Use of osnlp3 gene

Abstract

The application discloses application of an OsNLP3 gene and relates to the technical field of plant genetic engineering, wherein the amino acid sequence coded by the OsNLP3 gene is shown as SEQ ID NO. 2. By constructing an OsNLP3 gene overexpression plant, compared with a wild type control, the single gene expression amount of the OsNLP3 gene overexpression plant is enhanced, which leads to significant increase of total protein content of the rice, and the grain length, grain width and yield remain unchanged, the genetic effect is significant, and the OsNLP3 gene overexpression plant has great application potential and prospect for improvement of rice variety traits, and provides a new gene resource for rice nutrient breeding.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of plant genetic engineering, and particularly relates to application of an OsNLP3 gene. BACKGROUND

[0002] Proteins are basic requirements for human life, and are widely involved in various life regulation pathways. Insufficient intake seriously threatens the health of residents. As a storage material next only to starch, the content of protein in rice is about 7%-10% of the dry weight of rice. Therefore, increasing the protein content of rice to improve the nutritional quality of rice is an important way to ensure food safety production and improve the health of residents.

[0003] Proteins in rice are mainly divided into albumin, globulin, prolamin and glutelin, among which the content of glutelin is the most abundant, and glutelin mainly exists in the endosperm and the aleurone layer. Therefore, the content and composition of proteins in rice directly determine the nutritional quality of rice. The synthesis and metabolism of proteins in rice are controlled by complex environmental factors and gene regulation networks. Studies have shown that the protein content of rice is a quantitative trait controlled by multiple genes, and is extremely susceptible to environmental conditions. At present, 15 glutelin coding genes have been found in rice, mainly Glu family genes, further confirming that OsGluA2 is a positive regulator of seed protein content in rice (Yang, et al. 2019). Genome sequencing of rice found that there are 34 prolamin coding genes, and further research found that the expression level of the amino acid permease OsAAP6 in rice can promote the absorption and transport of amino acids by rice roots, accelerate the synthesis and accumulation of glutelin, albumin, prolamin and globulin in rice, and significantly improve the protein content of rice (Peng, et al. 2014). However, there are still natural variation sites and excellent genes with high protein content in rice, which need to be explored and applied. On the other hand, researchers have introduced multiple synthesis genes of important nutrients into rice as a chassis crop in recent years through synthetic biology and genetic engineering techniques to meet people's demand for nutrition and health, which has shown great application potential and market demand.

[0004] Therefore, it is feasible and has broad application prospects to improve the protein content and nutritional quality of rice by using synthetic biology techniques. SUMMARY

[0005] Therefore, the application provides an application of an OsNLP3 gene.

[0006] In order to achieve the above purpose, the application adopts the following technical scheme:

[0007] Application of the OsNLP3 gene: increasing the glutelin content of rice;

[0008] The amino acid sequence coded by the OsNLP3 gene is shown as SEQ ID NO. 2.

[0009] Preferably, the nucleotide sequence of the OsNLP3 gene is shown as SEQ ID NO. 1.

[0010] Another object of the present application is to provide the use of biological materials for increasing the expression amount of the OsNLP3 gene, and the use is for increasing the content of rice glutelin.

[0011] The biological materials are one of the following:

[0012] a. an expression cassette capable of over-expressing the OsNLP3 gene;

[0013] b. a recombinant vector containing the expression cassette of a;

[0014] c. a recombinant microorganism containing the expression cassette of a or the recombinant vector of b;

[0015] The amino acid sequence coded by the OsNLP3 gene is shown as SEQ ID NO. 2.

[0016] Preferably, the nucleotide sequence of the OsNLP3 gene is shown as SEQ ID NO. 1.

[0017] Another object of the present application is to provide a breeding method for increasing the content of rice glutelin, and the method uses transgenic means to increase the expression amount of the OsNLP3 gene.

[0018] The amino acid sequence coded by the OsNLP3 gene is shown as SEQ ID NO. 2.

[0019] Beneficial effects: the present application provides the use of the OsNLP3 gene. The increase of the single gene expression amount causes the increase of the total protein content of rice, and the traits such as grain length, grain width and yield do not change obviously, the genetic effect is significant, and the application potential and prospect for the improvement of the traits of rice varieties are huge, and the present application provides a new gene resource for the breeding of the protein content and nutritional quality of rice. BRIEF DESCRIPTION OF DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced. Obviously, the drawings in the following description are only embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of the provided drawings.

