A method for inhibiting horizontal gene transfer based on fnr knockout of vibrio harveyi

Abstract

The application discloses a method for inhibiting horizontal gene transfer based on fnr knockout of Harveyi Vibrio, and relates to the fields of molecular biology and genetic engineering. The method for inhibiting horizontal gene transfer comprises the following steps: introducing a target exogenous plasmid into a conjugative transfer donor bacterium, and then conjugating with a receptor bacterium. The efficiency of the Harveyi Vibrio in obtaining the exogenous plasmid through conjugative transfer is reduced by knocking out the fnr gene of the receptor bacterium, and the method has the characteristics of significant reduction in the conjugative transfer efficiency. Compared with a wild-type host cell, the efficiency of the host cell with the fnr gene knocked out in obtaining the plasmid pMMB207 in the donor bacterium Escherichia coli through conjugative transfer is reduced by 6.76 times. The method greatly reduces the acquisition ability of the host cell to the exogenous plasmid, and has great significance in resisting microbial pathogenicity and drug resistance.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically to a method for inhibiting horizontal gene transfer based on Vibrio harveyi fnr knockout. Background Technology

[0002] Vibrio harveyi is a significant opportunistic pathogen in marine aquaculture, posing a substantial threat to the industry. A survey of marine fish diseases along the South China coast found that approximately 70% of vibrio infections in marine fish are caused by Vibrio harveyi. Due to the limitations of other control methods such as vaccines and immune enhancers, antibiotics are considered the most effective and flexible weapon against bacterial infectious diseases and are widely used for the prevention and treatment of bacterial diseases in aquaculture. Currently, Vibrio harveyi faces a severe resistance situation, with a resistance index as high as 0.60. The urgency of effective disease control and the drug resistance induced by antibiotic treatment both indicate the urgent need to explore new disease control strategies. Attenuating virulence and reducing antibiotic resistance are fundamental requirements for disease control and are key to implementing green and healthy aquaculture.

[0003] The key to reducing virulence and resistance lies in controlling virulence and drug resistance genes. Virulence and drug resistance genes of pathogenic microorganisms can spread horizontally between different species through conjugation transfer via mobile genetic elements such as plasmids, thereby enhancing the pathogenicity and drug resistance of pathogens and increasing the complexity and variability of disease control. Therefore, reducing the efficiency of plasmid conjugation transfer between bacteria can effectively control the spread and diffusion of virulence and drug resistance genes, and is considered one of the effective strategies for controlling the spread of virulence and drug resistance in pathogenic microorganisms. Summary of the Invention

[0004] To address the problems existing in the prior art, the present invention aims to provide a method for inhibiting horizontal gene transfer. Using this method for plasmid conjugation transfer effectively reduces plasmid conjugation transfer efficiency and can effectively solve the problems of rapid spread of drug-resistant and pathogenic bacteria.

[0005] To solve the above problems, the present invention is implemented as follows:

[0006] The first objective of this invention is to provide the application of the gene fnr, which encodes the CRP / FNR family transcriptional regulator of knockout bacteria, in suppressing horizontal gene transfer.

[0007] Preferably, the bacteria is Vibrio harveyi, and the CRP / FNR family transcription factor encoding gene fnr is shown in SEQ ID NO. 1, 385bp-1131bp.

[0008] The fnr gene is located on chromosome 1 of Vibrio harveyi, at positions 3053987-3054733, with an ID of CU052_14940 and consists of 747 bases. Its encoded protein, FNR, is a CRP / FNR family transcriptional regulator with an ID of NP_797915.1.

[0009] The second objective of this invention is to provide a Vibrio harveyi strain with low conjugation transfer efficiency, wherein the CRP / FNR family transcription factor encoding gene fnr of the Vibrio harveyi strain is knocked out, and the CRP / FNR family transcription factor encoding gene fnr is shown as 385bp-1131bp of SEQ ID NO.1.

