Method for gene repair of beta-deletion type thalassemia hematopoietic stem cells

Abstract

The invention provides a method for gene repair of beta-deletion type thalassemia hematopoietic stem cells, and belongs to the technical field of stem cells. According to the method, hematopoietic stem cells of a patient with beta-deletion thalassemia are subjected to in-vitro culture, gene editing is performed on the hematopoietic stem cells deleted in a 5'end regulation region of a beta-globin protein gene by applying a CRISPR / Cas9 gene editing technology, and deleted DNA fragments are inserted at fixed points. The hematopoietic stem cells subjected to gene repair are successfully sorted through flow cytometry sorting, PCR (polymerase chain reaction) detection and gene sequencing. The hematopoietic stem cells subjected to gene repair are differentiated into erythroid cells through in-vitro differentiation induction culture. Compared with normal cells, the mRNA transcriptional level of beta-globin protein is only 30.98% of that of the normal cells after differentiation induction of the hematopoietic stem cells with gene deletion in the 5 '-regulatory region, and the normal level is achieved after gene repair. The hematopoietic stem cells subjected to gene repair are expected to be subjected to lifelong treatment when being transfused back to patients.

Description

Technical Field

[0001] The present invention belongs to the technical field of stem cells, and in particular relates to a method for gene repair of hematopoietic stem cells for beta-deficient thalassemia. Background Art

[0002] Thalassemia is one of the most common single gene genetic diseases. β-thalassemia is a hereditary hemolytic anemia that is seriously harmful to human health. It is caused by point mutation or deletion of β-globin gene and its regulatory sequence, which leads to the reduction or complete cessation of β-globin peptide chain synthesis.

[0003] Blood transfusion therapy for severe thalassemia can relieve anemia symptoms, but it will aggravate the deposition of iron ions, eventually leading to organ failure and death. At present, the only possible means to cure thalassemia is bone marrow transplantation. However, allogeneic bone marrow transplantation faces two difficulties: immune rejection and graft-versus-host disease, so it is necessary to find a donor with matching major histocompatibility antigens to avoid the above-mentioned rejection reaction. In the absence of donors, gene modification and re-infusion of autologous hematopoietic stem cells has become a hope for the treatment of thalassemia. Compensation of normal β-globin through gene therapy is the most direct method for treating β-thalassemia. Hematopoietic stem cells have the ability to rebuild the omnipotence and self-renewal of an individual's hematopoietic system. In theory, the normal β-globin gene is introduced into hematopoietic stem cells to repair abnormal chromosomal DNA sequences and transfuse them back into the body so that they can be properly expressed. The patient will receive lifelong treatment. This is the gene therapy for β-thalassemia. However, hematopoietic stem cell gene repair has always faced challenges. Solving these difficulties requires finding safe and effective gene editing vectors and gene editing methods. Summary of the invention

[0004] The purpose of the present invention is to provide a method for gene repair of hematopoietic stem cells for β-deficient thalassemia, belonging to the technical field of stem cells.

[0005] To achieve the above object, the present invention provides the following technical solutions:

[0006] First, the present invention provides a method for gene repair of hematopoietic stem cells with β-deficient thalassemia, wherein the method for gene repair of hematopoietic stem cells comprises co-transfecting β-deficient thalassemia hematopoietic stem cells with gRNA, Cas9 mRNA and Donor DNA, and sorting the hematopoietic stem cells into which the Donor DNA is site-specifically inserted into the gene-deficient region.

[0007] Furthermore, the nucleotide sequence of the gRNA is SEQ ID NO.1.

[0008] Furthermore, the nucleotide sequence of the Donor DNA is SEQ ID NO.2.

[0009] Furthermore, the density of the hematopoietic stem cells during transfection was 1×10 6 cells / mL, and 5 μg of Donor DNA, 1 μg of Cas9 mRNA and 1 μg of gRNA were added to 100 μL of cells.

[0010] Secondly, the present invention provides a hematopoietic stem cell culture medium, the formula of the culture medium is StemSpanSFEMII hematopoietic stem cell serum-free culture medium added with 50 μg / L recombinant stem cell growth factor (rhSCF), 10 μg / L rhGM-CSF, 10 μg / L recombinant interleukin 1 (rhIL-1), and 10 μg / L recombinant interleukin 6 (rhIL-6).

[0011] Thirdly, the present invention provides a hematopoietic stem cell in vitro differentiation induction culture medium, the formula of the culture medium is StemSpan SFEMII serum-free culture medium supplemented with 50 μg / L recombinant stem cell growth factor (rhSCF), 10 μg / L recombinant interleukin 3 (rhIL-3), 0.5 U / ml recombinant human erythropoietin (rhEPO), and 1× cholesterol lipid.

