml of water was added, mixed well, then 0.6 ml of A solution was added in turn, mixed well, 0.3 ml of color developing agent B was added, mixed well, then 0.6 ml of C was added, mixed well, 37°C water bath for 20 min, flow cooling, A630 measured OD value.
[0059] Results: E = (ΔA*2.1*N) / 17.03 / 30 / K;
[0060] Wherein, E: protein glutamine enzyme activity, u / ml; ΔA: OD630 difference; 2.1: total volume of reaction solution (ml); N: sample dilution multiple; 17.03: ammonia molecular weight; 30: reaction time (min); K: standard curve slope.
[0061] Protein concentration determination: ImageJ was used to analyze the gray scale of mature peptide to obtain the concentration of mature peptide (mg / mL).
[0062] The specific enzyme activity of wild type (referred to as WT) and all mutants was determined, and the results are shown in Figure 2 Figure 2 It can be seen that the specific enzyme activity of the mutants G63W, L65I, G87A, T102S, S144P, A193S, Y204F, T211V, S261F, Y264L, I271V / I204F, T211V / Y204F, Y204F / G63W, Y204F / L65I, Y204F / G87A, Y204F / A193S, I271V / T211V, T211V / Y204F / A193S, T211V / Y204F / A193S / G87A, T211V / Y204F / Y264L / S144P or T211V / Y204F / Y264L / L65I is higher than that of the wild type, and the specific enzyme activity of the mutant I271V / T211V reaches 3.97 U / mg, which is 4.14 times that of the wild type.
[0063] 2. Heat stability determination
[0064] Heat stability determination: the wild type protein glutaminase and all mutants were subjected to heat stability determination and treated at 37°C for 0h, 0.5h, 1h, 2h, and the results are shown in Table 2. Figure 3 ; from Figure 3 It can be seen that the protein glutaminase mutants G63W, L65I, G87A, T102S, S144P, A193S, Y204F, T211V, S261F, Y264L, I271V / I204F, T211V / Y204F, Y204F / G63W, Y204F / L65I, Y204F / G87A, Y204F / A193S, I271V / T211V, T211V / Y204F / A193S, T211V / Y204F / A193S / G87A, T211V / Y204F / Y264L / S144P and T211V / Y204F / Y264L / L65I have good heat stability.
[0065] The wild type protein glutaminase and the mutant I271V / T211V were treated at 37°C and 55°C for 0h, 0.5h, 1h, 2h, and the results are shown in Table 3. Figure 4 The mutant I271V / T211V retains 90% of the activity after being treated at 55°C for 0.5h, while the wild type protein glutaminase retains 65% of the activity after being treated at 55°C for 0.5h. The heat stability of the mutant I271V / T211V is greatly improved compared with that of the wild type protein glutaminase.
[0066] 3. Optimum temperature determination
[0067] Optimum temperature determination: the wild type protein glutaminase and mutant I271V / T211V are determined for enzyme activity at 15℃, 20℃, 25℃, 30℃, 35℃, 40℃, 45℃, 50℃, 55℃, 60℃, 65℃, and the results are as shown in Table 1 Figure 5 The mutant I271V / T211V has high activity at different temperatures.
[0068] In conclusion, the present application directly produces active protein glutaminase through a double plasmid co-expression system, constructs single-point mutants and combination mutants of protein glutaminase through a computer-aided design method, and the specific enzyme activity and thermal stability of the provided mutants are greatly improved, which is of great significance for improving the solubility and emulsification of proteins in food, and is more conducive to meeting the needs of social production.
[0069] In the description of the present specification, the description of the terms "one embodiment", "some embodiments", "an example", "a specific example", or "some examples" and the like means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. In the present specification, the illustrative description of the above terms is not necessarily directed to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any appropriate manner in any one or more embodiments or examples. In addition, different embodiments or examples described in the present specification and the features of different embodiments or examples can be combined and modified by those skilled in the art without contradiction.
[0070] Although the embodiments of the present application have been shown and described above, it should be understood that the above-described embodiments are exemplary and should not be construed as limiting the present application, and those skilled in the art can make changes, modifications, replacements and variations to the above-described embodiments within the scope of the present application.
Claims
1. A mutant of the protein glutaminase characterized in that, The protein glutaminase mutant is I271V / T211V.
2. The protein glutaminase mutant according to claim 1, characterized in that, The coding gene encodes the protein glutaminase mutant as claimed in any one of claims 1 to 2.
3. A gene encoding a gene, characterized in that, The recombinant plasmid comprises a recombinant plasmid I for expressing HRV3C protease and a recombinant plasmid II connected with the coding gene as claimed in claim 3.
4. A recombinant plasmid, characterized by comprising the nucleotide sequence of SEQ ID NO:
1. The plasmid vector of the recombinant plasmid I is pEVOL, and the plasmid vector of the recombinant plasmid II is pET28a.
5. The recombinant plasmid of claim 4, wherein, The recombinant plasmid as claimed in claim 4 or 5 is comprised.
6. A recombinant bacterium, characterized in that, The steps comprise:
7. A method for directly preparing an active protein glutaminase enzyme, characterized by, (1) preparing the recombinant plasmid I and the recombinant plasmid II as claimed in claim 4 or 5, transforming the recombinant plasmid I and the recombinant plasmid II into a host to obtain the recombinant bacteria as claimed in claim 6; (2) inducing the recombinant bacteria by an inducer to obtain bacteria containing intracellular expression of the recombinant plasmid I and the recombinant plasmid II, crushing the bacteria to obtain a crude enzyme solution; (3) separating and purifying the crude enzyme solution to obtain the protein glutaminase mutant. The inducer in step (2) is IPTG and arabinose; and the crude enzyme solution in step (3) is sequentially separated and purified by a nickel column and a desalting column.
8. The method of claim 7, wherein the protein glutaminase mutant is prepared by, The protein glutaminase mutant as claimed in any one of claims 1 to 2 is used for modifying plant proteins.
9. Use of a mutant of the protein glutaminase characterized in that,
Citation Information
Patent Citations
Protein glutaminase mutant with improved catalytic activity and application thereof
CN116536291A
Glucoamylase variants and polynucleotides encoding same
US20180298456A1