[0010] The third objective of this invention is to provide a method for constructing Vibrio harveyi with low conjugation transfer efficiency, which involves knocking out the CRP / FNR family transcription factor encoding gene fnr of Vibrio harveyi to obtain Vibrio harveyi with low conjugation transfer efficiency. The CRP / FNR family transcription factor encoding gene fnr is shown as 385bp-1131bp in SEQ ID NO.1.

[0011] Preferably, it includes the following steps:

[0012] Step 1: Design gene knockout primers for the CRP / FNR family transcriptional regulatory factor encoding gene fnr on the Vibrio harveyi genome;

[0013] Step 2: Using Vibrio harveyi as the starting strain, knock out the gene fnr encoding the CRP / FNR family transcriptional regulator, and obtain the gene-deleted strain V.harveyi 345-Δfnr, which is Vibrio harveyi with low conjugation transfer efficiency.

[0014] Preferably, the gene knockout primers in step one are: upstream homologous arm amplification primers: aagcttgatatcgaattcAAGC ACCCAGTGTATG and atcgtgatctaagatggtgATCCAACTGATCCAGTTC, and downstream homologous arm amplification primers: ga actggatcagttggatCACCATCTTAGATCACGAT and ttggtaacgaatcagacCAAAGTCGAAGCTATCGTC.

[0015] Preferably, step two, specifically the knockout of the CRP / FNR family transcriptional regulator gene fnr, includes the following steps:

[0016] (1) PCR amplification of the upstream and downstream homologous arms of the fnr gene and the linearized suicide plasmid;

[0017] (2) Recombinant plasmids were obtained by isothermal assembly of upstream and downstream homologous arms and linearized suicide plasmids. The recombinant plasmids were then transformed into intermediate host E. coli GEB802 and donor E. coli GEB883, and positive clones were obtained by PCR identification.

[0018] (3) The donor bacteria E. coli GEB883 was cultured to the early logarithmic phase, and the recipient bacteria Vibrio harveyi 345 was cultured to the early logarithmic phase;

[0019] (4) The early logarithmic recipient bacteria Vibrio harveyi 345 was heat-shocked at 40℃ for 30 min and then conjugated with the early logarithmic donor bacteria E. coli GEB883.

[0020] (5) Screening and identification of single-crossover clones and double-crossover clones, that is, strains with the fnr gene deletion, which are Vibrio harveyi with low conjugation transfer efficiency.

[0021] In step (1), the suicide plasmid is pSW7848; in step (5), the screening of single-exchange clones specifically refers to screening on plates containing 34 μg / mL chloramphenicol and 0.2% D-glucose; in step (5), the screening of double-exchange clones specifically refers to screening on plates containing 0.2% L-arabinose; in step (5), the identification specifically refers to designing primer pairs: GCATCAAAGTCGTTTTCCATCA and TCAGTATATTGGAGTACACAAGGTAC for PCR identification.

[0022] Furthermore, in some embodiments of the present invention, prior to the conjugation transfer step, the above method includes: an fnr gene knockout step; the fnr gene knockout step includes: constructing a recombinant suicide plasmid containing upstream and downstream homologous arm fragments of the targeting fragment (the fnr gene fragment to be knocked out); introducing the recombinant suicide plasmid into the conjugation transfer donor bacterial host Escherichia coli GEB883; and conjugating the donor bacterial containing the recombinant suicide plasmid with the recipient bacterial.

[0023] It should be noted that the gene knockout method described above uses homologous recombination to knock out the fnr gene. However, in other embodiments, other gene knockout methods may also be used to knock out the fnr gene. Regardless of the method used to knock out the fnr gene, such as complete knockout, partial knockout, or even inhibiting fnr gene expression through RNAi interference vectors to inactivate it, as long as the method prevents the recipient bacterium's fnr gene from functioning during plasmid conjugation and transfer, it falls within the scope of protection of this invention.