[0012] Fourthly, the present invention provides an in vitro differentiation induction medium for hematopoietic stem cells, the formula of the medium being StemSpan SFEMII serum-free medium supplemented with 50 μg / L recombinant stem cell growth factor (rhSCF), 10 μg / L recombinant interleukin 3 (rhIL-3), 0.5 U / ml recombinant human erythropoietin (rhEPO), 1× cholesterol lipid, 50 μg / mL iron ion saturated transferrin, and 3 U / ml recombinant human erythropoietin (rhEPO).

[0013] The beneficial effect of the present invention is that, by culturing hematopoietic stem cells of patients with β-deficient thalassemia in vitro, CRISPR / Cas9 gene editing technology is applied to co-transfect gRNA, Cas9 mRNA and Donor DNA into hematopoietic stem cells with β-deficient thalassemia, and sorting into hematopoietic stem cells where Donor DNA is inserted into the gene deletion region. The gRNA used in the present invention guides the Cas9 protein to cut the target gene site with high efficiency, and co-transfection of gRNA and Cas9 mRNA can achieve gene scarless editing, overcoming the carcinogenic and pathogenic risks of gene editing by viral vectors such as lentivirus, which are currently widely used. Gene editing is performed on hematopoietic stem cells with a 5' end regulatory region deletion of the β-globin protein gene, and a DNA fragment with a fixed insertion is inserted into the deletion. Gene-repaired hematopoietic stem cells are successfully sorted by flow cytometer sorting, PCR detection and gene sequencing. Gene-repaired hematopoietic stem cells are differentiated into erythroid cells by in vitro differentiation induction culture. Compared with normal cells, the transcription level of β-globin protein mRNA in hematopoietic stem cells with 5' regulatory region gene deletion after differentiation induction is only 30.98% of that of normal cells, and the normal level is reached after gene repair. There is hope that gene-repaired hematopoietic stem cells can be transfused back into patients to provide lifelong treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 :pX330-Cas9gRNA plasmid map.

[0015] Figure 2 : Results of electrophoresis detection of hematopoietic stem cells with site-specific insertion of deleted genes.

[0016] Figure 2 Label number: M: DL2000 Maker, 1: cells with missing 5' regulatory region, 2: cells with failed gene repair, 3: cells with normal 5' regulatory region, 4: cells with successful gene repair.

[0017] Figure 3 :Detection of β-globin protein transcription level before and after gene repair. DETAILED DESCRIPTION

[0018] Example 1: Isolation and culture of hematopoietic stem cells

[0019] (1) Add 7.5 ml of Ficoll solution with a specific gravity of 1.017 to a 15 ml separation tube, slowly transfer an equal amount of bone marrow cell suspension, centrifuge at 2000 r / min at 4°C for 20 min after overall balance, aspirate the white blood cell layer, wash with RPMI1640 medium, and centrifuge at 2000 r / min at 4°C for 10 min. Take the white blood cell layer and add RPMI1640 medium to 10 ml to prepare a hematopoietic stem cell suspension sample.

[0020] (2) The isolated hematopoietic stem cell suspension sample was incubated with FcR Blocking Reagent and CD34 MicroBeads μLtraPure at 2-8°C for 30 minutes. The cells were washed and centrifuged to remove excess unlabeled magnetic beads, and the cells were resuspended to an appropriate volume.

[0021] According to the total cell count and CD34+ cells, select the appropriate MACS column and MACS separator. After incubation with CD34 MicroBeads, the cell mixture passes through the column, and CD34+ cells are adsorbed by the magnetic beads in the column; while non-CD34+ cells flow out of the column. After several washes, the flow-through can obtain CD34+ cells with higher purity. Through magnetic bead sorting, hematopoietic stem cells are enriched because they contain CD34+ cells.

[0022] Take freshly isolated CD34+ hematopoietic stem cells and adjust the cell density to 1×10 5 / ml, add 50μg / L recombinant stem cell growth factor (rhSCF), 10μg / L rhGM-CSF, 10μg / L recombinant interleukin 1 (rhIL-1), and 10μg / L recombinant interleukin 6 (rhIL-6) to StemSpan SFEMII hematopoietic stem cell serum-free medium. Place in a CO2 incubator with 5% CO2 and 37°C saturated humidity, replace half of the medium every 7 days, and after 3 weeks, the bottom of the culture well is covered with a monolayer of cells, and digested and passaged with 1% trypsin.

[0023] Example 2: Gene repair of bone marrow hematopoietic stem cells in β-deficient thalassemia

[0024] (1) gRNA design

[0025] The deletion of 201bp in the 5' regulatory region of the β-globin protein gene leads to low transcription levels of β-globin protein and insufficient synthesis of β-globin protein, which causes β-deficient thalassemia. Gene editing technology can be used to create a cut in the double-stranded DNA in the deletion region, and at the same time provide the correct insertion sequence to repair the deletion gene through homologous recombination, so as to repair the hematopoietic stem cells with gene deletion to hematopoietic stem cells with normal gene function. The hematopoietic stem cells that have been screened and repaired are transfused back to the patient, and multiple hematopoietic stem cell transfusions are expected to cure β-deficient thalassemia.