[0021] Figure 1The drawing is a plasmid map of the overexpression vector pU1301 provided by the application; wherein A is a linear schematic diagram of the vector; and B is a circular schematic diagram of the vector.

[0022] Figure 2 The drawing is a comparison of the expression amount of the OsNLP3 gene in the OsNLP3 transgenic plants overexpressing in the Kitaake background provided by the application, OE-OsNLP3-1 and OE-OsNLP3-2 represent two overexpression OsNLP3 plant numbers respectively, and the following figures refer to the same explanation as this figure.

[0023] Figure 3 The drawing is a data statistical chart of the grain type, thousand-grain weight and yield per plant of the OsNLP3 transgenic plants overexpressing in the Kitaake background provided by the application; wherein A is a photograph of the rice grain type, B is a photograph of the brown rice shape, C is the grain length, D is the grain width, E is the thousand-grain weight, and F is the yield per plant.

[0024] Figure 4 The drawing is a data statistical chart of the total protein content of the OsNLP3 transgenic plants overexpressing in the Kitaake background provided by the application.

[0025] Note: In the above drawings, ** and * respectively represent significant differences at the 0.01 and 0.05 levels of t-test, and no mark represents no significant difference. DETAILED DESCRIPTION

[0026] The technical solutions in the embodiments of the application will be described clearly and completely below with reference to the drawings in the embodiments of the application. Obviously, the described embodiments are only part of the embodiments of the application, rather than all the embodiments of the application. Based on the embodiments in the application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the application.

[0027] Example 1: Obtaining of the rice OsNLP3 gene overexpression plants and quantitative expression analysis

[0028] 1. Construction of the rice OsNLP3 gene overexpression vector

[0029] According to the OsNLP3 gene (LOC_Os01g13540) sequence published on Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu / ), a pair of PCR specific primers with restriction endonuclease Kpnl and BamHI joint (OsNLP3 F: CGGGGTACCATGGAGGTTGACCCATCGTC, SEQ ID NO. 3; OsNLP3 R: GCGGGATCC TCAACCTGAGCTTCCACAGG, SEQ ID NO. 4) were designed, and the cDNA of rice variety Kitaake was used as a template for PCR amplification. The reaction system was as follows: 2x Taq Mix 25 μL, cDNA 1 μL, primer-F / R 1 μL, and water to 50 μL. The PCR reaction program was as follows: 95 °C for 3 min, 95 °C for 30 sec, 55 °C for 30 sec, 72 °C for 60 sec, 72 °C for 5 min, 10 °C for 5 min, 35 cycles. The obtained gene OsNLP3 sequence was constructed into the pU1301 expression vector by homologous recombination (the plasmid map is shown in Figure 1). Figure 1 ).

[0030] OsNLP3 gene CDS sequence:

[0031]

[0032] The OsNLP3 amino acid sequence is:

[0033] MEVDPSSSLPGAGEGGGGGIGGGGGDLWPFDSLTTSLLFSSVSASPQPLPASSSSWLTPPSPLWLFDERQLLPLDMGAPAAPATAPPAEAAAVVEEVHRTRSGNSDTTSKRVDQINSKWQFHLSIDDNTDSSCLFKERLTQALRYFKESTDQHLLVQVWAPVKSGDRYVLTTSGQPFVLDQQSIGLLQYRAVSMMYMFSVDGENAGELGLPGRVYKQKVPEWTPNVQYYSSTEYPRLNHAISYNVHGTVALPVFDPSVQNCIAVVELIMTSKKINYAGEVDKVCKALEAVNLKSTEILDHPNVQICNEGRQSALVEILEILTVVCEEHKLPLAQTWVPCKYRSVLAHGGGVKKSCLSFDGSCMGEVCMSTSDVAFHVIDAHMWGFRDACVEHHLQKGQGVSGKAFIYRRPCFSKDISQFCKLEYPLVHYARMFGLAGCFAICLQSMYTGDDDYILEFFLPPNCRNEDDQNALLESILARMKKCLRTLKVVGNGDTNEVCLQISNVLIIETEDLKTNVHFENSEGCFRESPESNGSQRVHEVDNDGNKVSIMSERHLLADDNSQNNGASVGRPNGSGASDSLHKSNKPPERRRGKAEKTISLDVLQQYFSGSLKNAAKSLGVCPTTMKRICRQHGISRWPSRKINKVNRSLSKLKQVIESVQGSDAAFNLTSITGPLPIPVGPSSDSQNLEKASPNKVAELSNLAVEGDRDSSLQKPIENDNLAILMSQQGFIDANNNLQLEADKASHSRSSSGEGSINSRTSEASCHGSPANQTFVCKPIASTFAEPQLIPEAFTKEPFQEPALPLSRMLIEDSGSSKDLKNLFTSAVDQPFLARSSNLALMQNSGTVTIKASFKEDIVRFRFPCSGSVTALKDEVAKRLRMDVGMFDIKYLDDDHEWVKLACNADLEECMEISGSHVIRLLVSDVAAHLGSSCGSSG*, as SEQ ID NO. 2.