[0024] A fourth objective of this invention is to provide the above-mentioned Vibrio harveyi with low conjugation transfer efficiency as a genetically engineered bacterium for gene knockout, inhibition of horizontal gene transfer, or reduction of drug-resistant pathogens.

[0025] The fifth objective of this invention is to provide a method for horizontal transfer of inhibitory genes based on Vibrio harveyi fnr knockout, comprising the following steps: introducing a target exogenous plasmid into a conjugation transfer donor bacterium, and then conjugating it with the aforementioned Vibrio harveyi with low conjugation transfer efficiency.

[0026] Preferably, the exogenous plasmid is pMMB207, and the donor bacterium is Escherichia coli GEB883.

[0027] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0028] This invention is the first to discover that, compared to wild-type strains, knocking out the fnr gene can suppress the efficiency of acquiring exogenous plasmids through conjugation transfer. Based on this finding, during conjugation transfer, mixing donor bacteria containing the target exogenous plasmid with recipient bacteria that have had the fnr gene knocked out and performing conjugation transfer can reduce the efficiency of conjugation transfer of the target exogenous plasmid from the donor bacteria to the recipient bacteria, inhibiting horizontal transfer of exogenous genes. This is of great significance in resisting the rapid spread of drug-resistant and pathogenic microorganisms.

[0029] This invention provides a method for inhibiting horizontal gene transfer based on FNR knockout, which greatly reduces the host cell's ability to acquire exogenous plasmids through conjugation transfer. Compared with the originating strain, the conjugation transfer efficiency of V. harvestyi 345-Δfnr is significantly reduced. This method greatly reduces the ability of Vibrio harveyi to absorb exogenous plasmids, which is of great significance for resisting microbial pathogenicity and drug resistance.

[0030] The present invention provides a method for inhibiting horizontal gene transfer, comprising: mixing donor bacteria containing a target exogenous plasmid with recipient bacteria that have had their fnr gene knocked out; and reducing conjugation transfer and inhibiting horizontal gene transfer by knocking out the fnr gene in the recipient bacteria. This method has the characteristic of significantly reducing the efficiency of conjugation transfer. For example, compared with wild-type V. harvestyi 345, the efficiency of obtaining plasmid pMMB207 by conjugation transfer of V. harvestyi 345-Δfnr with the fnr gene knocked out is reduced by 6.76 times. The method for inhibiting horizontal gene transfer provided by the present invention is of great significance in resisting the emergence of drug-resistant bacteria.

[0031] The starting strain *V. harvestyi* 345 described in this invention has been published in NCBI (CP025537, CP025538, CP025539, CP025540). The intermediate host *E. coli* GEB802, the donor strain *E. coli* GEB883, and the plasmid pSW7848 involved in this invention have been published in the following literature: Deng YQ, Su YL, Liu SL, et al. Identification of a novel small RNA srvg23535 in *Vibrio alginolyticus* ZJ-T and its characterization with phenotype microarray technology [J]. *Frontiers in Microbiology*, 2018: 2394. The inventors also possess the aforementioned microorganisms and vectors and guarantee to provide them to the public within 20 years from the date of application. Attached Figure Description

[0032] Figure 1 Construction of knockout strains of fnr gene encoding CRP / FNR family transcriptional regulators;

[0033] Lane M1: DNA Marker DL5000; Lane 1: pSW7848 linearized fragment; Lane M2: DNA Marker DL2000; Lanes 2 / 3: fnr upstream / downstream fragments; Lane M3: DNA Marker DL2000; Lane 4: recombinant pSW7848-fnr detection fragment; Lane M4: DNA Marker DL2000; Lane 5: fnr gene knockout identification primer amplification results using wild-type Vibrio harveyi 345 genomic DNA as a template; Lane 6: fnr gene knockout identification primer amplification results using fnr candidate mutant genomic DNA as a template.