[0026] According to the β-globin protein gene GenBank: U01317.1 on chromosome 11 of healthy people and the β-globin protein gene 5' regulatory region deletion gene sequence K01897.1, gRNA was designed on the right side of the deletion sequence to guide Cas9 to cut on the right side of the gene deletion region to break the double-stranded DNA. The gRNA nucleotide sequence is the antisense sequence of 52115-52137bp of U01317.1, and the gRNA nucleotide sequence is SEQ ID NO.1: GCAGGCATGCACCACACGCCCGG, which conforms to the design principle of the gRNA sequence GN20NGG.

[0027] (2) Construction of gene editing system

[0028] The pX330-Cas9gRNA plasmid was constructed for site-directed mutagenesis of the β-globin protein gene 5' regulatory region deletion region right side. The T7 promoter drives gRNA transcription, and the SP6 promoter drives Cas9 gene transcription. The pX330-Cas9gRNA plasmid map is shown in Figure 1 .

[0029] The pX330-Cas9gRNA plasmid was linearized with NotI restriction endonuclease, electrophoresed on 1.5% agarose gel, and the target band was cut out and purified using an agarose gel recovery kit. TM SP6 transcription kit was used to transcribe the Cas9 gene mRNA in vitro, and the transcription product was purified using an RNA purification kit. TM T7 transcription kit was used to perform in vitro transcription to obtain gRNA, and the transcription product was purified using RNA purification kit. Cas9 mRNA and gRNA were dissolved in 20 μL TE buffer and stored in aliquots at -80°C.

[0030] (3) Design of gene repair insert

[0031] According to the β-globin protein gene GenBank: U01317.1 on chromosome 11 of healthy people and the β-globin protein gene 5' regulatory region deletion gene sequence K01897.1, the sequence between 100bp on the left side of the deletion sequence and 100bp on the right side of the gRNA cutting site was selected as the gene repair insertion fragment Donor, that is, 51777-52217bp of U01317.1, and the DNA sequence of Donor is SEQ ID NO. 2. The left and right 100bp of the deletion sequence are homologous arms, which are conducive to the homologous recombination of the insertion fragment Donor at the chromosome cutting site. A pair of primers donorF / donorR were designed to amplify the Donor sequence using the healthy human genome as a template.

[0032] The Donor DNA fragment was amplified by PCR using the NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs) high-fidelity enzyme system. The PCR reaction was a 50 μL system with a primer concentration of 0.5 μM and 2 μL normal human genomic DNA as a template. The PCR program was: 98°C pre-denaturation for 30 s; 98°C denaturation for 10 s, 55°C annealing for 20 s, and 72°C extension for 20 s; and finally 72°C extension for 5 min. The PCR product was subjected to 1.5% agarose gel electrophoresis, the target band was cut out, and the target fragment was recovered and purified using an agarose gel recovery kit as the gene repair insert fragment Donor DNA.

[0033] (4) Gene repair of β-deficient thalassemia gene in bone marrow hematopoietic stem cells

[0034] Bone marrow hematopoietic stem cells were passaged 36 hours before transfection. When the cell confluence in the cell culture flask reached 80%, the cells were digested with 1% trypsin, 20 mL of StemSpan SFEMII hematopoietic stem cell serum-free medium was added, the cells were counted, centrifuged at 1000 rpm for 10 min, and the cells were resuspended with StemSpan SFEMII hematopoietic stem cell serum-free medium to adjust the cell density to 1×10 6 cells / mL.

[0035] Pipette 100μL of cells into a 1.5mL EP tube, add 5μg Donor DNA, 1μg Cas9 mRNA and 1μg gRNA, mix with a pipette, and then pipette 100μL of the mixture into a 4mm electroporation cup. The electroporation cup was placed in an ECM 830 electroporator, and the electroporation parameters were set to 250V, 6msec, 625V / cm, and electroporation was performed once. Immediately after the electroporation, the cells were transferred to a 6-well cell culture plate and placed in a CO2 incubator with 5% CO2 and saturated humidity at 37°C for 24 hours. Single cells with green fluorescence were sorted into 96-well plates using a flow cytometer. Half of the culture medium was replaced every 7 days, and after 21 days, the bottom of the culture well was covered with a monolayer of cells. The cells were digested with 1% trypsin, the cell genomic DNA was extracted, and PCR amplification was performed with primers CXF / CXR to detect whether the Donor DNA was inserted into the cell genome.