[0034] 2. Obtaining rice OsNLP3 gene overexpression plants

[0035] The obtained 1301-pUbi::OsNLP3 overexpression vector is transformed into rice by the method of Agrobacterium induction. The specific operation is as follows: the Agrobacterium transformation process is: -80℃ Agrobacterium competent is thawed on ice, 10 μL 1300-pUbi::OsNLP3 plasmid is added to 100 μL Agrobacterium competent, and the mixture is mixed by gently rotating and blowing with a gun head; after being inserted into ice for 20 min, it is quickly frozen in liquid nitrogen for 5 min and 37℃ water bath for 5 min; after being ice-bathed for 2 min, 1 mL of anti-LB liquid is added, and the culture is shaken at 28℃ for 2-4 h; after centrifugation at 8000 rpm at room temperature for 1 min, the supernatant is discarded, 100-200 μL of resuspended sediment is left, and LB (Kan 100 mg / L, Rif 125 mg / L) solid medium is coated, and the culture is incubated at 28℃ for 2-3 days. After single colonies grow, PCR screening is performed to identify positive engineering bacteria. Finally, the callus of Kitaake is transformed by Agrobacterium mediation to obtain T0 generation transgenic plants.

[0036] 3. Identification of rice OsNLP3 gene overexpression plants

[0037] Quantitative expression analysis in each tissue of rice Kitaake

[0038] Fresh rice Kitaak, OE-OsNLP3-1, and OE-OsNLP3-2 seed samples are taken in RNase-free centrifuge tubes and placed in liquid nitrogen, the mortar and grinding rod are sterilized with alcohol and pre-cooled in advance, and the sample is powdered by pouring an appropriate amount of liquid nitrogen into the mortar. After adding 1 mL Trizol and shaking, it is left at room temperature for 20 mins. After adding 200 μL chloroform and shaking, it is centrifuged at 13000 rpm at 4℃ for 10 mins, about 700 μL supernatant is taken into a new 1.5 mL RNase-free centrifuge tube, and an equal volume of isopropanol is added. After being mixed by inverting, it is centrifuged at 13000 rpm at 4℃ for 10 mins, the supernatant is discarded, the precipitate is washed with 75% ethanol solution (treated with DEPC H2O), and centrifuged at 13000 rpm at 4℃ for 5 mins. The supernatant is discarded, and the precipitate is dried for 1 min (the time should not be too long), 30 μL DEPC H2O is added to dissolve the RNA, and the mixture is stored at -80℃. The synthesis of cDNA (complementary DNA) uses a reverse transcription kit from TOYOBO Co., Ltd., 1 μg of RNA is reverse transcribed, and the reaction is stored at -20℃ after completion. Hieff UnMuLV First Strand cDNA Synthesis Kit from Shanghai Yisen Biotechnology Co., Ltd. is used to synthesize cDNA, and the reaction is stored at -20℃ after completion. The Power qPCR SYBR Green MasterMix was used to perform real-time fluorescence quantitative qPCR (quantitative PCR) reaction on the expression amount of the OsNLP3 gene. The results showed that, compared with the rice Kitaak, the overexpression plants OE-OsNLP3-1 and OE-OsNLP3-2 were positive plants (see attached Figure 2 ).