[0034] Figure 2 This is a comparison of the conjugation and transfer efficiencies of the starting strains V. harvestyi 345 and V. harvestyi 345-Δfnr in chloramphenicol plates.

[0035] Figure 3 This is a comparison of the relative conjugation efficiencies of the starting strains V. harvestyi 345 and V. harvestyi 345-Δfnr. Detailed Implementation

[0036] The technical solution of the present invention will be further described below with reference to the embodiments, but the scope of protection of the present invention is not limited thereto.

[0037] For the source of the suicide plasmid pSW7848, see the reference: Val, ME., Skovgaard, O., Ducos-Galand, M., Bla nd, MJ, Mazel, D., 2012. Genome engineering in Vibrio cholerae: a feasible approach to address biological issues. PLoS Genet. 8, e1002472.

[0038] For the source of E.coli GEB883, please refer to the literature: Nguyen, AN, Disconzi, E., Charrière, GM, Destoumi eux-Garzón, D., Bouloc, P., Le Roux, F., Jacq, A., 2018. csrB geneduplication drives the evolution of redundant regulatory pathways controlling expression of the major toxic secreted metalloproteases in Vibriotasmaniensis LGP32.mSphere.3,e00582-00518.

[0039] E. coli GEB802 is published in the literature Deng YQ, Su YL, Liu SL, et al. Identification of anovel small RNA srvg23535 in Vibrio alginolyticus ZJ-T and its characterization with phenotype microarray technology[J]. Frontiers in microbiology, 2018:2394. E. coli GEB802 is π3813 in the article.

[0040] Example 1:

[0041] I. Knockout of fnr (CU052_14940), the gene encoding CRP / FNR family transcriptional regulators, in the V. harvestyi 345 genome

[0042] In the experiment, we designed corresponding gene knockout primers for the fnr gene (Table 1).

[0043] Table 1 Primers related to gene knockout and identification

[0044]

[0045] The fnr gene ORF and its upstream and downstream sequences (as shown in SEQ ID NO.1), with the italicized ATG and TAA being the start and stop codons of fnr, respectively, from 385bp to 1131bp.

[0046] The genome of *V. harveyi* 345 was extracted as a template. Using upstream homologous arm amplification primers: fnr-U_fwd: aa gcttgatatcgaattcAAGCACCCAGTGTATG and fnr-U_rev: atcgtgatctaagatggtgATCCAACTGATCC AGTTC, and downstream homologous arm amplification primers: fnr-D_fwd: gaactggatcagttggatCACCATCTTAGATCACGAT and fnr-D_rev: ttggtaacgaatcagacCAAAGTCGAAGCTATCGTC, the upstream and downstream flanking sequences of the *fnr* gene were obtained by PCR amplification. Using the suicide plasmid pSW7848 as a template, the linearized plasmid pSW7848 was obtained by PCR amplification using primers pSW7848-F and pSW7848-R. Using the ClonExpress MultiS One Step Cloning Kit (Nanjing Novizan Biotechnology Co., Ltd.), upstream and downstream flanking sequences were isothermally assembled with a linearized plasmid to obtain the recombinant plasmid pSW7848-fnr (its sequence is shown in SEQ ID NO.2). This plasmid was subsequently transformed into the intermediate host E. coli GEB802 and the donor strain E. coli GEB883 (the preparation and transformation methods of E. coli GEB802 and E. coli GEB883 competent cells are described in Chinese patent CN 107904228 A). Positive clones were screened by PCR using primers pSW7848-check-F and pSW7848-check-kR. The PCR amplification system and procedure described above are described in Chinese patent CN 107904228 A.