[0036] As a result, the gene repair was successful, and the cells with the correct Donor DNA inserted could amplify a single band of 495bp. The gene repair failed, and the cells without the Donor DNA inserted amplified a single band of 294bp. After a large number of screenings, two cell lines were obtained that could amplify a single band of 495bp. DNA sequencing confirmed that both cells had the Donor DNA sequence correctly inserted, and the 201bp sequence missing in the 5' end regulatory region of the β-globin protein gene was inserted and repaired. The electrophoresis detection results are shown in Figure 2 .

[0037] (5) Verification of bone marrow hematopoietic stem cell function after repair

[0038] The 201bp sequence of the missing 5' regulatory region of the β-globin protein gene was inserted into the repaired bone marrow hematopoietic stem cells, and the cells were cultured in a CO2 incubator with 5% CO2 and 37°C saturated humidity for 21 days using StemSpan SFEMII serum-free medium supplemented with 50μg / L recombinant stem cell growth factor (rhSCF), 10μg / L recombinant interleukin 3 (rhIL-3), 0.5U / ml recombinant human erythropoietin (rhEPO), and 1× cholesterol lipid. Then, the cells were cultured in a CO2 incubator with 5% CO2 and 37°C saturated humidity for 21 days using StemSpan SFEMII serum-free medium supplemented with 50μg / L recombinant stem cell growth factor (rhSCF), 10μg / L recombinant interleukin 3 (rhIL-3), recombinant human erythropoietin (0.5U / ml), 1× cholesterol lipid, 50μg / mL iron saturated transferrin, and 3U / ml recombinant human erythropoietin (rhEPO), and the cells were cultured for another 21 days. Hematopoietic stem cells differentiate into red blood cells through in vitro differentiation induction culture.

[0039] The total RNA of cells after differentiation induction was extracted using RNeasy mini kit, and the β-globin gene transcription level was detected by qRT-PCR using TaqMan probe primers targeting β-globin mature mRNA. The primers and probes used are as follows:

[0040] βF:AGCTGTCCTCATGAATGTCT,

[0041] βR:CATGGAAGGAACACTTCAGG,

[0042] βPFAM-BHQ1:TCACTACCCATTTGCTTATCCTGC.

[0043] The results showed that compared with normal cells with 5' regulatory region of β-globin protein gene, the β-globin protein mRNA transcription level of hematopoietic stem cells with 5' regulatory region gene deletion after differentiation induction was only 30.98% of that of normal cells. The β-globin protein mRNA transcription level of cells after gene repair was no different from that of normal cells and reached the normal level.

Claims

1. A method for gene repair of hematopoietic stem cells in β-deficient thalassemia, characterized in that: The method for repairing the gene of hematopoietic stem cells is to co-transfect β-deficient thalassemia hematopoietic stem cells with gRNA, Cas9 mRNA and Donor DNA, and sort the hematopoietic stem cells into which the Donor DNA is inserted into the gene deletion region.

2. The method according to claim 1, characterized in that The nucleotide sequence of the gRNA is SEQ ID NO.

1.

3. The method according to claim 1, characterized in that The nucleotide sequence of the Donor DNA is SEQ ID NO.

2.

4. The method according to claim 1, characterized in that: The density of the hematopoietic stem cells during transfection is 1×10 6 cells / mL, 5μg Donor DNA, 1μg Cas9 mRNA and 1μg gRNA were added to 100μL cells.

5. A hematopoietic stem cell culture medium, characterized in that: The formula of the culture medium is StemSpan SFEMII hematopoietic stem cell serum-free culture medium with 50 μg / L recombinant stem cell growth factor (rhSCF), 10 μg / L rhGM-CSF, 10 μg / L recombinant interleukin 1 (rhIL-1), and 10 μg / L recombinant interleukin 6 (rhIL-6) added thereto.

6. A hematopoietic stem cell in vitro differentiation induction medium, characterized in that: The formula of the culture medium is StemSpanSFEMII serum-free culture medium supplemented with 50 μg / L recombinant stem cell growth factor (rhSCF), 10 μg / L recombinant interleukin 3 (rhIL-3), 0.5 U / ml recombinant human erythropoietin (rhEPO), and 1× cholesterol lipid.

7. A hematopoietic stem cell in vitro differentiation induction medium, characterized in that: The formula of the culture medium is StemSpanSFEMII serum-free culture medium supplemented with 50 μg / L recombinant stem cell growth factor (rhSCF), 10 μg / L recombinant interleukin 3 (rhIL-3), 0.5 U / ml recombinant human erythropoietin (rhEPO), 1× cholesterol lipid, 50 μg / mL iron ion saturated transferrin, and 3 U / ml recombinant human erythropoietin (rhEPO).

Images