[0039] Example 2 Comparison of agronomic traits of OsNLP3 overexpression lines

[0040] All the obtained materials were planted in the test field of the Fuyang base of the China Rice Research Institute, with single-plant planting, row spacing of 19.8 cm, and plant spacing of 16.5 cm. All the field tests were uniformly managed following the normal production mode in the field. Yield trait investigation: after the rice matured, 10 plants in the middle of 12 single plants of the OsNLP3 overexpression lines were harvested, and the grains were naturally dried and then placed at room temperature for more than 3 months to ensure the dryness of the grains and the relative consistency of the water content among the lines. The grain type, 1000-grain weight, and single-plant yield were investigated. The number of single-plant ears was obtained by dividing the total effective ear number by the number of single plants, the number of grains per ear was obtained by dividing the total number of grains by the total number of ears, the 1000-grain weight was obtained by selecting 2 parts of 300 full grains and converting the weight, and the single-plant yield was obtained by dividing the weight of all grains by the number of single plants. Compared with the wild type, the grain length, 1000-grain weight, and yield of the OsNLP3 overexpression plants did not change significantly (see attached Figure 3 ).

[0041] Example 3 Identification of protein content of OsNLP3 overexpression plants

[0042] The main protein in rice is glutelin and prolamin. In order to identify the total protein content of brown rice, the total protein in wild type and transgenic lines of brown rice was extracted, and the specific operation was as follows: the mature brown rice was removed from the pan, ground into powder, placed in an oven at 80°C until constant weight, and then placed in a drying box until it cooled to room temperature. 25 mg of brown rice powder was weighed and placed in a 2 mL RNase-free centrifuge tube. 700 μL of seed total protein extraction solution (125 mM Tris-HCl (pH 6.8), 4% w / v SDS, 4M Urea) was added, 5% β-mercaptoethanol was added before use, and the brown rice powder and protein extraction solution were shaken and mixed well to prevent clumping. The sample was incubated in a metal bath at 50°C for 6 hours, and the sample was shaken and mixed every 30 minutes. Centrifuged at 13000 rpm for 8 mins, the supernatant was used for protein content identification. The specific identification method was as follows: 0.1 ml of the extraction solution was taken and added to a 10 ml graduated test tube, 5 ml of Coomassie Brilliant Blue G-250 reagent was added and mixed well, and then the test tube was placed in a 10 mm light path colorimetric cup and measured at 595 nm wavelength. The OD value was recorded, and finally the corresponding protein concentration was calculated according to the standard curve. Compared with the wild type, the total protein (glutelin and prolamin) content of the OsNLP3 overexpression plants was significantly increased (see Figure 6). Figure 4

[0043] Each of the embodiments in the specification is described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the embodiments can be referred to each other.

[0044] The above description of the disclosed embodiments enables a person skilled in the art to implement or use the present application. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application will not be limited to these embodiments shown herein, but will conform to the widest scope consistent with the principles and novel features disclosed herein.​

Claims

1. Increasing OsNLP3 the expression of the gene in improving the total protein content of rice, characterized in that, The OsNLP3 The amino acid sequence encoded by the gene is shown in SEQ ID NO.

2.

2. The method of increasing the yield of rice plants according to claim 1, wherein the expression level of the gene is increased by at least 10% compared to the expression level of the gene in a rice plant not transformed with the nucleic acid molecule. OsNLP3 The application of the expression level of the gene in increasing the total protein content of rice plants, characterized in that, The OsNLP3 The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

3. improving OsNLP3 application of a biomaterial to the amount of gene expression, characterized by, The application is: Increasing the total protein content of rice; The biological material is one of the following: a. capable of enabling OsNLP3 expression cassettes for gene overexpression; b. A recombinant vector containing the expression cassette of a; c. A recombinant microorganism containing the expression cassette of a or the recombinant vector of b; The OsNLP3 The amino acid sequence encoded by the gene is shown in SEQ ID NO.

2.

4. The use according to claim 3, wherein the biological material is a gene expression product. OsNLP3 4. The use according to claim 3, wherein the biological material is a gene expression product. The OsNLP3 The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

5. A breeding method for increasing total protein content in rice, characterized by, Increasing the expression of a gene using transgenic means OsNLP3 the expression of a gene The OsNLP3 The amino acid sequence encoded by the gene is shown in SEQ ID NO. 2.

Images