[0047] Referring to the invention patent CN 107904228 A, a mutant strain V. harvestyi 345-Δfnr was constructed. The recipient bacterium, Vibrio harveyi 345, was cultured to the early logarithmic growth phase (OD2). 600nm =0.3~0.7), and after heat shock treatment at 40℃ for 30 min, cultured to the early logarithmic growth stage (OD). 600nmConjugation transfer was performed on E. coli GEB883 containing the recombinant plasmid pSW7848-fnr (p=0.3–0.7). The recombinant plasmid pSW7848-fnr from E. coli GEB883 was transferred into Vibrio harveyi 345 via bacterial gene conjugation transfer. Since the pSW7848 plasmid cannot self-replicate in Vibrio harveyi 345, it can only replicate along with the genome after integrating into the Vibrio harveyi 345 genome through homologous recombination. Plasmid integration confers chloramphenicol resistance to *V. harvestyi* 345, while D-glucose inhibits the expression of the toxic gene ccdB from the suicide plasmid pSW7848. Single-crossover clones were obtained through screening on plates containing 34 μg / mL chloramphenicol and 0.2% D-glucose. Double-crossover clones were then screened on plates containing 0.2% L-arabinose (which induces ccdB expression). Further screening of candidate mutants involved simultaneously plating clones on plates containing 0.2% L-arabinose and plates containing 34 μg / mL chloramphenicol and 0.2% L-arabinose. Clones lacking chloramphenicol resistance were identified by PCR (del fnr-check-F and del fnr-check-R), yielding clones with successful gene knockout, which became the mutant strain *V. harvestyi* 345-Δfnr. Following this procedure, fnr was knocked out, and the gene knockout identification results met expectations. Figure 1 ).

[0048] II. Implementation Results

[0049] The starting strain *Vibrio campbellii* V. *harveyi* 345 and the obtained mutant strain *V. *harveyi* 345-Δfnr were subjected to a logarithmic early stage heat shock at 40°C for 10 min, followed by the addition of the RP4 shuttle plasmid pMMB207 (which is chloramphenicol resistant and can self-replicate in *Vibrio campbellii* 345; construction method described in Liu, JX, Zhao, Z., Deng, YQ, Shi, Y., Liu, YP, Wu, C., Luo, P., Hu, CQ, 2017. Complete genome sequence of *Vibrio campbellii* LMB29 isolated from red drum with four native... The *E. coli* donor strain pMMB207-E. coli GEB883 (megaplasmids. Front. Microbiol. 8, 2035. https: / / doi.org / 10.3389 / fmicb.2017.02035) was used for conjugation. After overnight conjugation, the plaques were collected using 1 mL of fresh culture medium (LBS medium, containing 1% peptone, 0.5% yeast extract, and 3% sodium chloride by mass fraction). The plaques were serially diluted, and 100 μL of each dilution was spread onto LBS plates containing 34 μg / mL chloramphenicol (containing 1% peptone, 0.5% yeast extract, 3% sodium chloride, and 1.5% technical agar by mass fraction) for conjugation screening. The conjugation transfer efficiency was statistically analyzed. The results showed that ( Figure 2 , Figure 3 (Table 2) Compared with the starting strain Vibrio harveyi 345, the conjugation transfer efficiency of V. harveyi 345-Δfnr decreased significantly by 6.76 times.

[0050] Table 2. Bonding transfer efficiency of V.harveyi 345 and V.harveyi 345-Δfnr

[0051]

[0052] Compared to wild-type host cells, host cells with the fnr gene knockout exhibited a 6.76-fold lower efficiency in acquiring the pMMB207 plasmid from the donor bacterium *E. coli* via conjugative transfer. This method significantly reduces the host cell's ability to acquire exogenous plasmids, which is of great importance in combating microbial pathogenicity and drug resistance.

[0053] In summary, the above results indicate that the deletion of the fnr gene can significantly reduce the efficiency of Vibrio harveyi in acquiring exogenous plasmids through conjugation transfer, inhibit horizontal gene transfer, and thus prevent or reduce the ability of microorganisms to absorb drug-resistant or pathogenic DNA fragments from the external environment. The method provided by this invention offers a new approach and strategy for reducing or avoiding the emergence of drug-resistant bacteria.

[0054] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

[0055] SEQ ID NO.1

[0056] AAGCACCCAGTGTATG CCTTTCCATTTGGCTTTATTTGGGGCTGGTTACCCTGTGGACTAGTATACTCGGCGTTAACCTGGTCTGCAGTTTCAGGAGACGCTTTAAACGGCGGATTAATCATGCTGTCGTTTGGTCTCGGAACTCTTCCATCAATGCTTGCCATCGGATATGGTGCGAGCCATTTTCAGAAGTTGCAAAAATCGTTAATATTTAGAAACATCTCTGCATTAATCCTAATAAGCTATGGCATGTAT ACTGCCGCCGGCGCGATGCGAATGCTTGGTTTCATAGCATCAAAGTCGTTTTCCATTTTTTTGCTACCCTTTAGAAGTAAGCGTGATAAAATATTGATGTATATCAAATAGTGAAAGGTTGTTATGATTTCTGAAAAACCTGCAACAAAGCGTATCCAATCAGGTGGTTGCGCGATTCATTGCCAAGATTGTAGCATTAGCCAACTGTGTATTCCGTTCACTCTAAACGAGTCT GAACTGGATCAGTTGGATCAAATCATCGAGCGTAAAAAGCCAATCCAAAAAGGCCAAGAGCTTTTTAAAGCAGGTGATGAGCTAAAATCTCTGTACGCTATCCGCTCTGGCACAATCAAGAGCTACACCATTACAGAACAAGGCGATGAGCAAATTACTGCGTTTCACTTAGCAGGTGACCTTGTAGGTTTTGACGCAATCACGGGCGATCTACACCCAAGTTTTGCTCAAGCACTTGAAACTTCAATGGTTTGTGAGATTCCTTACGAAATCCTTGATGACCTATCAGGCAAAATGCCTAAGCTTCGTCAGCAGATCATGCGTCTAATGAGTAGCGAAATTAAAGGTGACCAAGAAATGATCCTTCTGCTTTCTAAAAAGAATGCTGAAGAACGTCTTGCGGCTTTCCTTTACAACCTATCAACACGTTTCTCGCAACGTGGTTTTAGCCCTCGAGAGTTCCGTCTAACCATGACTCGTGGTGATATTGGTAACTACCTCGGTCTAACAGTTGAAACCATCAGCCGCCTACTTGGTCGCTTCCAGAAATCTGAAATTCTGAGCGTAAAAGGTAAGTACAT CACCATCTTAGATCACGATGCATTGATGGAACTTGCTGGCGTCAGCAAAGACTAATTTGCCCTATCAATTGATGTAGCTCGAAAATGAGCTACATCATATTTCTTCCAAAATCCCTTCGAAAGTCCTCAAATTCTTCCCCAAACTGAGCTACAGTAAAAATGTACCTTGTGTACTCCAATATACTGATTTACCTTATATTCAGTATTTGGTTTTACAATAATAAGTGGGCTTAGATATGAGTATATACAGTAAGATCCTTGTTGTTGCTGACATCAATAATGATGAGCAGCCAGCACTTGCAAGAGCAGTTCAACTCGCTCGAAAAAGTGTATCCAGAAGCCGAATCACTTTCTTTCTGTCAATCTACGATTTTTCGTATGACATGACCTCAATGCTGTCGGTCGATGAAAGAGATGCTATGCGTCGCGGTGTTATCCACCAACGTGAACAATGGATGCGTAAGATAGCCCAACCGTATTTA GACGATAGCTTCGACTTTG SEQ ID NO. 2

[0057]

Claims

1. Knockout of genes encoding bacterial CRP / FNR family transcription regulators fnr Its application in inhibiting horizontal gene transfer is characterized by, The bacteria in question is Vibrio harveyi, and the gene encoding the CRP / FNR family transcription regulator is... fnr As shown in SEQ ID NO.1, 385 bp-1131 bp.

2. A type of Vibrio harveyi with low conjugation transfer efficiency, characterized in that, The gene encoding the CRP / FNR family transcription regulatory factor of Vibrio harveyi fnr The gene encoded by the CRP / FNR family transcriptional regulator was knocked out. fnr As shown in SEQ ID NO.1, 385 bp-1131 bp.

3. A method for constructing Vibrio harveyi with low conjugation transfer efficiency, characterized in that, It is the gene encoding the CRP / FNR family transcription regulator of Vibrio harveyi. fnr Knockout yielded Vibrio harveyi with low conjugation transfer efficiency, the gene encoding the CRP / FNR family transcriptional regulator. fnr As shown in SEQ ID NO.1, 385 bp-1131 bp.

4. The construction method according to claim 3, characterized in that, Includes the following steps: Step 1: Identify CRP / FNR family transcription factor encoding genes on the Vibrio harveyi genome. fnr Design gene knockout primers; Step 2: Using Vibrio harveyi as the starting strain, knock out the gene encoding the CRP / FNR family transcription regulator. fnr Correspondingly, gene-deleted strains were obtained. V. harveyi 345-Δ fnr, This refers to Vibrio harveyi, which has low conjugation transfer efficiency.

5. The construction method according to claim 4, characterized in that, The gene knockout primers mentioned in step one are: upstream homologous arm amplification primers: aagcttgatatcgaattcAAGCACCCAGTGTATG and atcgtgatctaagatggtgATCCAACTGATCCAGTTC, and downstream homologous arm amplification primers: gaactggatcagttggatCACCATCTTAGATCACGAT and ttggtaacgaatcagacCAAAGTCGAAGCTATCGTC.

6. The construction method according to claim 4, characterized in that, In step two, the knockout of the gene encoding the CRP / FNR family transcriptional regulator is described. fnr Specifically, the steps include the following: (1) PCR amplification of the above fnr Upstream and downstream homologous arms of genes and linearized suicide plasmids; (2) Recombinant plasmids were obtained by isothermal assembly of upstream and downstream homologous arms and linearized suicide plasmids, and the recombinant plasmids were successively transformed into intermediate hosts. E. coli GEB802 and donor bacteria E. coli In GEB883, positive clones were obtained by PCR identification; (3) Donor bacteria E. coli GEB883 cultured to the early logarithmic phase, recipient bacterium Vibrio harveyi V. harveyi 345 cultured to early logarithmic growth stage; (4) Early logarithmic recipient bacteria Vibrio harveyi V. harveyi 345 was heat-shocked at 40°C for 30 min and then treated with logarithmic early donor bacteria. E. coli GEB883 was used for bonding and transfer experiments; (5) Screening and identification of single-crossover clones and double-crossover clones, thus obtaining fnr Strains with gene deletions are Vibrio harveyi with low conjugation transfer efficiency. In step (1), the suicide plasmid is pSW7848; in step (5), the screening of single-exchange clones specifically refers to screening on plates containing 34 μg / mL chloramphenicol and 0.2% D-glucose; in step (5), the screening of double-exchange clones specifically refers to screening on plates containing 0.2% L-arabinose; in step (5), the identification specifically refers to designing primer pairs: GCATCAAAGTCGTTTTCCATCA and TCAGTATATTGGAGTACACAAGGTAC for PCR identification.

7. A method based on Vibrio harveyi fnr The method for knockout to suppress horizontal gene transfer is characterized by, The procedure includes the following steps: introducing the target exogenous plasmid into the conjugation transfer donor bacteria, and then conjugating it with Vibrio harveyi, which has low conjugation transfer efficiency, as described in claim 2.

8. The method according to claim 7, characterized in that, The exogenous plasmid is pMMB207, and the donor bacterium is Escherichia coli GEB883.

Images